FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2081749551> ?p ?o ?g. }

• W2081749551 endingPage "11970" @default.
• W2081749551 startingPage "11960" @default.
• W2081749551 abstract "Receptor-mediated induction of the human proenkephalin gene has been mapped to an imperfect palindrome located between -104 and -86, upstream of the transcriptional start site. Several lines of evidence suggest that receptor-mediated transcription of proenkephalin involves a reversible conformational change from duplex to a hairpin state of the enhancer [McMurray, C.T., Wilson, W.D., & Douglass, J.O. (1991) Proc. Natl. Acad. Sci. U.S.A. 88, 666]. To determine the structure that would form if such a conformational change took place, we have synthesized two 23-bp oligonucleotides, d(GCTGGCGTAGGGCCTGCGTCAGC) and d(GCTGACGCAGGCCCTACGCCAGC), whose sequences are identical to the top and the bottom strands of the native enhancer. We have found that each oligonucleotide strand exists primarily as a hairpin structure over a wide range of oligonucleotide concentrations and a wide range of temperatures (0-45 degrees C). The assignment of each imino proton was carried out using 1D and 2D nuclear Overhauser effects (NOE) and by comparison with the spectra of hairpins containing single base substitutions. The hairpin structure for each oligonucleotide contains a 3-member loop, a 10-bp stem, and two mismatched pairs. The hairpin that forms from the top strand of the enhancer and contains two GT mispaired bases creates an alternative binding site for the cyclic adenosine monophosphate element binding protein (CREB), a transcription factor that binds to and regulates the human proenkephalin gene. Circular dichroism and 31P NMR indicate that, despite the presence of mismatched pairs, each oligonucleotide hairpin adopts a B-form conformation with no unusual bending or kinking. The structure of the hairpin may explain the effect on expression of point mutations within the enhancer." @default.
• W2081749551 created "2016-06-24" @default.
• W2081749551 creator A5013955348 @default.
• W2081749551 creator A5039551115 @default.
• W2081749551 creator A5040355138 @default.
• W2081749551 creator A5043681590 @default.
• W2081749551 creator A5058921608 @default.
• W2081749551 creator A5060002817 @default.
• W2081749551 creator A5063103978 @default.
• W2081749551 date "1994-10-04" @default.
• W2081749551 modified "2023-09-27" @default.
• W2081749551 title "Hairpin Formation within the Human Enkephalin Enhancer Region. 2. Structural Studies" @default.
• W2081749551 cites W1515935592 @default.
• W2081749551 cites W1555757452 @default.
• W2081749551 cites W1978743038 @default.
• W2081749551 cites W1987519198 @default.
• W2081749551 cites W1988568219 @default.
• W2081749551 cites W1996409695 @default.
• W2081749551 cites W2004862139 @default.
• W2081749551 cites W2005393972 @default.
• W2081749551 cites W2007147088 @default.
• W2081749551 cites W2008570049 @default.
• W2081749551 cites W2014203128 @default.
• W2081749551 cites W2015292413 @default.
• W2081749551 cites W2017093132 @default.
• W2081749551 cites W2024322354 @default.
• W2081749551 cites W2028753366 @default.
• W2081749551 cites W2038996298 @default.
• W2081749551 cites W2039478144 @default.
• W2081749551 cites W2041590410 @default.
• W2081749551 cites W2042932259 @default.
• W2081749551 cites W2050472713 @default.
• W2081749551 cites W2053993290 @default.
• W2081749551 cites W2062001904 @default.
• W2081749551 cites W2067388503 @default.
• W2081749551 cites W2068577315 @default.
• W2081749551 cites W2071138881 @default.
• W2081749551 cites W2073840606 @default.
• W2081749551 cites W2078085951 @default.
• W2081749551 cites W2080648180 @default.
• W2081749551 cites W2085662415 @default.
• W2081749551 cites W2088221773 @default.
• W2081749551 cites W2092784580 @default.
• W2081749551 cites W2093700493 @default.
• W2081749551 cites W2096484165 @default.
• W2081749551 cites W2097641673 @default.
• W2081749551 cites W2134939519 @default.
• W2081749551 cites W2142611091 @default.
• W2081749551 cites W2177743694 @default.
• W2081749551 cites W2201892421 @default.
• W2081749551 cites W2416022039 @default.
• W2081749551 cites W28039676 @default.
• W2081749551 cites W4232854069 @default.
• W2081749551 cites W4233234342 @default.
• W2081749551 cites W4245364714 @default.
• W2081749551 cites W4252946136 @default.
• W2081749551 doi "https://doi.org/10.1021/bi00205a035" @default.
• W2081749551 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/7918415" @default.
• W2081749551 hasPublicationYear "1994" @default.
• W2081749551 type Work @default.
• W2081749551 sameAs 2081749551 @default.
• W2081749551 citedByCount "14" @default.
• W2081749551 crossrefType "journal-article" @default.
• W2081749551 hasAuthorship W2081749551A5013955348 @default.
• W2081749551 hasAuthorship W2081749551A5039551115 @default.
• W2081749551 hasAuthorship W2081749551A5040355138 @default.
• W2081749551 hasAuthorship W2081749551A5043681590 @default.
• W2081749551 hasAuthorship W2081749551A5058921608 @default.
• W2081749551 hasAuthorship W2081749551A5060002817 @default.
• W2081749551 hasAuthorship W2081749551A5063103978 @default.
• W2081749551 hasConcept C104317684 @default.
• W2081749551 hasConcept C107824862 @default.
• W2081749551 hasConcept C111936080 @default.
• W2081749551 hasConcept C12554922 @default.
• W2081749551 hasConcept C129312508 @default.
• W2081749551 hasConcept C133571119 @default.
• W2081749551 hasConcept C153911025 @default.
• W2081749551 hasConcept C170493617 @default.
• W2081749551 hasConcept C185592680 @default.
• W2081749551 hasConcept C2777515746 @default.
• W2081749551 hasConcept C2777803847 @default.
• W2081749551 hasConcept C2781063702 @default.
• W2081749551 hasConcept C552990157 @default.
• W2081749551 hasConcept C55493867 @default.
• W2081749551 hasConcept C71240020 @default.
• W2081749551 hasConcept C86339819 @default.
• W2081749551 hasConcept C86803240 @default.
• W2081749551 hasConceptScore W2081749551C104317684 @default.
• W2081749551 hasConceptScore W2081749551C107824862 @default.
• W2081749551 hasConceptScore W2081749551C111936080 @default.
• W2081749551 hasConceptScore W2081749551C12554922 @default.
• W2081749551 hasConceptScore W2081749551C129312508 @default.
• W2081749551 hasConceptScore W2081749551C133571119 @default.
• W2081749551 hasConceptScore W2081749551C153911025 @default.
• W2081749551 hasConceptScore W2081749551C170493617 @default.
• W2081749551 hasConceptScore W2081749551C185592680 @default.
• W2081749551 hasConceptScore W2081749551C2777515746 @default.
• W2081749551 hasConceptScore W2081749551C2777803847 @default.

• next