FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2082433420> ?p ?o ?g. }

• W2082433420 endingPage "23425" @default.
• W2082433420 startingPage "23414" @default.
• W2082433420 abstract "The protein kinase C (PKC) family has been implicated in the regulation of apoptosis. However, the contribution of individual PKC isozymes to this process is not well understood. We reported amplification of the chromosome 2p21 locus in 28% of thyroid neoplasms, and in the WRO thyroid carcinoma cell line. By positional cloning we identified a rearrangement and amplification of the PKCε gene, that maps to 2p21, in WRO cells. This resulted in the overexpression of a chimeric/truncated PKCε (Tr-PKCε) mRNA, coding for N-terminal amino acids 1–116 of the isozyme fused to an unrelated sequence. Expression of the Tr-PKCε protein in PCCL3 cells inhibited activation-induced translocation of endogenous PKCε, but its kinase activity was unaffected, consistent with a dominant negative effect of the mutant protein on activation-induced translocation of wild-type PKCε and/or displacement of the isozyme to an aberrant subcellular location. Cell lines expressing Tr-PKCε grew to a higher saturation density than controls. Moreover, cells expressing Tr-PKCε were resistant to apoptosis, which was associated with higher Bcl-2 levels, a marked impairment in p53 stabilization, and dampened expression of Bax. These findings point to a role for PKCε in apoptosis-signaling pathways in thyroid cells, and indicate that a naturally occurring PKCε mutant that functions as a dominant negative can block cell death triggered by a variety of stimuli. The protein kinase C (PKC) family has been implicated in the regulation of apoptosis. However, the contribution of individual PKC isozymes to this process is not well understood. We reported amplification of the chromosome 2p21 locus in 28% of thyroid neoplasms, and in the WRO thyroid carcinoma cell line. By positional cloning we identified a rearrangement and amplification of the PKCε gene, that maps to 2p21, in WRO cells. This resulted in the overexpression of a chimeric/truncated PKCε (Tr-PKCε) mRNA, coding for N-terminal amino acids 1–116 of the isozyme fused to an unrelated sequence. Expression of the Tr-PKCε protein in PCCL3 cells inhibited activation-induced translocation of endogenous PKCε, but its kinase activity was unaffected, consistent with a dominant negative effect of the mutant protein on activation-induced translocation of wild-type PKCε and/or displacement of the isozyme to an aberrant subcellular location. Cell lines expressing Tr-PKCε grew to a higher saturation density than controls. Moreover, cells expressing Tr-PKCε were resistant to apoptosis, which was associated with higher Bcl-2 levels, a marked impairment in p53 stabilization, and dampened expression of Bax. These findings point to a role for PKCε in apoptosis-signaling pathways in thyroid cells, and indicate that a naturally occurring PKCε mutant that functions as a dominant negative can block cell death triggered by a variety of stimuli. protein kinase C receptor for activated C kinase truncated PKCε thyrotropin bacterial artificial chromosome polymerase chain reaction phosphate-buffered saline polyacrylamide gel electrophoresis rapid amplification of cDNA ends kilobase(s) 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide phorbol 12-myristate acetate Protein kinase C (PKC)1isozymes are involved in signal transduction pathways controlling growth, differentiation, and apoptosis (1Toker A. Front. Biosci. 1998; 3: D1134-1147Crossref PubMed Google Scholar, 2Lucas M. Sanchez-Margalet V. Gen. Pharmacol. 1995; 26: 881-887Crossref PubMed Scopus (100) Google Scholar). In addition, PKCs are the major cellular receptors for the tumor promoter phorbol esters and related compounds. Because of this, there has been considerable interest in the potential role of PKC isozymes in the multistage process of carcinogenesis. However, isolating the role of the individual isozymes has proven to be complex due to apparent similarity in their substrate specificity, at least in vitro , as well as overlapping sensitivity to activators and inhibitors. The PKC gene family is divided into three subgroups based on sequence homology and cofactor requirements: conventional PKC (α, βI, βII, and γ) which are dependent on Ca2+ for activation, nonconventional PKCs (δ, ε, η, and θ) that are not dependent on Ca2+ for activation, and atypical PKCs (ζ, λ/ι) which are not stimulated by diacylglycerol or phorbol esters and are Ca2+ independent (3Newton A.C. Curr. Opin. Cell Biol. 1997; 9: 161-167Crossref PubMed Scopus (851) Google Scholar). Cell signal pathways involving the PKC family are initiated by binding of a ligand to its respective cell surface receptor, which triggers the breakdown of phospholipids by phospholipase C and D producing many products including diacylglycerol (3Newton A.C. Curr. Opin. Cell Biol. 1997; 9: 161-167Crossref PubMed Scopus (851) Google Scholar, 4Berridge M.J. Irvine R.F. Nature. 1989; 341: 197-205Crossref PubMed Scopus (3313) Google Scholar). Diacylglycerol binds to and activates most PKC isozymes, which then relocate to specific subcellular compartments that vary between the PKC isozymes as well as between cell types (5Goodnight J. Mischak H. Kolch W. Mushinski J.F. J. Biol. Chem. 1995; 270: 9991-10001Abstract Full Text Full Text PDF PubMed Scopus (292) Google Scholar, 6Mochly-Rosen D. Science. 1995; 268: 247-251Crossref PubMed Scopus (835) Google Scholar). This relocation results from distinct protein-protein interactions, many of which are likely to be isozyme specific. Jaken, Scott, and collaborators (7Kiley S.C. Jaken S. Whelan R. Parker P.J. Biochem. Soc. Trans. 1995; 23: 601-605Crossref PubMed Scopus (47) Google Scholar, 8Faux M.C. Scott J.D. J. Biol. Chem. 1997; 272: 17038-17044Abstract Full Text Full Text PDF PubMed Scopus (98) Google Scholar, 9Klauck T.M. Faux M.C. Labudda K. Langeberg L.K. Jaken S. Scott J.D. Science. 1996; 271: 1589-1592Crossref PubMed Scopus (483) Google Scholar, 10Hyatt S.L. Liao L. Chapline C. Jaken S. Biochemistry. 1994; 33: 1223-1228Crossref PubMed Scopus (80) Google Scholar, 11Hyatt S.L. Liao L. Aderem A. Nairn A.C. Jaken S. Cell Growth Differ. 1994; 5: 495-502PubMed Google Scholar, 12Dell'Acqua M.L. Faux M.C. Thorburn J. Thorburn A. Scott J.D. EMBO J. 1998; 17: 2246-2260Crossref PubMed Scopus (203) Google Scholar) have identified talin, vinculin, a myristoylated protein kinase C substrate, a β-adducin homolog, AKAP79, as well as gravin/AKAP250 as PKC-associated proteins that require phosphatidylserine for binding. The binding of diacylglycerol is believed to lead to activation and relocalization of the PKCs through conformational changes that expose the catalytic domain as well as the region involved in binding to the docking site after translocation. This docking site has been termed RACK (receptor for activated C kinase), and each isozyme has been postulated to have its own specific RACK (6Mochly-Rosen D. Science. 1995; 268: 247-251Crossref PubMed Scopus (835) Google Scholar, 13Mochly-Rosen D. Khaner H. Lopez J. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 3997-4000Crossref PubMed Scopus (442) Google Scholar), which is thought to determine the specific cellular location of the activated PKC isozymes. This property has been exploited for the past few years to develop isozyme-specific competitive antagonists (for review, see Ref. 14Souroujon M.C. Mochly-Rosen D. Nat. Biotechnol. 1998; 16: 919-924Crossref PubMed Scopus (201) Google Scholar). In a previous report (15Chen X. Knauf J.A. Gonsky R. Wang M. Lai E.H. Chissoe S. Fagin J.A. Korenberg J.R. Am. J. Hum. Genet. 1998; 63: 625-637Abstract Full Text Full Text PDF PubMed Scopus (56) Google Scholar) we describe the use of comparative genomic hybridization to detect regions of allelic imbalance in thyroid tumors, including an amplification event on chromosome 2p21 in 28% of the thyroid neoplasms examined, as well as in the clonal thyroid carcinoma cell line WRO. Positional cloning and sequencing of a BAC mapping to the 2p21 amplicon identified a candidate gene, protein kinase Cε (PKCε), which was amplified in the WRO cell line. Here we extended the analysis of this genetic event by describing that the PKCε gene was not only amplified, but also rearranged in the WRO cells. This complex genetic aberration leads to the overexpression of a chimeric and truncated PKCε (Tr-PKCε). The Tr-PKCε protein reported here is nearly identical to an N-terminal PKCε fragment which has been demonstrated to specifically inhibit both activation-induced translocation of wild-type PKCε to its intracellular binding site as well as the biological effects mediated by this enzyme (16Johnson J.A. Gray M.O. Chen C.H. Mochly-Rosen D. J. Biol. Chem. 1996; 271: 24962-24966Abstract Full Text Full Text PDF PubMed Scopus (343) Google Scholar, 17Hundle B. McMahon T. Dadgar J. Chen C.H. Mochly-Rosen D. Messing R.O. J. Biol. Chem. 1997; 272: 15028-15035Abstract Full Text Full Text PDF PubMed Scopus (88) Google Scholar, 18Yedovitzky M. Mochly-Rosen D. Johnson J.A. Gray M.O. Ron D. Abramovitch E. Cerasi E. Nesher R. J. Biol. Chem. 1997; 272: 1417-1420Abstract Full Text Full Text PDF PubMed Scopus (164) Google Scholar). We provide evidence that this truncated gene product interferes with the function of the wild-type isozyme in clonal thyroid cell lines and results in significant alterations in growth and apoptosis. In addition, we show that the inhibition of apoptosis in cells expressing Tr-PKCε is associated with impairment of the expected stabilization of p53 induced by DNA damage, and of the consequent activation of Bax. These data indicate that PKCε is involved in apoptosis signaling in thyroid cells, and raise the possibility that that loss of expression or function of PKCε may participate in thyroid tumorigenesis by inhibiting programmed cell death. The human thyroid carcinoma cell lines NPA, ARO, and WRO were a gift of G. Juilliard (UCLA), and propagated in RPMI 1640 medium containing 10% fetal calf serum, non-essential amino acids (Irvine Scientific, Irvine, CA), glutamine (286 mg/liter), penicillin, and streptomycin (Life Technologies, Inc., Gaithersburg, MD), as described (19Zeki K. Spambalg D. Sharifi N. Gonsky R. Fagin J.A. J. Clin. Endocrinol. Metab. 1994; 79: 1317-1321Crossref PubMed Scopus (0) Google Scholar). PCCL3 cells were propagated in H6 medium, which consisted of Coons modification of Ham's F-12 media (Irvine Scientific, Irvine, CA) containing 5% fetal calf serum, glutamine (286 mg/l), somatostatin (10 ng/ml), glycyl-l-histidyl-l-lysin acetate (10 ng/ml), transferrin (5 μg/ml), hydrocortisone (10 nm), insulin (10 μg/ml), thyroid stimulating hormone (TSH, 10 mIU/ml), penicillin, and streptomycin, as described (20Fusco A. Berlingieri M.T. Di Fiore P.P. Portella G. Grieco M. Vecchio G. Mol. Cell. Biol. 1987; 7: 3365-3370Crossref PubMed Scopus (246) Google Scholar). WRO cell chromosome preparations were hybridized with the indicated bacterial artificial chromosome (BAC) clone as described previously (21Korenberg J.R. Chen X.N. Cytogenet. Cell Genet. 1995; 69: 196-200Crossref PubMed Scopus (50) Google Scholar). Briefly, the indicated BACs were biotin-labeled and hybridized to chromosome slides made from the WRO cell line. The images were captured using a Photometrics cooled-CCD camera (CH250) and Oncor image analysis system equipped with a Zeiss 135 Axovert fluorescence microscope. Southern blots of 10 μg of genomic DNA from the indicated sources digested with either Eco RI or Bam HI were performed as described (15Chen X. Knauf J.A. Gonsky R. Wang M. Lai E.H. Chissoe S. Fagin J.A. Korenberg J.R. Am. J. Hum. Genet. 1998; 63: 625-637Abstract Full Text Full Text PDF PubMed Scopus (56) Google Scholar). Membranes were probed with either the full-length (2.2 kb) human PKCε cDNA obtained by Nhe I digestion of the PKCε/pBluebac expression vector (22Burns D. Strickland M. Holmes W. Loomis C. Ballas L. Biochim. Biophys. Acta. 1992; 1134: 154-160Google Scholar) or PCR products generated from the indicated regions of PKCε cDNA. Probes were labeled with [32P]dCTP by random priming (Stratagene, San Diego, CA). Northern blots of 20 μg of total RNA were performed as described (23Church G.M. Gilbert W. Prog. Clin. Biol. Res. 1985; 177: 17-21PubMed Google Scholar, 24Gonsky R. Knauf J.A. Elisei R. Wang J.W. Su S. Fagin J.A. Nucleic Acids Res. 1997; 25: 3823-3831Crossref PubMed Scopus (34) Google Scholar) and hybridized with a full-length human [32P]dCTP-labeled PKCε cDNA. After washing, cells were scraped from the plate in ice-cold PBS and collected by centrifugation at 1000 × g for 10 min. The pellet was resuspended in buffer A (10 mmTris-HCl, pH 7.5, 5.0 mm EDTA, 100 μg/ml phenylmethylsulfonyl fluoride, 4.0 mm EGTA, 1 μg/ml aprotinin, 5 μg/ml E-64, 1 μg/ml leupeptin, and 1 μg/ml pepstatin) containing 1% Triton X-100 and then lysed by passing through a 27-gauge needle 10 times. The lysate was then centrifuged at 10,000 × g for 15 min at 4 °C, the supernatant collected, and the protein concentration determined. Equal amounts of protein from each sample was then subjected to SDS-PAGE. For preparation of soluble and particulate fractions the cells were homogenized in buffer B consisting of 50 mm Tris-HCl, pH 7.5, 5.0 mm EDTA, 100 μg/ml phenylmethylsulfonyl fluoride, 4.0 mm EGTA, 1 μg/ml aprotinin, 5 μg/ml E-64, 1 μg/ml leupeptin, and 1 μg/ml pepstatin by passing them through a 27-gauge needle 10 times. Soluble and particulate fractions were then separated by ultracentrifugation (100,000 × g for 1 h). The supernatant (soluble fraction) was removed and the pellet resuspended in buffer B with 1% Triton X-100. The Triton X-100-insoluble material was removed by centrifugation at 100,000 × g for 1 h and the supernatant collected (particulate fraction). The distribution of the PKC isozymes in the various fractions was then analyzed by Western blotting. To better determine the distribution and relocation of PKCε after activation, PCCL3 cells were subfractionated into four parts as follows. The cells were washed and scraped from the plate in ice-cold PBS. The cells were then washed with ice-cold buffer A and collected by centrifugation. The cell pellet was then resuspended in buffer A and the mixture incubated on ice for 10 min, passed through a 27-gauge needle 10 times, and the nuclei pelleted by centrifugation at 1000 × g for 10 min. The supernatant was removed and centrifuged at 100,000 × g at 4 °C for 60 min. The resulting supernatant (fraction F1, cytosol) was collected and the pellet resuspended in buffer A with 1% Triton X-100. The resuspended pellet was centrifuged at 100,000 × g at 4 °C for 60 min and the resulting supernatant collected (fraction F2, particulate extract). The intact nuclei were lysed by resuspending them in buffer A containing 600 mm KCl and centrifuged at 100,000 ×g at 4 °C for 60 min and the resulting supernatant collected (fraction F3, nucleoplasm). The pellet was resuspended in buffer A with 1.0% Triton X-100, centrifuged at 100,000 ×g at 4 °C for 60 min, and the supernatant collected (fraction F4, Triton-soluble nuclear extract). To remove the KCl from F3, the proteins were precipitated by the addition of trichloroacetic acid to a final concentration of 2%. The precipitated proteins were collected by centrifugation and the pellet resuspended in buffer A. The protein concentration of all fractions was determined using the micro BCA reagent, as directed by manufacturer (Pierce, Rockford, IL). The indicated amount of protein from total cell lysates or cellular fractions were subjected to SDS-PAGE and Western blotting as described (25Laemmli U.K. Nature. 1970; 227: 680-685Crossref PubMed Scopus (207537) Google Scholar, 26Towbin H. Staehelin T. Gordon J. Proc. Natl. Acad. Sci. U. S. A. 1979; 76: 4350-4354Crossref PubMed Scopus (44939) Google Scholar). Blots were hybridized with antibodies to the indicated proteins and then with their corresponding species-specific horseradish peroxidase-conjugated secondary IgG and visualized using the Supersignal CL-HRP system (Pierce) as directed by manufacturer. The 3′ RACE reaction was performed as described in Frohmanet al. (27Frohman M.A. Dush M.K. Martin G.R. Proc. Natl. Acad. Sci. U. S. A. 1988; 85: 8998-9002Crossref PubMed Scopus (4341) Google Scholar), except that the 5′ primer was specific for exon 1 of PKCε (TGCCCTCAATGTGGACGACTC). In addition, the second round of PCR amplification was performed under the following conditions: 95 °C for 45 s, 60 °C for 30 s, and 72 °C for 3 min. The PCR products generated were cloned into the pCR-II vector by TA cloning, as directed by the manufacturer (InVitrogen, Carlsbad, CA). Cloned inserts that were confirmed to contain exon 1 of PKCε by Southern blot analysis were sequenced using an ABI 373 automatic sequencer. Poly(A)+ RNA was isolated from the WRO cell line using a PolyATtract mRNA system (Promega, Madison, WI). cDNA was generated from poly(A)+ RNA and then cloned into a λ expression vector using a ZAP Express Vector Kit (Stratagene, San Diego, CA). The λ cDNA library was then screened as directed by the manufacturer (Stratagene), using a probe labeled by random priming in the presence of [32P]dCTP. The probe used was generated by PCR amplification of a clone obtained by 3′ RACE (described above) which contained part of PKCε exon 1 (base 140–364) and a 3′ end that did not correspond to either intron 1 or exon 2, and was thought to have resulted from a rearrangement of the PKCε gene. Positive plaques were isolated and the ExAssist helper phage (Stratagene) used to generate a recircularized pBK-CMV phagemid (Stratagene) containing the positive cDNA. DNA isolated from these clones were reconfirmed by Southern blotting to contain exon 1 of PKCε, and then sequenced using an ABI sequencing machine. The expression construct containing the Tr-PKCε (amino acids 1–116) was obtained, as described above, from the in vivo excision of a clone isolated from the WRO cDNA library. The expression construct containing the V1 region of PKCε (amino acids 2–142 (16Johnson J.A. Gray M.O. Chen C.H. Mochly-Rosen D. J. Biol. Chem. 1996; 271: 24962-24966Abstract Full Text Full Text PDF PubMed Scopus (343) Google Scholar)) was a generous gift from Dr. Robert Messing (University of California, San Francisco) and has been previously described (17Hundle B. McMahon T. Dadgar J. Chen C.H. Mochly-Rosen D. Messing R.O. J. Biol. Chem. 1997; 272: 15028-15035Abstract Full Text Full Text PDF PubMed Scopus (88) Google Scholar). PCCL3 cells were plated (5 × 105 cells/35-mm dish) and grown at 37 °C with 5% CO2. After 24 h the cells were transfected by LipofectAMINE-mediated gene transfer, as directed by the manufacturer (Life Technologies, Inc.). Briefly, 10 μl of LipofectAMINE were incubated with 1.0 μg of plasmid and 200 μl of serum-free medium for 30 min at room temperature. Then 800 μl of serum-free medium was added to the LipofectAMINE-plasmid mixture and the entire solution added to a plate which had been previously washed twice with PBS. Cells were incubated at 37 °C in 5% CO2for 5–8 h and the transfection mixture replaced with H6 medium. After 24 h the cells were trypsinized and divided into four 100-mm dishes and single clones selected in H6 medium containing 300 μg/ml G418 (Life Technologies, Inc.). The mass-transfected lines were created as above except that after splitting into 100-mm dishes, individual G418 clones were not isolated, but instead, all G418-resistant colonies growing on that dish were pooled. Neomycin-resistant control cell lines were created by transfecting the pBK-CMV vector alone. Cells were plated into each of the four wells of a 4-well chamber-slide and incubated with H6 medium. When the cells became confluent, the medium was replaced by H6 medium with or without 100 nm PMA, and the cells incubated for 20 min at 37 °C with 5% CO2. Cells were washed 3 times with ice-cold PBS and fixed by incubating the slides in 50:50 methanol/acetone at −20 °C for 4 min. Nonspecific interaction was blocked by a 30-min incubation in PBS containing 2 mg/ml bovine serum albumin, 10% goat serum, and 0.1% Triton X-100. Cells were then incubated in PBS containing 2 mg/ml bovine serum albumin, 5% goat serum, and polyclonal anti-PKCε IgG (Santa Cruz Biotechnology) for 16 h at 4 °C. The cells were washed with 3 sequential 5-min incubations in PBS containing 2 mg/ml bovine serum albumin, followed by a 2-h incubation at room temperature in PBS containing 2 mg/ml bovine serum albumin, 5% goat serum, and fluorescein isothiocyanate-conjugated goat anti-rabbit IgG (Jackson ImmunoResearch Laboratories, Inc., West Grove, PA). The slides were washed again 3 times and then mounted in Vectorshield (Vector Laboratories Inc., Burlingame, CA). They were viewed under a Zeiss Axiophot microscope. The images were captured onto Kodak 6400 ASA film using an MC100 camera. Cells were washed and then scraped from the plate in ice-cold PBS, and collected by centrifugation at 1000 × g for 10 min. The cell pellet was resuspended in extraction buffer (20 mm Tris-HCl, pH 7.5, 0.5% Nonidet P-40, 250 mmNaCl, 3 mm EDTA, 1 mm EGTA, 1 mmdithiothreitol, 2 mm Na3VO4, 25 μg/ml aprotinin, 25 μg/ml leupeptin, 100 μg/ml phenylmethylsulfonyl fluoride) and passed through a 27-gauge needle 10 times, and then centrifuged for 15 min at 10,000 × g at 4 °C. The supernatant was collected and the protein concentration determined. Extracts were diluted into extraction buffer (final protein concentration 1 μg/μl) and added to 3 μg of rabbit anti-PKCε IgG (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) which had been preincubated with protein G-agarose overnight at 4 °C. This mixture was then incubated for 4 h at 4 °C. The beads were then washed 3 times with PBS containing 0.1% Triton X-100 and then 3 times with kinase buffer (20 mm HEPES, pH 7.2, 137 mmNaCl, 5.4 mm NaH2PO4, 0.4 mm KH2PO4, 25 mmβ-glycerophosphate, 10 mm MgCl2, 0.5 mm EGTA, and 0.25 mm CaCl2). Beads were resuspended in kinase buffer containing 0.013 μCi/μl [γ-32P]ATP, 50 μm ATP, 125 ng/μl PKA inhibitor, and 0.4 mg/ml myelin basic protein and incubated at room temperature for 30 min. The reaction was stopped by adding SDS-PAGE loading buffer and then incubating at 95 °C for 5 min. The reaction was then size separated by 15% SDS-PAGE, transferred to a nylon membrane, and phosphorylation of the myelin basic protein quantitated by PhosphorImager analysis. Background was determined by substituting normal rabbit IgG for the rabbit anti-PKCε IgG. The plating efficiency (ratio of cells attached to cells plated) of each clone was determined by plating a known number of cells in H6 medium. The plate was incubated for 24 h at 37 °C in 5% CO2 at which time the cells were detached by trypsinization and counted with a Z1 Coulter counter. Plating of each clone for growth curves was done in triplicate, after accounting for differences in plating efficiency, to obtain 50,000 cells per well of a 6-well plate after 24 h. The cells were grown in H6 medium with or without TSH at 37 °C in 5% CO2. At the indicated times the cells were detached by trypsinization and counted using a Z1 Coulter counter. Cells grown in H6 medium were allowed to reach 95% confluency and then the medium replaced with fresh H6 medium containing the indicated amounts of actinomycin D or doxorubicin or alternatively cells were irradiated with the indicated dose of UV. Apoptosis was measured with the following methodologies. Cells were incubated for the indicated times and the attached cells were collected by trypsinization then combined with the detached cells suspended in the medium. DNA was then extracted and 20 μg from each sample was electrophoresed through a 2% agarose-TBE gel and the DNA visualized by staining with ethidium bromide. The cells were plated and grown as above. At the indicated times the number of cells in the medium was determined using a Z1 Coulter counter. More then 95% of detached cells examined by light microscopy after Diff-Quik staining or fluorescent microscopy after propidium iodide staining were found to have condensed and fragmented nuclei, consistent with death via apoptosis. We also confirmed that cell death was via apoptosis by TUNEL analysis using the Apotag In Situ Apoptosis kit, as directed by the manufacturer (Oncor Inc., Gaithersburg, MD). To determine cell viability an MTT assay was performed as directed by the manufacturer (Sigma). Briefly, H6 medium was removed from cells and replaced with H6 medium containing 0.5 mg/ml 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma-Aldrich, St. Louis, MO) and incubated for 2 h at 37 °C. The medium was removed and the colored precipitate formed by cleavage of MTT in living cells was solubilized with isopropyl alcohol containing 0.05 m HCl. Cell survival was determined by absorbance at 570 nm. Background was determined by absorbance at 660 nm. Athymic nude/nude mice were purchased from Harlan Sprague-Dawley, Indianapolis, IN. For each cell line tested 1 × 106 cells in 200 μl of sterile PBS were injected into the right flank of 4 nude/nude mice. The animals were followed for 8 weeks with weekly inspection for nodules. To assay for anchorage-independent growth soft agar colony formation assays were performed by suspending 2 × 103 cells in 1.0 ml of 0.5% Bacto-agar (Difco Laboratories, Detroit, MI) in H6 medium, and overlaying the suspension in triplicate onto a layer of 2 ml of 0.6% Bacto-agar in H6 medium in each well of a 6-well plate. The cells were refed every 5th day by overlaying 1 ml of 0.5% Bacto-agar in H6 medium. After 20 days the colonies with more than 50 cells were counted. We have previously reported mapping of the PKCε gene to the 2p21 locus (15Chen X. Knauf J.A. Gonsky R. Wang M. Lai E.H. Chissoe S. Fagin J.A. Korenberg J.R. Am. J. Hum. Genet. 1998; 63: 625-637Abstract Full Text Full Text PDF PubMed Scopus (56) Google Scholar), a region found by comparative genomic hybridization to be amplified in 28% of thyroid neoplasms studied. The amplification was mapped to a series of BAC/PAC clones derived from a chromosome 2-specific library (15Chen X. Knauf J.A. Gonsky R. Wang M. Lai E.H. Chissoe S. Fagin J.A. Korenberg J.R. Am. J. Hum. Genet. 1998; 63: 625-637Abstract Full Text Full Text PDF PubMed Scopus (56) Google Scholar). One of these, BAC 1D9, was demonstrated by FISH analysis to be amplified 40–70 times in the WRO cell line (Fig.1), a thyroid cancer cell line that contains double minute chromosomes. Sequencing of the entire BAC 1D9 demonstrated that it contained the first coding exon of the PKCε gene. Hybridization of the full-length human PKCε cDNA to Southern blots containing DNA from the WRO cell line, the anaplastic thyroid carcinoma cell line ARO, and normal tissue demonstrated that the PKCε gene has undergone rearrangement and amplification in the WRO cells, since there were additional bands found in the WRO cell line that were not found present in normal tissue or in ARO cells (Fig.2). Furthermore, it is clear that only part of the PKCε gene is amplified in the WRO cells, as not all hybridizing bands were over-represented (Fig. 2). To map the location of the amplification and rearrangement, PCR products specific to different regions of the PKCε cDNA were generated and hybridized to Southern blots. This demonstrated that the 5′ break point of the internal deletion was between bases 366 and 599 of PKCε cDNA (data not shown), whereas hybridization with probes mapping to bases 1136–2244 showed that all were amplified, indicating that at least part of the 3′ end of the gene was within the amplicon. These Southern blot data suggest that the changes in the PKCε gene are a result of an internal deletion followed by an amplification of the rearranged gene.Figure 2Southern and Northern blots of WRO cells. A, Southern blot containing 10 μg of DNA from ARO and WRO cells and normal tissue, digested with Eco RI orBam HI. The blots were hybridized with the full-length PKCε cDNA. Only some DNA bands from WRO cells are amplified. Top arrow points to a Bam HI band present at normal dosage.Middle arrow points to an amplified band of normal size.Lower arrow indicates an aberrantly sized amplified fragment, consistent with amplification of a rearranged PKCε gene in the WRO cell line. B, Northern blot containing 20 μg of total RNA from normal thyroid tissue, NPA cells, and WRO cells.Top, blot hybridized with the full-length PKCε cDNA. The upper arrow (∼7.2 kb) indicates the position of the full-length PKCε mRNA and the lower arrow (∼2.2 kb) indicates position of the Tr-PKCε mRNA. Bottom, ethidium bromide staining of the gel.View Large Image Figure ViewerDownload Hi-res image Download (PPT) To ascertain what effects the amplification and rearrangement of the PKCε gene has on its expression, Northern blots containing 20 μg of RNA from two clonal thyroid cancer cell lines and normal thyroid tissue were probed with the 2.2-kb PKCε cDNA (Fig. 2). Expression of the full-length PKCε mRNA was slightly lower in WRO, than in normal thyroid tissue. In addition, there was a PKCε hybridizing mRNA of approximately 2.2 kb in the WRO cell line, suggesting this cell line has an abnormal PKCε transcript. The identity of this mRNA was determined by sequencing products generated by 3′ RACE, and found to be a chimeric and truncated PKCε (Tr-PKCε) species that contained exon 1 of PKCε fused to an unrelated sequence. To obtain the Tr-PKCε cDNA in its entirety, a WRO cDNA library was constructed and screened with the DNA product generated by 3′ RACE. Probing duplicate membranes from 5 plates, containing 30,000 plaques each, we identified more than 40 plaques that were positive in both membranes. The positive plaques were isolated and the corresponding pBK-CMV phagemids containing the Tr-PKCε cDNAs were generated b" @default.
• W2082433420 created "2016-06-24" @default.
• W2082433420 creator A5007551001 @default.
• W2082433420 creator A5017828443 @default.
• W2082433420 creator A5030305499 @default.
• W2082433420 creator A5033322421 @default.
• W2082433420 creator A5039639608 @default.
• W2082433420 creator A5067136142 @default.
• W2082433420 creator A5077347159 @default.
• W2082433420 creator A5080716045 @default.
• W2082433420 date "1999-08-01" @default.
• W2082433420 modified "2023-10-18" @default.
• W2082433420 title "Involvement of Protein Kinase Cε (PKCε) in Thyroid Cell Death" @default.
• W2082433420 cites W1514099677 @default.
• W2082433420 cites W1517614087 @default.
• W2082433420 cites W152459441 @default.
• W2082433420 cites W1554882994 @default.
• W2082433420 cites W1563745823 @default.
• W2082433420 cites W1662546471 @default.
• W2082433420 cites W1662819364 @default.
• W2082433420 cites W1714294326 @default.
• W2082433420 cites W1865619950 @default.
• W2082433420 cites W1968167396 @default.
• W2082433420 cites W1971448678 @default.
• W2082433420 cites W1972223792 @default.
• W2082433420 cites W1978518304 @default.
• W2082433420 cites W1979046763 @default.
• W2082433420 cites W1980905934 @default.
• W2082433420 cites W1983386156 @default.
• W2082433420 cites W1987441461 @default.
• W2082433420 cites W1989706319 @default.
• W2082433420 cites W1991352152 @default.
• W2082433420 cites W1991714532 @default.
• W2082433420 cites W1997093700 @default.
• W2082433420 cites W1999383552 @default.
• W2082433420 cites W2000767760 @default.
• W2082433420 cites W2005907096 @default.
• W2082433420 cites W2006966528 @default.
• W2082433420 cites W2008356119 @default.
• W2082433420 cites W2014170738 @default.
• W2082433420 cites W2019002150 @default.
• W2082433420 cites W2023494473 @default.
• W2082433420 cites W2023972740 @default.
• W2082433420 cites W2025407633 @default.
• W2082433420 cites W2025674834 @default.
• W2082433420 cites W2027151723 @default.
• W2082433420 cites W2030916051 @default.
• W2082433420 cites W2031351595 @default.
• W2082433420 cites W2035175373 @default.
• W2082433420 cites W2044117808 @default.
• W2082433420 cites W2055333039 @default.
• W2082433420 cites W2056530510 @default.
• W2082433420 cites W2057211153 @default.
• W2082433420 cites W2061052988 @default.
• W2082433420 cites W2063877452 @default.
• W2082433420 cites W2065933401 @default.
• W2082433420 cites W2070664130 @default.
• W2082433420 cites W2082979850 @default.
• W2082433420 cites W2086729342 @default.
• W2082433420 cites W2086802798 @default.
• W2082433420 cites W2089330962 @default.
• W2082433420 cites W2091023380 @default.
• W2082433420 cites W2092516221 @default.
• W2082433420 cites W2099628115 @default.
• W2082433420 cites W2100837269 @default.
• W2082433420 cites W2101108802 @default.
• W2082433420 cites W2108388593 @default.
• W2082433420 cites W2113761414 @default.
• W2082433420 cites W2116450965 @default.
• W2082433420 cites W2136736088 @default.
• W2082433420 cites W2163421864 @default.
• W2082433420 cites W2164263233 @default.
• W2082433420 cites W2168261275 @default.
• W2082433420 cites W2169995312 @default.
• W2082433420 cites W2290500472 @default.
• W2082433420 cites W93019692 @default.
• W2082433420 doi "https://doi.org/10.1074/jbc.274.33.23414" @default.
• W2082433420 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/10438519" @default.
• W2082433420 hasPublicationYear "1999" @default.
• W2082433420 type Work @default.
• W2082433420 sameAs 2082433420 @default.
• W2082433420 citedByCount "70" @default.
• W2082433420 countsByYear W20824334202012 @default.
• W2082433420 countsByYear W20824334202013 @default.
• W2082433420 countsByYear W20824334202014 @default.
• W2082433420 countsByYear W20824334202016 @default.
• W2082433420 countsByYear W20824334202018 @default.
• W2082433420 countsByYear W20824334202020 @default.
• W2082433420 countsByYear W20824334202022 @default.
• W2082433420 crossrefType "journal-article" @default.
• W2082433420 hasAuthorship W2082433420A5007551001 @default.
• W2082433420 hasAuthorship W2082433420A5017828443 @default.
• W2082433420 hasAuthorship W2082433420A5030305499 @default.
• W2082433420 hasAuthorship W2082433420A5033322421 @default.
• W2082433420 hasAuthorship W2082433420A5039639608 @default.
• W2082433420 hasAuthorship W2082433420A5067136142 @default.
• W2082433420 hasAuthorship W2082433420A5077347159 @default.
• W2082433420 hasAuthorship W2082433420A5080716045 @default.

• next