FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2083584334> ?p ?o ?g. }

• W2083584334 endingPage "916" @default.
• W2083584334 startingPage "911" @default.
• W2083584334 abstract "Sitosterolemia is an autosomal recessive disorder caused by mutations in the ABCG5 or ABCG8 half-transporter genes. These mutations disrupt the mechanism that distinguishes between absorbed sterols and is most prominently characterized by hyperabsorption and impaired biliary elimination of dietary plant sterols. Sitosterolemia patients retain 15–20% of dietary plant sterols, whereas normal individuals absorb less than 1–5%. Normotensive Wistar Kyoto inbred (WKY inbred), spontaneously hypertensive rat (SHR), and stroke-prone spontaneously hypertensive rat (SHRSP) strains also display increased absorption and decreased elimination of dietary plant sterols. To determine if the genes responsible for sitosterolemia in humans are also responsible for phytosterolemia in rats, we sequenced the Abcg5 and Abcg8 genes in WKY inbred, SHR, and SHRSP rat strains. All three strains possessed a homozygous guanine-to-thymine transversion in exon 12 of the Abcg5 gene that results in the substitution of a conserved glycine residue for a cysteine amino acid in the extracellular loop between the fifth and sixth membrane-spanning domains of the ATP binding cassette half-transporter, sterolin-1.The identification of this naturally occurring mutation confirms that these rat strains are important animal models of sitosterolemia in which to study the mechanisms of sterol trafficking. Sitosterolemia is an autosomal recessive disorder caused by mutations in the ABCG5 or ABCG8 half-transporter genes. These mutations disrupt the mechanism that distinguishes between absorbed sterols and is most prominently characterized by hyperabsorption and impaired biliary elimination of dietary plant sterols. Sitosterolemia patients retain 15–20% of dietary plant sterols, whereas normal individuals absorb less than 1–5%. Normotensive Wistar Kyoto inbred (WKY inbred), spontaneously hypertensive rat (SHR), and stroke-prone spontaneously hypertensive rat (SHRSP) strains also display increased absorption and decreased elimination of dietary plant sterols. To determine if the genes responsible for sitosterolemia in humans are also responsible for phytosterolemia in rats, we sequenced the Abcg5 and Abcg8 genes in WKY inbred, SHR, and SHRSP rat strains. All three strains possessed a homozygous guanine-to-thymine transversion in exon 12 of the Abcg5 gene that results in the substitution of a conserved glycine residue for a cysteine amino acid in the extracellular loop between the fifth and sixth membrane-spanning domains of the ATP binding cassette half-transporter, sterolin-1. The identification of this naturally occurring mutation confirms that these rat strains are important animal models of sitosterolemia in which to study the mechanisms of sterol trafficking. Sitosterolemia (MIM 210250), also known as phytosterolemia, is a rare autosomal recessive disorder characterized by increased absorption and decreased elimination of dietary plant sterols, as well as abnormally low cholesterol biosynthesis (1Bhattacharyya A.K. Connor W.E. Beta-sitosterolemia and xanthomatosis. A newly described lipid storage disease in two sisters.J. Clin. Invest. 1974; 53: 1033-1043Google Scholar, 2Miettinen T.A. Phytosterolaemia, xanthomatosis and premature atherosclerotic arterial disease: a case with high plant sterol absorption, impaired sterol elimination and low cholesterol synthesis.Eur. J. Clin. Invest. 1980; 10: 27-35Google Scholar, 3Nguyen L.B. Shefer S. Salen G. Ness G.C. Tint G.S. Zaki F.G. Rani I. A molecular defect in hepatic cholesterol biosynthesis in sitosterolemia with xanthomatosis.J. Clin. Invest. 1990; 86: 923-931Google Scholar, 4Bjorkhem I. Boberb K. Leitersdorf E. Inborn errors in bile acid biosynthesis and storage of sterols other than cholesterol.in: Scriver C. Beaudet A. Sly W. Valle D. The Metabolic and Molecular Bases of Inherited Disease. Vol. 2. McGraw-Hill, New York2001: 2961-2988Google Scholar). Affected individuals have high levels of plasma plant sterols, namely 18–72 mg/dl versus 0.3–1.0 mg/dl (W. M. N. Ratnayake, and E. Vavasour, unpublished observations) and normal to slightly elevated blood cholesterol levels. Patients exhibit tendon and tuberous xanthomas, accelerated atherosclerosis, and premature coronary artery disease. Recently, mutations in the ATP binding cassette (ABC) half-transporter genes ABCG5 and ABCG8 have been shown to cause sitosterolemia in humans (5Berge K.E. Tian H. Graf G.A. Yu L. Grishin N.V. Schultz J. Kwiterovich P. Shan B. Barnes R. Hobbs H.H. Accumulation of dietary cholesterol in sitosterolemia caused by mutations in adjacent ABC transporters.Science. 2000; 290: 1771-1775Google Scholar, 6Lee M.H. Lu K. Hazard S. Yu H. Shulenin S. Hidaka H. Kojima H. Allikmets R. Sakuma N. Pegoraro R. Srivastava A.K. Salen G. Dean M. Patel S.B. Identification of a gene, ABCG5, important in the regulation of dietary cholesterol absorption.Nat. Genet. 2001; 27: 79-83Google Scholar). These genes are oriented on chromosome 2p21 in a head-to-head arrangement, are separated by 375 bp, and each contains 13 exons (7Lu K. Lee M.H. Hazard S. Brooks-Wilson A. Hidaka H. Kojima H. Ose L. Stalenhoef A.F. Mietinnen T. Bjorkhem I. Bruckert E. Pandya A. Brewer Jr., H.B. Salen G. Dean M. Srivastava A. Patel S.B. Two genes that map to the STSL locus cause sitosterolemia: genomic structure and spectrum of mutations involving sterolin-1 and sterolin-2, encoded by ABCG5 and ABCG8, respectively.Am. J. Hum. Genet. 2001; 69: 278-290Google Scholar). ABCG5 and ABCG8 genes are members of the ABC transporter family and encode for sterolin-1 and sterolin-2, respectively. These proteins are expressed in liver and intestine and consist of an N-terminal ATP binding site and six transmembrane domains at the C terminus. On the basis of their importance in sitosterolemia and recent expression in transgenic mice (8Yu L. Li-Hawkins J. Hammer R.E. Berge K.E. Horton J.D. Cohen J.C. Hobbs H.H. Overexpression of ABCG5 and ABCG8 promotes biliary cholesterol secretion and reduces fractional absorption of dietary cholesterol.J. Clin. Invest. 2002; 110: 671-680Google Scholar), these proteins are thought to pump plant sterols out of intestinal cells into the gut lumen, and out of liver cells into the bile duct. Functional ABC transporters comprise two ATP binding sites and 12 membrane-spanning domains (9Chang G. Roth C.B. Structure of MsbA from E. coli: a homolog of the multidrug resistance ATP binding cassette (ABC) transporters.Science. 2001; 293: 1793-1800Google Scholar, 10Locher K.P. Lee A.T. Rees D.C. The E. coli BtuCD structure: a framework for ABC transporter architecture and mechanism.Science. 2002; 296: 1091-1098Google Scholar). Consistent with these half-transporters functioning as heterodimers, mutations in either ABCG5 or ABCG8, but not in both genes simultaneously, have been found in sitosterolemia patients (5Berge K.E. Tian H. Graf G.A. Yu L. Grishin N.V. Schultz J. Kwiterovich P. Shan B. Barnes R. Hobbs H.H. Accumulation of dietary cholesterol in sitosterolemia caused by mutations in adjacent ABC transporters.Science. 2000; 290: 1771-1775Google Scholar, 6Lee M.H. Lu K. Hazard S. Yu H. Shulenin S. Hidaka H. Kojima H. Allikmets R. Sakuma N. Pegoraro R. Srivastava A.K. Salen G. Dean M. Patel S.B. Identification of a gene, ABCG5, important in the regulation of dietary cholesterol absorption.Nat. Genet. 2001; 27: 79-83Google Scholar, 7Lu K. Lee M.H. Hazard S. Brooks-Wilson A. Hidaka H. Kojima H. Ose L. Stalenhoef A.F. Mietinnen T. Bjorkhem I. Bruckert E. Pandya A. Brewer Jr., H.B. Salen G. Dean M. Srivastava A. Patel S.B. Two genes that map to the STSL locus cause sitosterolemia: genomic structure and spectrum of mutations involving sterolin-1 and sterolin-2, encoded by ABCG5 and ABCG8, respectively.Am. J. Hum. Genet. 2001; 69: 278-290Google Scholar, 11Hubacek J.A. Berge K.E. Cohen J.C. Hobbs H.H. Mutations in ATP-cassette binding proteins G5 (ABCG5) and G8 (ABCG8) causing sitosterolemia.Hum. Mutat. 2001; 18: 359-360Google Scholar, 12Heimer S. Langmann T. Moehle C. Mauerer R. Dean M. Beil F.U. von Bergmann K. Schmitz G. Mutations in the human ATP binding cassette transporters ABCG5 and ABCG8 in sitosterolemia.Hum. Mutat. 2002; 20: 151Google Scholar). To date, no mutations have been identified in these genes in other species. Lu et al. have identified a number of polymorphisms in Abcg5 and Abcg8 in several mouse strains (13Lu K. Lee M.H. Yu H. Zhou Y. Sandell S.A. Salen G. Patel S.B. Molecular cloning, genomic organization, genetic variations, and characterization of murine sterolin genes Abcg5 and Abcg8.J. Lipid Res. 2002; 43: 565-578Google Scholar) and although some of these polymorphisms altered amino acids, none of them correlated with increased plasma plant sterol levels. Similar to phytosterolemic patients, specific rat strains have been shown to retain high levels of plasma plant sterols and to have blood and cell membrane cholesterol deficiencies (14Ratnayake W.M.N. Plouffe L. Hollywood R. L’Abbe M.R. Hidiroglou N. Sarwar G. Mueller R. Influence of sources of dietary oils on the life span of stroke-prone spontaneously hypertensive rats.Lipids. 2000; 35: 409-420Google Scholar, 15Ratnayake W.M.N. L’Abbe M.R. Mueller R. Hayward S. Plouffe L. Hollywood R. Trick K. Vegetable oils high in phytosterols make erythrocytes less deformable and shorten the life span of stroke-prone spontaneously hypertensive rats.J. Nutr. 2000; 130: 1166-1178Google Scholar, 16Yamori Y. Nara Y. Horie R. Ooshima A. Abnormal membrane characteristics of erythrocytes in rat models and men with predisposition to stroke.Clin. Exp. Hypertens. 1980; 2: 1009-1021Google Scholar, 17Yamori Y. Nara Y. Imafuku H. Kanbe T. Mori K. Kihara M. Horie R. Biomembrane abnormalities in spontaneous hypertension.in: Villard H. Sambhi M.P. Topics in Pathophysiology of Hypertension. Martinus Nijhoff, Boston1984: 3-13Google Scholar). Normotensive Wistar Kyoto inbred (WKY inbred) rats, spontaneously hypertensive rats (SHRs), and stroke-prone spontaneously hypertensive rats (SHRSPs) contained 12% to 15% plant sterols in the sterol fraction of serum compared with 2% to 6% in nine different rat strains fed commercial rat chow (18Ikeda I. Nakagiri H. Sugano M. Ohara S. Hamada T. Nonaka M. Imaizumi K. Mechanisms of phytosterolemia in stroke-prone spontaneously hypertensive and WKY rats.Metabolism. 2001; 50: 1361-1368Google Scholar). Ikeda et al. (18Ikeda I. Nakagiri H. Sugano M. Ohara S. Hamada T. Nonaka M. Imaizumi K. Mechanisms of phytosterolemia in stroke-prone spontaneously hypertensive and WKY rats.Metabolism. 2001; 50: 1361-1368Google Scholar) further demonstrated that WKY inbred and SHRSP rats deposit three to four times higher levels of plant sterols in serum when fed a 0.5% plant sterol diet. The proportion of plant sterols in the sterol fraction was ∼25% to 35% (33.7 mg/dl) in WKY inbred and SHRSP rats and 6% to 12% (8.39 mg/dl) in WKA and Wistar control rats (18Ikeda I. Nakagiri H. Sugano M. Ohara S. Hamada T. Nonaka M. Imaizumi K. Mechanisms of phytosterolemia in stroke-prone spontaneously hypertensive and WKY rats.Metabolism. 2001; 50: 1361-1368Google Scholar). In all tissues, the deposition of campesterol was higher than that of sitosterol. These high serum plant sterol values are similar to those obtained from phytosterolemic patients (4Bjorkhem I. Boberb K. Leitersdorf E. Inborn errors in bile acid biosynthesis and storage of sterols other than cholesterol.in: Scriver C. Beaudet A. Sly W. Valle D. The Metabolic and Molecular Bases of Inherited Disease. Vol. 2. McGraw-Hill, New York2001: 2961-2988Google Scholar) and by Ratnayake et al. in SHRSP rats (15Ratnayake W.M.N. L’Abbe M.R. Mueller R. Hayward S. Plouffe L. Hollywood R. Trick K. Vegetable oils high in phytosterols make erythrocytes less deformable and shorten the life span of stroke-prone spontaneously hypertensive rats.J. Nutr. 2000; 130: 1166-1178Google Scholar). The increased accumulation of plant sterols in these rats may be due to enhanced intestinal absorption and decreased biliary excretion (18Ikeda I. Nakagiri H. Sugano M. Ohara S. Hamada T. Nonaka M. Imaizumi K. Mechanisms of phytosterolemia in stroke-prone spontaneously hypertensive and WKY rats.Metabolism. 2001; 50: 1361-1368Google Scholar). The SHRSP strain was derived from the SHR strain (19Okamoto K. Yamori Y. Nagaoka A. Establishment of the stroke-prone spontaneously hypertensive rat (SHR).Circ. Res. 1974; 34: 143-153Google Scholar, 20Yamori Y. Importance of genetic factors in stroke: an evidence obtained by selective breeding of stroke-prone and -resistant SHR.Jpn. Circ. J. 1974; 38: 1095-1100Google Scholar, 21Yamori Y. Okamoto K. Spontaneous hypertension in the rat. A model for human “essential” hypertension.Verh. Dtsch. Ges. Inn. Med. 1974; 80: 168-170Google Scholar) that had been developed previously from the WKY inbred strain (22Okamoto K. Aoki K. Development of a strain of spontaneously hypertensive rats.Jpn. Circ. J. 1963; 27: 282-293Google Scholar). Their serum triacylglycerol levels do not differ significantly (23Tomita T. Shirasaki Y. Yamada K. Endo T. Hayashi E. Age and blood pressure related changes in cholesterol esterase activity and cholesterol content in aortas of stroke prone spontaneously hypertensive rats, spontaneously hypertensive rats and normotensive Wistar Kyoto rats.Paroi Arterielle. 1980; 6: 19-25Google Scholar), and it is well established that dietary plant sterols have no effect on triglycerides in both rats (15Ratnayake W.M.N. L’Abbe M.R. Mueller R. Hayward S. Plouffe L. Hollywood R. Trick K. Vegetable oils high in phytosterols make erythrocytes less deformable and shorten the life span of stroke-prone spontaneously hypertensive rats.J. Nutr. 2000; 130: 1166-1178Google Scholar) and humans (24Jones P.J. Ntanios F.Y. Raeini-Sarjaz M. Vanstone C.A. Cholesterol-lowering efficacy of a sitostanol-containing phytosterol mixture with a prudent diet in hyperlipidemic men.Am. J. Clin. Nutr. 1999; 69: 1144-1150Google Scholar). When fed a high cholesterol/cholate diet, the plasma cholesterol levels are significantly higher in normotensive WKY inbred than in SHR and SHRSP strains even though these three rat strains have increasing systolic blood pressures in that order (25Mori H. Ishiguro K. Okuyama H. Hypertension in rats does not potentiate hypercholesterolemia and aortic cholesterol deposition induced by a hypercholesterolemic diet.Lipids. 1993; 28: 109-113Google Scholar). The SHR and SHRSP strains are widely used animal models for hypertension and hemorrhagic stroke and may also be suitable models for studying mechanisms of differential absorption of various sterols. To ascertain the mechanism of increased dietary plant sterol retention in these rats, we determined the genomic structures for the rat Abcg5 and Abcg8 genes and their mRNA tissue expression patterns, and subsequently identified the mutation responsible for phytosterolemia in rats. Accession numbers AF312714.2 and AF351785.1, corresponding to rat Abcg5 and Abcg8 cDNA sequences, respectively, were used to search databases for any homologous genomic DNA sequences using the Basic Local Alignment Search Tool (BLAST). Rat clone CH230-359E1 (AC112747.1) and clone CH230-65H6 (AC120701) were identified from the Rat Genome Database. Using these genomic sequences, we were able to determine the intron sequences flanking all of the exons in the ABC half-transporter genes except for Abcg5 exons 2, 8, and 9, and Abcg8 exons 4, 5, 6, and 8. To determine the remaining exon/intron boundary sequences and estimate intron sizes, rat genomic fragments were amplified using primers selected from the cDNA sequences (Table 1). These fragments were subsequently cloned (TOPO TA Cloning Kit, Invitrogen Life Technologies, Canada) and sequenced.TABLE 1Oligonucleotide primers used for amplification of Abcg5 and Abcg8 intronsForward PrimersReverse PrimersPrimer NamePosition in cDNAaGenBank accession number AF312714.3.Sequences 5′ to 3′Primer NamePosition in cDNAaGenBank accession number AF312714.3.Sequences 5′ to 3′Abcg5Abcg5-i1-F139–159GGAGGAAGGCTCAGTTACAGGAbcg5-i1-R269–249TTTCCTGTCCCACTTCTGCTAbcg5-i2-F256–268GTGGGACAGGAAAATCCTCAAbcg5-i2-R407–388ACACTTCCCCTTCCAAGGTCAbcg5-i3-F398–416GGGGAAGTGTTTGTGAACGAbcg5-i3-R521–502CCGTGTATCTCAGCGTCTCCAbcg5-i4-F500–519CGGGAGACGCTGAGATACACAbcg5-i4-R629–610AGTTGCCGATCATTTGGTCTAbcg5-i5-F618–638TGATCGGCAACTATAATTTTGAbcg5-i5-R773–754CCAAGAGGAGGACGATATGAAbcg5-i6-F787–806CAGGAACCGCATTGTAATTGAbcg5-i6-R893–874TGCCACAGAACACCAACTCTAbcg5-i7-F902–921GAGATGCTCGGCTTCTTCAAAbcg5-i7-R1,037–1,018TCTGGACTCGCTTGTACGTCAbcg5-i8-F1,121–1,140CCCATGGTTCCTTTCAAAACAbcg5-i8-R1,238–1,218CAAGACGCATAATCACAACCTAbcg5-i9-F1,330–1,349GCTGTTGTACCAGCTTGTGGAbcg5-i9-R1,462–1,443GAGCAGCATCTGCCACTTCTAbcg5-i10-F1,465–1,484CTATGTGCTGCATGCTCTCCAbcg5-i10-R1,582–1,563AGCGGCAGAGAAGTATCCAAAbcg5-i11-F1,653–1,674TTGTCAACAGCATAGTGGCTCTAbcg5-i11-R1,770–1,749TGGAAGGTAAAGTAACCCAGGAAbcg5-i12-F1,778–1,799TGTTGTGAGATTCTTGTGGTCAAbcg5-i12-R1,895–1,876CAATGAATTGGATCCCTTGGPrimer NamePosition in cDNAbGenBank accession number AF351785.2.Sequences 5′ to 3′Primer NamePosition in cDNAbGenBank accession number AF351785.2.Sequences 5′ to 3′Abcg8Abcg8-i1-F114–133GCTCAGACGACCAAAGAGGAAbcg8-i1-R227–206GGTGAAGTAGAGGCTGTTGTCAAbcg8-i2-F224–244CACCTACAGTGGTCAGTCCAAAbcg8-i2-R343–324CGAGACCTCCACGGTAACTTAbcg8-i3-F370–389GCATCCGAAATCTGAGCTTCAbcg8-i3-R498–479CTGATTTCATCTTGCCACCAAbcg8-i4-F609–628CTGACTTTCATCGCCCAGATAbcg8-i4-R746–728CCCGCGTACGTATGTGTTGAbcg8-i5-F732–750ACATACGTACGCGGGGTGTAbcg8-i5-R880–861CGGGACAAAGTTCTCACCAGAbcg8-i6-F1,002–1,022CAGCACATGGTGCAGTACTTTAbcg8-i6-R1,148–1,128TGCAAGTAATCGAGCCTTCTCAbcg8-i7-F1,181–1,201CGACTTTCTGTGGAAAGCTGAAbcg8-i7-R1,296–1,278GTATCATCCCGGGCAGCTCAbcg8-i8-F1,260–1,279AACTGTGGAACTGCTGCTGAAbcg8-i8-R1,373–1,355TGCTCCATGGATGAACAGGAbcg8-i9-F1,465–1,486TCATGATAGGAGCACTCATTCCAbcg8-i9-R1,569–1,549TGTACAGTCCGTCCTCCAGTTAbcg8-i10-F1,546–1,565ATGAACTGGAGGACGGACTGAbcg8-i10-R1,649–1,630GGGCATCCCATAGATGATGAAbcg8-i11-F1,791–1,810TGCTGCAACGCTCTCTACAAAbcg8-i11-R1,925–1,906AATCTGCATCAGCCCTGAGAAbcg8-i12-F1,940–1,959CATTTACACCACGCAGATCGAbcg8-i12-R2,055–2,036TGCCAATGACGATGAGGTAGa GenBank accession number AF312714.3.b GenBank accession number AF351785.2. Open table in a new tab Liver tissue samples were obtained from the following rats: SHRSP (SHRSP from Seac Yoshitomi, Fukuoka, Japan, inbred, SPF, maintained in the Animal Resources Division of Health Canada for 2 years); SHR [Tac:N(SHR) (Okamoto-Aoki Strain), outbred, bred in a closed colony, MPF, Taconic Farms, Inc., Germantown, NY]; WKY (WKY/[email protected], inbred, MPF, Taconic Farms, Inc.); WKY [Tac:N(WKY), outbred, MPF, Taconic Farms, Inc.]; Sprague-Dawley [Crl:CD(SD)IGSBR, outbred, Charles River Canada, Saint-Constant, Quebec]; diabetes-prone and control BB (BBdp and BBc, respectively, Animal Resources Division of Health Canada). Genomic DNA was extracted from the tissue samples using GenElute Mammalian Genomic DNA Miniprep Kit (Sigma Chemical Co., St. Louis, MO). Rat genomic DNA was subjected to PCR and direct DNA sequencing in order to screen the Abcg5 and Abcg8 genes for sequence variations. Primers were designed based on our deduced genomic structures of both genes and were used to amplify all 26 exons from the intronic sequences flanking each exon (Table 2). PCR amplification conditions were optimized for each primer pair, and the products were subsequently subjected to exonuclease I and shrimp alkaline phosphatase treatment (Exo-Sap-It, Amersham, Piscataway, NJ; USB Corp., Cleveland, OH) and then manually sequenced using the Thermo Sequenase Radiolabeled Terminator Cycle Sequencing Kit (Amersham; USB Corp.) according to the manufacturer’s recommended conditions. Denatured sequencing reactions were immediately loaded and electrophoresed through a 6% acrylamide gel (SequaGel-6, National Diagnostics, Atlanta, GA). Gels were transferred onto filter paper, dried for 2 h at 80°C, and exposed to X-ray film (KODAK BIOMAX MX, Mandel Scientific, Guelph, ON) for 18 h at −80°C. Autoradiographs were examined for sequence changes. All nucleotide, codon, and exon numbering corresponds to GenBank accession numbers AF312714.3 and AF351785.2 (http://www.ncbi.nlm.nih.gov/).TABLE 2Oligonucleotide primersaPrimer sequences are given in the 5′ to 3′ direction. used for amplification of Abcg5 and Abcg8 exonsAbcg5Abcg8ExonForward PrimerReverse PrimerForward PrimerReverse Primer1AGCCAGACAGGACACCAGAGTAGGGTGGGAAGCCTAGCTCAGAATCCTGGCCTAGCCAACTCAGTTTCATCTTGCCTCCA2GGGTCCTACTCTGCCTTTTGTCCTCCCAGAGTCTGCCTTACCCCTCCTGTCTGCTTCTCTGCCCACCCCTGAACATTCTATT3AAAGTGCCCCCATTCTCACCAGGAAAGGGGACATCAGGCTCTGAATGGCTCAGCTTCCATCGTACGGGTGAAAAACCA4CCAAGACTGCGTCTCCTACCTGCTGAGGCACCTGATCTCCAGGTAAGCCCTGCAGAAACTCCAGCTGAACTGGGTCTTC5AGTCATGGAGACAGCAGCAGCGGGAACACATGGAGGATAGAAGAAGTTGCCCCTGGACGGACAGGTTGTAGGCTCAGG6ACGATGCTAGGCAATGGTTCTGGGATGAGATGTTGAGTCGCCTGAGCCTACAACCTGTCCGACAGCAAATGACTGTGTCCA7GGCTGGGAAGCACACACTAAAGATTTCCAAAAAGCCCTGACAGGTCTCTGCCTTTCTGCTACCACCAGATCTTCCCATCA8TGTCCATTCTGTGTGTGTGCATGAGCATGAAGAGCCAAGCGATGGGAAGATCTGGTGGTGGGCAGAAGACAGAGACAGAGAGA9AGCTGGCTTGGCTCTTCATGATAGATGTGGGGGAGAGAGCTCGGGTGATAAGGTCACAGATCCCACTGTCCCGAAGTCT10CCTCAGCAGTGTGGTGACTGTGACCCAGGGGAACTGAACCCACGGCATTACAAGAGATCATGGCTGAGTGTTTCCGTA11TGATAGTGTGCGGAGAGAGAATCAGTTGACCCTTGACCACATGGTGTCGGCTCCATGTCCCTACAGAGGCCTGGCTAA12GCATAAAGACGTACCCTTTCCACCCTGGGAAATCGCTTACTTCCATGCGACTAACACTTGGACAGCAGCACTTGGATTGAGA13GAAGTGCCTGAGGGCTGAGATGCCAGGGTCACAGATGTCAATCCAAGTGCTGCTGAGCGATGCTGCTTGAGATCTGTa Primer sequences are given in the 5′ to 3′ direction. Open table in a new tab Several control rat strains were screened for the presence of the G1811T transversion by PCR amplification of exon 12 of the Abcg5 gene followed by HaeIII restriction analysis (New England Biolabs, Beverly, MA). The single nucleotide transversion deletes a unique HaeIII restriction site. Rat multiple-tissue poly(A)+ RNA Northern blots (Ori-gene, Bethesda, MD) were hybridized with radiolabeled rat Abcg5 cDNA, rat Abcg8 cDNA, or β-actin cDNA according to the manufacturer’s recommended conditions. Primers designed to Abcg5 (forward 5′-GCTCTGAAGCCAGACAGGAC-3′; reverse 5′-GTTCAGGACAGGGGTAACCA-3′) or Abcg8 (forward 5′-GAGGACTCAAGTGCCCTAGC-3′; reverse 5′-GTAGATAGGGGTGCCAGACG-3′) transcripts were used to PCR amplify probes from cDNA prepared using rat liver total RNA. Total RNA was isolated using Trizol reagent (Invitrogen Life Technologies) as per the manufacturer’s recommended conditions. Rat Abcg5 or Abcg8 cDNA was radiolabeled by incorporation of [α-32P]dCTP into the PCR product, and unincorporated nucleotides were removed using G-50 Micro columns (Amersham) as per the manufacturer’s instructions. The activity of the probes was determined by scintillation counting, and 1–3 × 106 cpm of denatured probe was added per ml of hybridization solution. Genomic information for Abcg5 and Abcg8 genes was obtained by comparing the full-length cDNA transcripts present in GenBank to sequences deposited in the Rat Genome Database using BLAST. Two clones, CH230-359E1 (AC112747.1) and CH230-65H6 (AC120701), were identified that contained partial genomic fragments for both Abcg5 and Abcg8. These sequences enabled us to quickly determine many of the exon/intron boundaries of the ABC half-transporter genes and importantly, the intron sequences flanking many of the exons of these genes. The remaining exon/intron boundaries and intron sizes were determined by sequencing cloned PCR products produced using exon-specific primers and rat genomic DNA (Table 1). Our results (Table 3) have now been confirmed by updated versions of clones CH230-359E1 (AC112747.3) and CH230-65H6 (AC120701.4) from the Rat Genome Database. Similar to the human and mouse genes, the rat Abcg5 and Abcg8 genes are arranged in a head-to-head orientation, and each gene is composed of 13 exons and 12 introns. The Abcg5 gene spans ∼33 kb of genomic DNA and the Abcg8 gene spans about 20 kb, with 379 bp separating their respective initiation codons.TABLE 3Exon-intron boundaries and organization of rat Abcg5 and Abcg8 genesExonIntronExon#Size3′ End SequenceSplice Donor#SizeSplice Acceptor5′ End Sequence#bpbpAbcg51aGenBank accession number AC112747.210GTCCTTCAGCGTCAGgtaaggggacccc1612atttctttaaagCAACCGTGTCGGGCC22bGenBank accession number.,cGenomic fragments that were PCR amplified using primers indicated in Table 1, then cloned and sequenced.122TCTTAGGTAGCTCAGgtaagcgcctcga214,228ttgtcgcccctagGCTCAGGGAAAACC33aGenBank accession number AC112747.137TCCTACCTCCTGCAGgtgggcgtgtccc385ccctttcctgcagAGCGATGTCTTTCTG44aGenBank accession number AC112747.99TTCTACGACAAGAAGgtacttttagtta42,340gtgtctcttacagGTAGAGGCAGTCCTG55aGenBank accession number AC112747.133TCCTTCAGGACCCCAgtaagtgggacac51,316tctttgctggcagAGGTCATGATGCTTG66aGenBank accession number AC112747.140TCTGAGCTCTTCCACgtaagggaacacc6901gtggtccaatcagCACTTCGACAAAATT77aGenBank accession number AC112747.130CCTTTGATTTCTACAgtaagtgcatttt7664gggaaacttttagTGGACTTGACATCGG88cGenomic fragments that were PCR amplified using primers indicated in Table 1, then cloned and sequenced.214CGGCGTTCTCCTGAGgtaagagcctt8103gtttggttttcagGAGAGTAACGAGAAA99cGenomic fragments that were PCR amplified using primers indicated in Table 1, then cloned and sequenced.206ACGCTGTGAACCTCTgtaagtgcctgtg9910ccttccatgccagTTCCCATGCTGAGAG1010aGenBank accession number AC112747.139CAGCGTGTGTTACTGgtaaggtggtgtc102,813tcgtgtttttctagGACTCTGGGCTTGT1111aGenBank accession number AC112747.186ATCTGGATTTATCAGgtaagaagaaat114,940tctctttcttaagAAACATAGAAGAAAT1212aGenBank accession number AC112747.113TGAACTTCACTTGTGgtaagtatcctatt121,857ttctccttggcagGTGGCTCCAACACTT1313aGenBank accession number AC112747.641GTGGAGTACAGAGAAAbcg81aGenBank accession number AC112747.173CTCCAGGATGCTTCAgtgagtgacctag13,347tgtctcccagcagAGCCTCCAGGACAGC22aGenBank accession number AC112747.102GATCTCACCTACCAGgtaggggcacatg21,788cctctccccacagGTGGACATGGCCTCTC33aGenBank accession number AC112747.157TCATAGGGAGCGCAGgtaccacagagac33,254ctgggtttgtcagGCTGCGGGAGAGCCA44cGenomic fragments that were PCR amplified using primers indicated in Table 1, then cloned and sequenced.237CAGCGAGAAAACGGgtaaccagtgggc4389agcctgccctcagGTGGAAGACGTGATT55cGenomic fragments that were PCR amplified using primers indicated in Table 1, then cloned and sequenced.133TCCTGTGGAACCCAGgtgaggcctggga586gataccccccagGAATCCTCATCCTGGA66cGenomic fragments that were PCR amplified using primers indicated in Table 1, then cloned and sequenced.270CTGCTGACTTCTACGgtgagtgagtaaa62,912tcttctgcttgcagTGGACTTGACGAGCAT77aGenBank accession number AC112747.163CACCTATGCAGTCAGgtactgagagaag780ctgttcccaacagCCAGACCCTCACACAG88cGenomic fragments that were PCR amplified using primers indicated in Table 1, then cloned and sequenced.81TACCACCCTGATCCGgtaaatcaacctc81,235tcctttctttcagTCGTCAGATTTCCAAT99aGenBank accession number AC112747.200ATGTCGTCTCCAAATgtgagtgtcacccg9164cccccatctccagGTCACTCGGAGCGGTC1010aGenBank accession number AC112747.77ATTTCTTTGCCAAGgtcagggccagga10552ctgtgctttgcagGTCCTCGGTGAGCTG1111aGenBank accession number AC112747.268CAACCTGTGGATAGgtgaggcctgcc111,204ttgctgtcttcagTACCTGCATGGATTT1212aGenBank accession number AC112747.128CCCCGGAGACGCGgtacgtagcgagg1287tgtctgtgtccgcagATGGTCACTGCCATG1313aGenBank accession number AC112747.,bGenBank accession number.2,838a GenBank accession number AC112747.b GenBank accession number.c Genomic fragments that were PCR amplified using primers indicated in Table 1, then cloned and sequenced. Open table in a new tab SHRSP, SHR, and WKY inbred DNA was examined for a mutation in the Abcg5 and Abcg8 genes. PCR and direct sequencing analysis identified a guanine-to-thymine transversion at nucleotide position 1,811 (codon 583) in exon 12 of both alleles of the Abcg5 gene (Fig. 1A). This transversion results in the substitution of a highly conserved glycine residue for a cysteine amino acid in the large extracellular loop between transmembrane domains 5 and 6 of sterolin-1 (Fig. 1B and Fig. 2), whereas Abcg5 exon 12 from the WKY outbred rat, along with three other rat strains (SD, BBc, and BBdp), displayed only wild-type sequence (Fig. 1A). HaeIII restriction enzyme digests of Abcg5 exon 12 were also negative for the presence of the G1811T mutation in four additional rat strains, Wistar, Long-Evans, Wistar-Furth, and full diabetic (data not shown).Fig. 2Glycine residue at codon 583 is conserved through evolution. ABCG5 half-transporter amino acids 568 to 601 from several different species are shown. The highly conserved glycine residue is boxed and the cysteine mutation of the WKY inbred, SHR, and SHRSP rat is in boldface.View Large Image Figure ViewerDownload (PPT) A polymorphism was also present in Abcg5 exon 7 on both alleles from SHRSP, SHR, and WKY inbred rats that was not found in WKY outbred, SD, BBc, and BBdp rat strains (Table 4). This cytosine-to-thymine transition does not result in an amino acid substitution.TABLE 4Single nucleotide polymorphisms detected in the rat Abcg5 and Abcg8 genesExon/IntronVariationPosition (Nucleotide)SDBBcBBdpWKY outbredWKY inbredSHRSHRSPAmino Acid ChangeAbcg5-I3C/T14 of intron 3CTCCCCCNoAbcg5-E7C/T72 of exon 7CCCCTTTNoAbcg5-E8C/T147 of exon 8TCTTTTTNoAbcg5-E9C/T139 of exon 9TCTTTTTNoAbcg5-E9T/C160 of exon 9CTCCCCCNoAbcg8-E5C/A93 of exon 5CACCCCCNoAbcg8-I6G/A2879 of intron 6AGGA/GAAANo Open table in a new tab Several novel polymorphisms were also present in the seven rat strains sequenced, and these are listed in Table 4. Northern blot analyses demonstrated that the rat Abcg5 gene is predominantly expressed in liver and small intestine, with a major transcript size of 2.6 kb and fainter transcript sizes of 1.1, 1.3, and 2.2 kb (Fig. 3A). Overexposure of the rat multiple tissue Northern blot resulted in the detection of faint Abcg5 transcripts in brain, kidney, and skin (data not shown). Rat Abcg8 mRNA expression is also predominant in liver and small intestine (Fig. 3B). Both of these tissues displayed an intense 3.9 kb transcript and a faint 2.6 kb transcript. In the present study, we report the first identification of a mutation in the rat Abcg5 gene that is responsible for phytosterolemia. This guanine-to-thymine transversion results in the substitution of a highly conserved glycine residue for a cysteine amino acid in the large extracellular loop between transmembrane domains 5 and 6 of the ABC half-transporter protein, sterolin-1. This mutation was present in both alleles of exon 12 of the Abcg5 gene in WKY inbred, SHR, and SHRSP rats. Our results correlate with previous reports demonstrating increased absorption and retention of plant sterols in the serum and tissues of WKY inbred, SHR, and SHRSP rats (14Ratnayake W.M.N. Plouffe L. Hollywood R. L’Abbe M.R. Hidiroglou N. Sarwar G. Mueller R. Influence of sources of dietary oils on the life span of stroke-prone spontaneously hypertensive rats.Lipids. 2000; 35: 409-420Google Scholar, 15Ratnayake W.M.N. L’Abbe M.R. Mueller R. Hayward S. Plouffe L. Hollywood R. Trick K. Vegetable oils high in phytosterols make erythrocytes less deformable and shorten the life span of stroke-prone spontaneously hypertensive rats.J. Nutr. 2000; 130: 1166-1178Google Scholar, 18Ikeda I. Nakagiri H. Sugano M. Ohara S. Hamada T. Nonaka M. Imaizumi K. Mechanisms of phytosterolemia in stroke-prone spontaneously hypertensive and WKY rats.Metabolism. 2001; 50: 1361-1368Google Scholar), and are consistent with the identification of other homozygous missense mutations in the human ABCG5 or ABCG8 genes in sitosterolemia patients (5Berge K.E. Tian H. Graf G.A. Yu L. Grishin N.V. Schultz J. Kwiterovich P. Shan B. Barnes R. Hobbs H.H. Accumulation of dietary cholesterol in sitosterolemia caused by mutations in adjacent ABC transporters.Science. 2000; 290: 1771-1775Google Scholar, 6Lee M.H. Lu K. Hazard S. Yu H. Shulenin S. Hidaka H. Kojima H. Allikmets R. Sakuma N. Pegoraro R. Srivastava A.K. Salen G. Dean M. Patel S.B. Identification of a gene, ABCG5, important in the regulation of dietary cholesterol absorption.Nat. Genet. 2001; 27: 79-83Google Scholar, 11Hubacek J.A. Berge K.E. Cohen J.C. Hobbs H.H. Mutations in ATP-cassette binding proteins G5 (ABCG5) and G8 (ABCG8) causing sitosterolemia.Hum. Mutat. 2001; 18: 359-360Google Scholar, 12Heimer S. Langmann T. Moehle C. Mauerer R. Dean M. Beil F.U. von Bergmann K. Schmitz G. Mutations in the human ATP binding cassette transporters ABCG5 and ABCG8 in sitosterolemia.Hum. Mutat. 2002; 20: 151Google Scholar). The homozygous mutation coincides with the recessive nature of the disease and with the development and inbreeding of these specific rat strains. The SHRSP inbred rat strain was developed from the SHR strain that is maintained in a closed colony (19Okamoto K. Yamori Y. Nagaoka A. Establishment of the stroke-prone spontaneously hypertensive rat (SHR).Circ. Res. 1974; 34: 143-153Google Scholar, 20Yamori Y. Importance of genetic factors in stroke: an evidence obtained by selective breeding of stroke-prone and -resistant SHR.Jpn. Circ. J. 1974; 38: 1095-1100Google Scholar, 21Yamori Y. Okamoto K. Spontaneous hypertension in the rat. A model for human “essential” hypertension.Verh. Dtsch. Ges. Inn. Med. 1974; 80: 168-170Google Scholar). The SHR strain was derived previously from the normotensive WKY inbred rat strain (22Okamoto K. Aoki K. Development of a strain of spontaneously hypertensive rats.Jpn. Circ. J. 1963; 27: 282-293Google Scholar). Based on the above information and on the absence of the glycine-to-cysteine amino acid substitution in the eight different rat strains tested, the data strongly suggest that the alteration at codon 583 represents a mutation. Formal proof of the mutation, however, will require functional analyses of the mutant protein. The ABCG5 half-transporter was initially speculated to act as a heterodimer with the ABCG8 half-transporter, because mutations in sitosterolemia patients have been found exclusively in ABCG5 or ABCG8, but never together (5Berge K.E. Tian H. Graf G.A. Yu L. Grishin N.V. Schultz J. Kwiterovich P. Shan B. Barnes R. Hobbs H.H. Accumulation of dietary cholesterol in sitosterolemia caused by mutations in adjacent ABC transporters.Science. 2000; 290: 1771-1775Google Scholar, 6Lee M.H. Lu K. Hazard S. Yu H. Shulenin S. Hidaka H. Kojima H. Allikmets R. Sakuma N. Pegoraro R. Srivastava A.K. Salen G. Dean M. Patel S.B. Identification of a gene, ABCG5, important in the regulation of dietary cholesterol absorption.Nat. Genet. 2001; 27: 79-83Google Scholar, 7Lu K. Lee M.H. Hazard S. Brooks-Wilson A. Hidaka H. Kojima H. Ose L. Stalenhoef A.F. Mietinnen T. Bjorkhem I. Bruckert E. Pandya A. Brewer Jr., H.B. Salen G. Dean M. Srivastava A. Patel S.B. Two genes that map to the STSL locus cause sitosterolemia: genomic structure and spectrum of mutations involving sterolin-1 and sterolin-2, encoded by ABCG5 and ABCG8, respectively.Am. J. Hum. Genet. 2001; 69: 278-290Google Scholar, 11Hubacek J.A. Berge K.E. Cohen J.C. Hobbs H.H. Mutations in ATP-cassette binding proteins G5 (ABCG5) and G8 (ABCG8) causing sitosterolemia.Hum. Mutat. 2001; 18: 359-360Google Scholar, 12Heimer S. Langmann T. Moehle C. Mauerer R. Dean M. Beil F.U. von Bergmann K. Schmitz G. Mutations in the human ATP binding cassette transporters ABCG5 and ABCG8 in sitosterolemia.Hum. Mutat. 2002; 20: 151Google Scholar). Graf et al. (26Graf G.A. Li W.P. Gerard R.D. Gelissen I. White A. Cohen J.C. Hobbs H.H. Coexpression of ATP-binding cassette proteins ABCG5 and ABCG8 permits their transport to the apical surface.J. Clin. Invest. 2002; 110: 659-669Google Scholar) have now demonstrated that ABCG5 and ABCG8 are N-linked glycosylated, physically interact, and require one another for transport from the endoplasmic reticulum to apical membranes. Our missense mutation in the extracellular loop between transmembrane domains 5 and 6 occurs near the canonical N-glycosylation sites of sterolin-1. We speculate that the amino acid substitution, which results in the addition of a sulfhydryl group, alters the tertiary structure of the protein, thereby preventing its interaction with sterolin-2. Consequently, assembly of the heterodimer and subsequent translocation from the endoplasmic reticulum into plasma/apical membranes will not occur, resulting in complete loss of ABC transporter function; however, one cannot rule out the possibility that the mutant ABC transporter may be properly expressed in plasma/apical membranes and still not function. Because expression of human ABCG5 and ABCG8 in mice caused a marked reduction in plasma levels of plant sterols (8Yu L. Li-Hawkins J. Hammer R.E. Berge K.E. Horton J.D. Cohen J.C. Hobbs H.H. Overexpression of ABCG5 and ABCG8 promotes biliary cholesterol secretion and reduces fractional absorption of dietary cholesterol.J. Clin. Invest. 2002; 110: 671-680Google Scholar), a loss of transporter function may lead to increased retention of plant sterols, presenting as phytosterolemia. Therefore, it appears that the SHR and SHRSP rat strains are excellent animal models for hypertension, hemorrhagic stroke, and phytosterolemia. Our results demonstrate that WKY inbred, SHR, and SHRSP rat strains represent the first naturally occurring animal models for the human disorder sitosterolemia, and are important models for studying the mechanisms of sterol trafficking.. The authors thank Dr. Nimal Ratnayake and Dr. Dennis Bulman for insightful discussions and Drs. Nimal Ratnayake, Steve Brooks, Jesse Bertinato, Kevin Cockell, Mary L’Abbé, Fraser Scott, and the Animal Resource Division at Health Canada for providing rat tissue samples. This research was funded by Health Canada." @default.
• W2083584334 created "2016-06-24" @default.
• W2083584334 creator A5030379297 @default.
• W2083584334 creator A5032865712 @default.
• W2083584334 creator A5063078310 @default.
• W2083584334 date "2003-05-01" @default.
• W2083584334 modified "2023-09-27" @default.
• W2083584334 title "Research Article" @default.
• W2083584334 cites W1510167055 @default.
• W2083584334 cites W1976707093 @default.
• W2083584334 cites W1983651374 @default.
• W2083584334 cites W1987372675 @default.
• W2083584334 cites W1987641460 @default.
• W2083584334 cites W2011954911 @default.
• W2083584334 cites W2023666259 @default.
• W2083584334 cites W2036021040 @default.
• W2083584334 cites W2047039616 @default.
• W2083584334 cites W2058878434 @default.
• W2083584334 cites W2094303590 @default.
• W2083584334 cites W2096319521 @default.
• W2083584334 cites W2099378835 @default.
• W2083584334 cites W2103960570 @default.
• W2083584334 cites W2129477632 @default.
• W2083584334 cites W2144963096 @default.
• W2083584334 cites W2146518753 @default.
• W2083584334 cites W2233236442 @default.
• W2083584334 cites W2252872720 @default.
• W2083584334 cites W4247935329 @default.
• W2083584334 cites W4251360714 @default.
• W2083584334 doi "https://doi.org/10.1194/jlr.m200438-jlr200" @default.
• W2083584334 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/12611906" @default.
• W2083584334 hasPublicationYear "2003" @default.
• W2083584334 type Work @default.
• W2083584334 sameAs 2083584334 @default.
• W2083584334 citedByCount "42" @default.
• W2083584334 countsByYear W20835843342012 @default.
• W2083584334 countsByYear W20835843342013 @default.
• W2083584334 countsByYear W20835843342014 @default.
• W2083584334 countsByYear W20835843342015 @default.
• W2083584334 countsByYear W20835843342018 @default.
• W2083584334 countsByYear W20835843342019 @default.
• W2083584334 countsByYear W20835843342021 @default.
• W2083584334 crossrefType "journal-article" @default.
• W2083584334 hasAuthorship W2083584334A5030379297 @default.
• W2083584334 hasAuthorship W2083584334A5032865712 @default.
• W2083584334 hasAuthorship W2083584334A5063078310 @default.
• W2083584334 hasBestOaLocation W20835843341 @default.
• W2083584334 hasConcept C70721500 @default.
• W2083584334 hasConcept C86803240 @default.
• W2083584334 hasConceptScore W2083584334C70721500 @default.
• W2083584334 hasConceptScore W2083584334C86803240 @default.
• W2083584334 hasIssue "5" @default.
• W2083584334 hasLocation W20835843341 @default.
• W2083584334 hasOpenAccess W2083584334 @default.
• W2083584334 hasPrimaryLocation W20835843341 @default.
• W2083584334 hasRelatedWork W1992782759 @default.
• W2083584334 hasRelatedWork W2013106815 @default.
• W2083584334 hasRelatedWork W2213189664 @default.
• W2083584334 hasRelatedWork W2316833920 @default.
• W2083584334 hasRelatedWork W2418104793 @default.
• W2083584334 hasRelatedWork W3085874984 @default.
• W2083584334 hasRelatedWork W3157487996 @default.
• W2083584334 hasRelatedWork W3214985509 @default.
• W2083584334 hasRelatedWork W4288436687 @default.
• W2083584334 hasRelatedWork W4308555169 @default.
• W2083584334 hasVolume "44" @default.
• W2083584334 isParatext "false" @default.
• W2083584334 isRetracted "false" @default.
• W2083584334 magId "2083584334" @default.
• W2083584334 workType "article" @default.