FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2083843080> ?p ?o ?g. }

• W2083843080 endingPage "34795" @default.
• W2083843080 startingPage "34786" @default.
• W2083843080 abstract "Hyperlipidemia (HL) impairs cardiac glucose homeostasis, but the molecular mechanisms involved are yet unclear. We examined HL-regulated GLUT4 and peroxisome proliferator-activated receptor (PPAR) γ gene expression in human cardiac muscle. Compared with control patients, GLUT4 protein levels were 30% lower in human cardiac muscle biopsies from patients with HL and/or type 2 diabetes mellitus, whereas GLUT4 mRNA levels were unchanged. PPARγ mRNA levels were 30-50% lower in patients with HL and/or diabetes mellitus type 2 than in controls. Reporter studies in H9C2 cardiomyotubes showed that HL in vitro, induced by high levels of arachidonic (AA) stearic, linoleic, and oleic acids (24 h, 200 μm) repressed transcription from the GLUT4 promoter; AA also repressed transcription from the PPARγ1 and PPARγ2 promoters. Co-expression of PPARγ2 repressed GLUT4 promoter activity, and the addition of AA further enhanced this effect. 5′-Deletion analysis revealed three GLUT4 promoter regions that accounted for AA-mediated effects: two repression-mediating sequences at -443/-423 bp and -222/-197 bp, the deletion of either or both of which led to a partial derepression of promoter activity, and a third derepression-mediating sequence at -612/-587 bp that was required for sustaining this derepression effect. Electromobility shift assay further shows that AA enhanced binding to two of the three regions of cardiac nuclear protein(s), the nature of which is still unknown. We propose that HL, exhibited as a high free fatty acid level, modulates GLUT4 gene expression in cardiac muscle via a complex mechanism that includes: (a) binding of AA mediator proteins to three newly identified response elements on the GLUT4 promoter gene and (b) repression of GLUT4 and the PPARγ genes by AA. Hyperlipidemia (HL) impairs cardiac glucose homeostasis, but the molecular mechanisms involved are yet unclear. We examined HL-regulated GLUT4 and peroxisome proliferator-activated receptor (PPAR) γ gene expression in human cardiac muscle. Compared with control patients, GLUT4 protein levels were 30% lower in human cardiac muscle biopsies from patients with HL and/or type 2 diabetes mellitus, whereas GLUT4 mRNA levels were unchanged. PPARγ mRNA levels were 30-50% lower in patients with HL and/or diabetes mellitus type 2 than in controls. Reporter studies in H9C2 cardiomyotubes showed that HL in vitro, induced by high levels of arachidonic (AA) stearic, linoleic, and oleic acids (24 h, 200 μm) repressed transcription from the GLUT4 promoter; AA also repressed transcription from the PPARγ1 and PPARγ2 promoters. Co-expression of PPARγ2 repressed GLUT4 promoter activity, and the addition of AA further enhanced this effect. 5′-Deletion analysis revealed three GLUT4 promoter regions that accounted for AA-mediated effects: two repression-mediating sequences at -443/-423 bp and -222/-197 bp, the deletion of either or both of which led to a partial derepression of promoter activity, and a third derepression-mediating sequence at -612/-587 bp that was required for sustaining this derepression effect. Electromobility shift assay further shows that AA enhanced binding to two of the three regions of cardiac nuclear protein(s), the nature of which is still unknown. We propose that HL, exhibited as a high free fatty acid level, modulates GLUT4 gene expression in cardiac muscle via a complex mechanism that includes: (a) binding of AA mediator proteins to three newly identified response elements on the GLUT4 promoter gene and (b) repression of GLUT4 and the PPARγ genes by AA. Glucose transport is the rate-limiting step for glucose metabolism in the heart (1Taegtmeyer H. Curr. Probl. Cardiol. 1994; 19: 59-113Crossref PubMed Scopus (334) Google Scholar). Under resting conditions, the heart derives about 70% of its energy from the oxidation of lipids and only 30% from glycolysis and glucose oxidation (1Taegtmeyer H. Curr. Probl. Cardiol. 1994; 19: 59-113Crossref PubMed Scopus (334) Google Scholar). Pathological states such as ischemia, hypertrophy, and congestive heart failure render the heart increasingly dependent on glucose to meet its metabolic demands (2Seymour A.M. Eldar H. Radda G.K. Biochim. Biophys. Acta. 1990; 1055: 107-116Crossref PubMed Scopus (59) Google Scholar, 3Owen P. Dennis S. Opie L.H. Circ. Res. 1990; 66: 344-354Crossref PubMed Scopus (180) Google Scholar, 4Nascimben L. Friedrich J. Liao R. Pauletto P. Pessina A.C. Ingwall J.S. Circulation. 1995; 91: 1824-1833Crossref PubMed Scopus (95) Google Scholar). Although patients with DM2 4The abbreviations used are: DM2, diabetes mellitus type 2; HL, hyperlipidemia; hCM, human cardiac muscle; PPAR, peroxisome proliferator-activated receptor; FFA, free fatty acid(s); ETYA, 5,8,11,14-eicosatetraynoic acid; AA, arachidonic acid; EMSA, electromobility shift assay; CHO, Chinese hamster ovary; RT, reverse transcription; PPRE, PPAR response element; FFA-RE, FFA response element; HNF, hepatic nuclear factor; TF, transcription factor; HPLC, high pressure liquid chromatography. 4The abbreviations used are: DM2, diabetes mellitus type 2; HL, hyperlipidemia; hCM, human cardiac muscle; PPAR, peroxisome proliferator-activated receptor; FFA, free fatty acid(s); ETYA, 5,8,11,14-eicosatetraynoic acid; AA, arachidonic acid; EMSA, electromobility shift assay; CHO, Chinese hamster ovary; RT, reverse transcription; PPRE, PPAR response element; FFA-RE, FFA response element; HNF, hepatic nuclear factor; TF, transcription factor; HPLC, high pressure liquid chromatography. and/or HL are at higher risk of developing coronary atherosclerosis, little is known about how these risk factors affect glucose homeostasis in hCM. In critically hospitalized patients, intensive normalization of plasma glucose levels was shown to be most beneficial way to reduce the size of the ischemic zone during coronary ischemia (5van den Berghe G. Wouters P. Weekers F. Verwaest C. Bruyninckx F. Schetz M. Vlasselaers D. Ferdinande P. Lauwers P. Bouillon R. N. Engl. J. Med. 2001; 345: 1359-1367Crossref PubMed Scopus (8134) Google Scholar). Insulin stimulation of glucose uptake in muscle and adipose tissue includes translocation of insulin-sensitive glucose transporters (GLUT4) from intracellular pools to the cell surface (6Karnieli E. Hissin P.J. Simpson I.A. Salans L.B. Cushman S.W. J. Clin. Invest. 1981; 68: 811-814Crossref PubMed Scopus (112) Google Scholar, 7Klip A. Ramlal T. Young D.A. Holloszy J.O. FEBS Lett. 1987; 224: 224-230Crossref PubMed Scopus (281) Google Scholar, 8James D.E. Piper R.C. Slot J.W. Trends Cell Biol. 1994; 4: 120-126Abstract Full Text PDF PubMed Scopus (95) Google Scholar). Reduced cellular content of GLUT4 is characteristic of DM2 and insulin resistance (9Karnieli E. Armoni M. Horm Res. 1990; 33: 99-104Crossref PubMed Scopus (15) Google Scholar, 10Kahn B.B. J. Cell. Biochem. 1992; 48: 122-128Crossref PubMed Scopus (32) Google Scholar). Stresses such as ischemia, hypoxia, and high frequency contraction can also modulate GLUT4 expression (11Abel E.D. Kaulbach H.C. Tian R. Hopkins J.C. Duffy J. Doetschman T. Minnemann T. Boers M.E. Hadro E. Oberste-Berghaus C. Quist W. Lowell B.B. Ingwall J.S. Kahn B.B. J. Clin. Invest. 1999; 104: 1703-1714Crossref PubMed Scopus (266) Google Scholar). Although GLUT4 knock-out mice are not diabetic, they do exhibit abnormalities in glucose and lipid metabolism, and cardiac hypertrophy is the most striking morphological consequence of ablation of GLUT4 expression (12Stenbit A.E. Katz E.B. Chatham J.C. Geenen D.L. Factor S.M. Weiss R.G. Tsao T.S. Malhotra A. Chacko V.P. Ocampo C. Jelicks L.A. Charron M.J. Am. J. Physiol. 2000; 279: H313-H318PubMed Google Scholar). Peroxisome proliferator-activated receptor (PPAR) γ has a critical role in adipogenesis (13Wahli W. Braissant O. Desvergne B. Chem. Biol. 1995; 2: 261-266Abstract Full Text PDF PubMed Scopus (261) Google Scholar). Two human PPARγ isoforms have been identified, PPARγ1 and PPARγ2. We have shown that both repress transcription of the GLUT4 promoter in primary adipocytes and that rosiglitazone exerts its anti-diabetic effects by alleviating this repression (14Armoni M. Kritz N. Harel C. Bar-Yoseph F. Chen H. Quon M.J. Karnieli E. J. Biol. Chem. 2003; 278: 30614-30623Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar). Although PPARγ2 is the main isoform expressed in adipocytes, both the γ1 and γ2 isoforms are found in muscle (15Gilde A.J. Van Bilsen M. Acta Physiol. Scand. 2003; 178: 425-434Crossref PubMed Scopus (133) Google Scholar), but their specific role in cardiac GLUT4 regulation is unknown. FFA represent an important link between obesity, insulin resistance, and DM2 (16Reaven G.M. Annu. Rev. Med. 1993; 44: 121-131Crossref PubMed Scopus (765) Google Scholar). Increased concentrations of plasma FFA in general, and AA in particular, inhibit insulin-stimulated glucose uptake into muscle (17Boden G. Proc. Assoc. Am. Physicians. 1999; 111: 241-248Crossref PubMed Scopus (185) Google Scholar). FFA-induced insulin resistance is mediated via activation of a serine kinase cascade that involves IκB kinase, leading to decreased translocation of GLUT4 to the plasma membrane and reduced insulin-stimulated glucose transport (18Hundal R.S. Petersen K.F. Mayerson A.B. Randhawa P.S. Inzucchi S. Shoelson S.E. Shulman G.I. J. Clin. Invest. 2002; 109: 1321-1326Crossref PubMed Scopus (587) Google Scholar, 19Kim J.K. Kim Y.J. Fillmore J.J. Chen Y. Moore I. Lee J. Yuan M. Li Z.W. Karin M. Perret P. Shoelson S.E. Shulman G.I. J. Clin. Invest. 2001; 108: 437-446Crossref PubMed Scopus (616) Google Scholar). Beyond that, FFA themselves exert a direct, membrane-independent influence on molecular events that govern gene expression (see reviews Refs. 20Sessler A.M. Ntambi J.M. J. Nutr. 1998; 128: 923-926Crossref PubMed Scopus (204) Google Scholar, 21Duplus E. Glorian M. Forest C. J. Biol. Chem. 2000; 275: 30749-30752Abstract Full Text Full Text PDF PubMed Scopus (298) Google Scholar, 22Pegorier J.P. Le May C. Girard J. J. Nutr. 2004; 134: 2444S-22449Crossref PubMed Google Scholar). It is believed that the regulation of gene expression by dietary fats has the greatest impact on the development of insulin resistance and its related pathophysiologies. FFA have been found to modulate gene transcription, mRNA stability, and cellular differentiation (23Pegorier J.P. Curr. Opin. Clin. Nutr. Metab. Care. 1998; 1: 329-334Crossref PubMed Scopus (36) Google Scholar). Chronic exposure of adipocytes to AA represses GLUT4 gene expression at the levels of both transcription and mRNA destabilization (24Long S.D. Pekala P.H. J. Biol. Chem. 1996; 271: 1138-1144Abstract Full Text Full Text PDF PubMed Scopus (112) Google Scholar). However, less is known about FFA-induced regulation of PPARγ either at the level of gene transcription and or at the level of receptor activation. Therefore, we examined whether HL in vivo inhibits GLUT4 gene expression in hCM and whether PPARγ mediates this effect. We present a novel model suggesting that both AA and PPARγ repress GLUT4 transcription in vitro, whereas AA also represses PPARγ transcription. We suggest that the AA-mediated effect on PPARγ explains the discrepancy observed between repressed transcription from the GLUT4 promoter in vitro and its unchanged mRNA levels in vivo. Materials—T4 polynucleotide kinase was obtained from Roche Diagnostics. [γ-32P]ATP (6000 Ci/mmol) was obtained from Amersham Biosciences. Free fatty acids were from Sigma. 5,8,11,14-Eicosatetraynoic acid (ETYA) was obtained from Cayman Chemical (Ann Arbor, MI). Cell culture reagents were from Biological Industries (Beth-Haemek, Israel). Human Cardiac Muscle Biopsies—In vivo studies were preformed in human cardiac muscle. Biopsies from the right atrial appendage were obtained during elective coronary artery bypass surgery from patients with HL and/or DM2 and matched euglycemic controls. The Human Rights Committee of the Rambam Medical Center approved the study, and written informed consent was obtained from each patient prior to the elective surgery. Cell Cultures—In vitro studies were performed in rat embryonal heart-derived H9C2 cells (ATCC CRL-1446), Chinese hamster ovary (CHO)-K1 fibroblasts (ATCC CCL-61), and rat skeletal muscle-derived L6 myoblasts (ATCC CRL-1458). Human HeLa cells were a gift from Dr. Richard Pestell (Albert Einstein College of Medicine, New York, NY) (25Wang C. Fu M. D'Amico M. Albanese C. Zhou J.N. Brownlee M. Lisanti M.P. Chatterjee V.K. Lazar M.A. Pestell R.G. Mol. Cell. Biol. 2001; 21: 3057-3070Crossref PubMed Scopus (150) Google Scholar). Cell cultures were grown in an atmosphere of 95% air, 5% CO2 in high glucose Dulbecco's modified Eagle's medium (H9C2, L6, and HeLa) or Ham's F-12 medium (CHO-K1 cells) supplemented with 10% fetal bovine serum, 100 units/ml penicillin, and 100 μg/ml streptomycin. H9C2 and L6 cells were induced to differentiate into myotubes in Dulbecco's modified Eagle's medium with 2% fetal bovine serum; differentiation was defined by morphological features and creatinine phosphokinase activity (26Schopf G. Rumpold H. Muller M.M. Biochim. Biophys. Acta. 1986; 884: 319-325Crossref PubMed Scopus (16) Google Scholar). Reverse Transcription (RT)-PCR and Northern Blot Analyses—Analysis of total cellular RNA by RT-PCR and Northern blots was preformed as detailed before (27Armoni M. Quon M.J. Maor G. Avigad S. Shapiro D.N. Harel C. Esposito D. Goshen Y. Yaniv I. Karnieli E. J. Clin. Endocrinol. Metab. 2002; 87: 5312-5324Crossref PubMed Scopus (31) Google Scholar). Immunodetection of Proteins—Crude membrane fractions prepared from the human cardiac muscle biopsies and total cell lysates prepared from H9C2 myocytes were analyzed for presence of GLUT1 and GLUT4 proteins using Western blotting and specific antibodies, as described by us previously (7Klip A. Ramlal T. Young D.A. Holloszy J.O. FEBS Lett. 1987; 224: 224-230Crossref PubMed Scopus (281) Google Scholar, 28Armoni M. Harel C. Burvin R. Karnieli E. Endocrinology. 1995; 136: 3292-3298Crossref PubMed Scopus (20) Google Scholar). Cellular 2-Deoxyglucose Uptake Rates—Fully differentiated H9C2 myotubes were incubated for 24 h in either the absence or presence of 200 μm AA. The next morning, the cells were transferred to Krebs-Ringer phosphate buffer (pH 7.4) that was either supplemented or not with 10 nm insulin for 30 min at 25 °C. The cellular rates of [3H]2-deoxyglucose uptake were assessed as described previously (28Armoni M. Harel C. Burvin R. Karnieli E. Endocrinology. 1995; 136: 3292-3298Crossref PubMed Scopus (20) Google Scholar). Expression Vectors and Luciferase Promoter Reporters—The expression vector encoding the wild-type mouse PPARγ2 in pSV-SPORT1, as well as luciferase-conjugated promoter reporters for GLUT1 (pGLUT1-P-Luc), GLUT4 (pGLUT4-P-Luc), and (AOX)3-Luc have been described previously (29Tontonoz P. Hu E. Graves R.A. Budavari A.I. Spiegelman B.M. Genes Dev. 1994; 8: 1224-1234Crossref PubMed Scopus (1991) Google Scholar). A series of progressively 5′-deleted promoter reporters was generated from pGLUT4-P-Luc using a QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA), and the sequences were confirmed by direct sequencing. The human PPARγ1 and PPARγ2 promoters in pGL3-Luc were obtained from Dr. Luis Fajas (CNRS INSERM, Strasbourg, France). Transient Expression and GLUT4 Promoter Reporter Assays—CHO-K1 and HeLa cells were plated in 100-mm dishes (750,000 cells/dish) and transfected 24 h later. H9C2 and L6 myotubes were transfected in the 8-day, fully differentiated state. Transfections were performed as previously described (14Armoni M. Kritz N. Harel C. Bar-Yoseph F. Chen H. Quon M.J. Karnieli E. J. Biol. Chem. 2003; 278: 30614-30623Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar, 27Armoni M. Quon M.J. Maor G. Avigad S. Shapiro D.N. Harel C. Esposito D. Goshen Y. Yaniv I. Karnieli E. J. Clin. Endocrinol. Metab. 2002; 87: 5312-5324Crossref PubMed Scopus (31) Google Scholar). One set of dishes, co-transfected with the (AOX)3-Luc promoter reporter, served as positive control for activation of PPARγ transcription. The next day, the medium was replaced with serum-free medium supplemented with 1% bovine serum albumin and 0-300 μm of the indicated FFA (stearic, oleic, linoleic, or arachidonic acid; Sigma), and the cells were incubated for additional 24 h at 37 °C. Luciferase activity was measured with a luciferase reporter assay kit (Promega, Madison, WI) and normalized to β-galactosidase activity as an internal control (30Sambrook J. Fritsh E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratorym, Cold Spring Harbor, NY1989: 16-17Google Scholar). Within each experiment, the values are expressed as percentages of the induced basal promoter reporter activity, i.e. the activity obtained in cells transfected with the reporter alone. Electromobility Shift Assays (EMSA)—Based on data from 5′-deletion analysis, promoter-derived probes for EMSA were synthesized commercially (Sigma), and sense and antisense oligonucleotides were annealed and end-labeled. The nuclear extracts were prepared from H9C2 cardiomyotubes that had been preincubated with or without 200 μm AA for 24 h. Binding reactions and sample analysis by EMSA were performed as reported previously (14Armoni M. Kritz N. Harel C. Bar-Yoseph F. Chen H. Quon M.J. Karnieli E. J. Biol. Chem. 2003; 278: 30614-30623Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar, 27Armoni M. Quon M.J. Maor G. Avigad S. Shapiro D.N. Harel C. Esposito D. Goshen Y. Yaniv I. Karnieli E. J. Clin. Endocrinol. Metab. 2002; 87: 5312-5324Crossref PubMed Scopus (31) Google Scholar). For supershift assays, nuclear extracts were preincubated with either anti-PPARγ or anti-HNF4α antibodies (Santa Cruz Biotechnology, Santa Cruz, CA) for 10 min prior to the addition of the labeled probe. Analytical Procedures—Plasma insulin levels were assessed by radioimmunoassay (Biodata, Milano, Italy). Serum FFA levels were assessed by HPLC and standard kits. Blood glycosylated hemoglobin (HbA1c) was assayed using the IMX system and its reagents (Abbott Laboratories, Abbott Park, IL). Statistical Analysis—The data were analyzed statistically using a two-tailed Student's t test for unpaired samples. The p values < 0.05 were considered statistically significant. The results are expressed as the means ± S.E. Clinical Characteristics of the Patients—The study groups consisted of patients with coronary arterial disease and various degrees of HL and/or DM2 and normoglycemic normolipidemic controls matched for age, sex, and weight (expressed as body mass index). Clinical data from these patients are shown in TABLE ONE. Control subjects (n = 24) had normal plasma levels of glucose, insulin, HbA1c, triglycerides, and cholesterol. The HL group (n = 19) had significantly higher levels of triglycerides and total cholesterol (as defined in Ref. 31Program National Cholesterol Education Circulation. 2002; 106: 3143-3421Crossref PubMed Scopus (11202) Google Scholar) but did not have diabetes. A third group included DM2 patients, as defined in Ref. 32Diabetes Care. 2003; 26: S5-S20Crossref PubMed Google Scholar, with fasting hyperglycemia, mild hyperinsulinemia, and elevated blood HbA1c. A fourth group (HL+DM2) included 23 patients with significantly higher levels of triglycerides and total cholesterol and co-existing DM2. The levels of seven major FFA were assessed in the sera of patients in the control and DM2 groups. Levels of all FFA examined were significantly higher in patients with DM2 or hyperlipidemia than in the euglycemic controls (TABLE TWO).TABLE ONEClinical data of the patients The data are presented as the means ± S.E. of the individual values obtained in each group. The body mass index was calculated as [weight (kg)]/[height (m)]2. Parameter Control HL DM2 HL + DM2 Sex (M/FM) 18/6 14/5 12/4 18/5 Age (years) 57 ± 4 63 ± 2 67 ± 5 64 ± 2 Body mass index 25.7 ± 1.4 29.7 ± 1.9ap < 0.05 relative to control 27.3 ± 0.9 27.5 ± 0.8 Fasting plasma glucose (mmol/liter) 4.4 ± 0.2 5.2 ± 0.3ap < 0.05 relative to control 10.5 ± 1.4a,p < 0.05 relative to controlbp < 0.05 relative to the HL group 8.9 ± 1.4a,p < 0.05 relative to controlbp < 0.05 relative to the HL group HbA1C (%) 5.7 ± 0.2 6.1 ± 0.4 8.3 ± 0.9a,p < 0.05 relative to controlbp < 0.05 relative to the HL group 9.3 ± 1.2a,p < 0.05 relative to controlbp < 0.05 relative to the HL group Fasting plasma insulin (pmol/liter) 102 ± 19 48 ± 7 338 ± 10a,p < 0.05 relative to controlbp < 0.05 relative to the HL group 128 ± 45 Plasma triglycerides (mg/dl) 114 ± 15 213 ± 25ap < 0.05 relative to control 137 ± 11bp < 0.05 relative to the HL group 258 ± 49a,p < 0.05 relative to controlcp < 0.05 relative to DM group Total cholesterol (mg/dl) 198 ± 18 243 ± 24ap < 0.05 relative to control 131 ± 29bp < 0.05 relative to the HL group 220 ± 25cp < 0.05 relative to DM groupa p < 0.05 relative to controlb p < 0.05 relative to the HL groupc p < 0.05 relative to DM group Open table in a new tab TABLE TWOSerum levels of FFA in the patients The blood samples were obtained from the patients, and the serum levels of FFA were assessed with HPLC and standard kits. The data are presented as the means ± S.E. of the individual values obtained for patients that either have DM2 (DM2) or do not (control). Fatty acid Control DM2 Arachidonic acid 408 ± 37 511 ± 32ap < 0.05 relative to control. The values are given in μmol/liter Linolenic acid 64 ± 8 80 ± 5ap < 0.05 relative to control. The values are given in μmol/liter Linoleic acid 1806 ± 98 2182 ± 80ap < 0.05 relative to control. The values are given in μmol/liter Oleic acid 1850 ± 173 2471 ± 171ap < 0.05 relative to control. The values are given in μmol/liter Stearic acid 626 ± 57 791 ± 44ap < 0.05 relative to control. The values are given in μmol/liter Palmitic acid 2100 ± 178 2835 ± 212ap < 0.05 relative to control. The values are given in μmol/litera p < 0.05 relative to control. The values are given in μmol/liter Open table in a new tab Endogenous Expression of the GLUT and PPARγ Genes in hCM Biopsies—To identify specific effects of HL and/or DM2 on GLUT gene expression in hCM in vivo, endogenous levels of GLUT1 and GLUT4 protein and mRNA were determined by Western and Northern blotting, respectively (Fig. 1). Compared with controls, GLUT4 protein was expressed at levels ∼30% lower in HL and DM2-derived hCM, whereas levels of GLUT1 protein were slightly elevated. Levels of GLUT1 mRNA (assessed in the same hCM samples) were only slightly elevated in HL patients and were unchanged in both DM2 and HL+DM2 patients (HL, 116 ± 11%; DM2, 100 ± 8%; and HL+DM2, 88 ± 12%; p ≥ 0.05 versus controls), whereas GLUT4 mRNA levels were not different from control levels in any of the groups (HL 92 ± 7%; DM2 100 ± 5%; and HL+DM2 91 ± 7%; p ≥ 0.05 versus controls). To explore the discrepancy observed between GLUT4 gene regulation at the mRNA and protein levels, PPARγ mRNA levels were assessed, because PPARγ has been suggested to mediate some of the effects of FFA at the level of transcription (33Guan H.P. Ishizuka T. Chui P.C. Lehrke M. Lazar M.A. Genes Dev. 2005; 19: 453-461Crossref PubMed Scopus (249) Google Scholar). Indeed, although PPARγ mRNA levels in hCM were unaffected by DM2 (89% ± 10% p ≥ 0.05 versus controls) and only mildly decreased in HL (76% ± 6%, p ≥ 0.05 versus controls), a major decrease was observed in the HL+DM2 group (53 ± 6%; p < 0.05 versus controls). This suggests that HL and DM2 may act synergistically to repress PPARγ gene expression, leading to derepression of GLUT4. Characterization of H9C2 Cardiomyotubes—To establish the validity of this cell line as a cellular model for cardiac muscle, we studied the endogenous expression of GLUT4 upon differentiation. Reduction of fetal calf serum from 10% to 2% for 1 week caused the cells to differentiate into myocytes and then into myotubes, reaching maximal differentiation at 8 days post-serum starvation. Maximal differentiation was determined by morphological features (Fig. 2A) and creatinine phosphokinase enzymatic activity, which was elevated more than 10-fold in differentiated myotubes (Fig. 2B). Gene expression at the mRNA level was assessed by RT-PCR analysis using the primers detailed in TABLE THREE. This analysis revealed that H9C2 myoblasts express mRNA for GLUT1 but not GLUT4, whereas cellular differentiation into myotubes resulted in a clear induction of endogenous GLUT4 mRNA and protein (Fig. 2, C and D). We evaluated GLUT4 protein expression in H9C2 cells at -4, 0, 6, 7, and 8 days of serum starvation (Fig. 2D) and found that GLUT4 protein is maximally expressed in H9C2 myotubes at day 6, reaching ∼40% of the level found in normal rat skeletal muscle. The size of the GLUT4 protein in differentiated H9C2 cells was ∼50 kDa, which is the same as that normally found in fully differentiated rat muscle cells. To further establish that the expressed GLUT4 is functionally active, basal and insulin-stimulated rates of 2-deoxy-d-glucose uptake were assessed in 8-day fully differentiated H9C2 myotubes that had been incubated for 24 h in the presence or absence of 200 μm AA in the medium. Incubation with AA increased basal glucose uptake rates by about 160%, and insulin did not stimulate glucose uptake any further beyond this (data not shown). These results are consistent with findings from Nugent et al. (34Nugent C. Prins J.B. Whitehead J.P. Wentworth J.M. Chatterjee V.K. O'Rahilly S. J. Biol. Chem. 2001; 276: 9149-9157Abstract Full Text Full Text PDF PubMed Scopus (97) Google Scholar), who reported that AA potentiated basal and insulin-stimulated glucose uptake in 3T3-L1 adipocytes by increasing the levels of both GLUT1 and GLUT4 at the cell surface. To further validate the suitability of H9C2 as our experimental model, fully differentiated H9C2 myotubes were incubated for 24 h either with or without 200 μm AA, and the total cellular level of GLUT4 proteins was assessed by Western immunoblotting. As shown in Fig. 2E, AA treatment significantly decreased the total level of GLUT4 proteins by as much as 40% below basal levels.TABLE THREESequences of primers used in RT-PCR The sense and anti-sense primers specific for the detection of mRNA for β-actin, GLUT1, GLUT4, and PPARγ were synthesized based on sequences obtained from GenBank™, as detailed previously (27Armoni M. Quon M.J. Maor G. Avigad S. Shapiro D.N. Harel C. Esposito D. Goshen Y. Yaniv I. Karnieli E. J. Clin. Endocrinol. Metab. 2002; 87: 5312-5324Crossref PubMed Scopus (31) Google Scholar). The primers for the detection of the PPARγ isoforms were according to Fajas et al. (40Fajas L. Auboeuf D. Raspe E. Schoonjans K. Lefebvre A.M. Saladin R. Najib J. Laville M. Fruchart J.C. Deeb S. Vidal-Puig A. Flier J. Briggs M.R. Staels B. Vidal H. Auwerx J. J. Biol. Chem. 1997; 272: 18779-18789Abstract Full Text Full Text PDF PubMed Scopus (1078) Google Scholar). Sense Antisense β-Actin GACGAGGCCCAGAGCAAGAGCG TCAGGCAGCATAGCTCTCCAGGG GLUT1 GCCATACTCATGACCATCGC AGCTCCTCGGGTGTCTTATC GLUT4 CATCCTGATGACTGTGGCTC TCTCATCTGGCCCTAAATACT PPARγ (total) tctctccgtaatggaagacc gcattatgagcatccccac PPARγ2 gcgattcct tcactgatac gcattatgagcatccccac Open table in a new tab In all, these data confirm that 8-day fully differentiated H9C2 myotubes are an appropriate cellular model for studying in vitro GLUT4 gene regulation in cardiac muscle and for establishing the role of lipotoxicity in the aberrant GLUT4 gene regulation in cardiac muscle from patients with cardiac diseases. FFA Repress Transcriptional Activity from the GLUT4 Gene Promoter—We next studied the effects of FFA on GLUT4 gene regulation at promoter level. Fully differentiated H9C2 myotubes were co-transfected with the GLUT4-P-Luc promoter reporter and incubated with 0-300 μm of stearic, oleic, linoleic, or arachidonic acid. As shown in Fig. 3, all FFA tested repressed transcription from the GLUT4 promoter by ∼20-40% at 100 μm and by ∼60% at 200 μm. Specifically, incubation of cells with 200 μm of arachidonic, stearic, oleic, or linoleic acid repressed GLUT4 promoter activity to 42, 36, 31, and 39%, respectively, of basal level (all differences are significant at p < 0.05 level). Because of the central role of AA in cellular metabolism and its known ability to regulate GLUT4 gene expression in 3T3-L1 adipocytes (24Long S.D. Pekala P.H. J. Biol. Chem. 1996; 271: 1138-1144Abstract Full Text Full Text PDF PubMed Scopus (112) Google Scholar), we further investigated its effects on GLUT4 promoter activity in both insulin-responsive and nonresponsive cell types (Fig. 3B). In all cell types examined, GLUT4 promoter activity was repressed by AA in a dose-dependent manner, reaching a maximum of 40-60% repression at 100-200 μm. Under similar conditions, AA also repressed the GLUT1 promoter activity in a dose-dependent manner, to a maximum of 30% (data not shown). To differentiate between direct and indirect effects of AA, we utilized a nonmetabolized analog of AA, ETYA. ETYA repressed GLUT4 much less than AA (Fig. 3C). This diminished effect of ETYA, a potent inhibitor of both lipoxygenase and cycloxygenase and an activator of PPARs (24Long S.D. Pekala P.H. J. Biol. Chem. 1996; 271: 1138-1144Abstract Full Text Full Text PDF PubMed Scopus (112) Google Scholar), suggests that a second pathway may exist in which AA directly represses GLUT4 gene expression at the promoter level. PPARγ as Mediator of AA Effects on GLUT4 Promoter Activity—FFA and their metabolites are ligands of PPARγ receptors and play key roles in many cellular events, including regulating the expression of genes involved in lipid and glucose homeostasis (33Guan H.P. Ishizuka T." @default.
• W2083843080 created "2016-06-24" @default.
• W2083843080 creator A5022181301 @default.
• W2083843080 creator A5028489682 @default.
• W2083843080 creator A5033039819 @default.
• W2083843080 creator A5036643076 @default.
• W2083843080 creator A5039146718 @default.
• W2083843080 date "2005-10-01" @default.
• W2083843080 modified "2023-09-27" @default.
• W2083843080 title "Free Fatty Acids Repress the GLUT4 Gene Expression in Cardiac Muscle via Novel Response Elements" @default.
• W2083843080 cites W1578840576 @default.
• W2083843080 cites W1644344232 @default.
• W2083843080 cites W1903949561 @default.
• W2083843080 cites W1968839983 @default.
• W2083843080 cites W1970312964 @default.
• W2083843080 cites W1970680837 @default.
• W2083843080 cites W1974079851 @default.
• W2083843080 cites W1980717583 @default.
• W2083843080 cites W1996845220 @default.
• W2083843080 cites W2010721602 @default.
• W2083843080 cites W2011067202 @default.
• W2083843080 cites W2013705368 @default.
• W2083843080 cites W2017639766 @default.
• W2083843080 cites W2021007157 @default.
• W2083843080 cites W2022584932 @default.
• W2083843080 cites W2024969833 @default.
• W2083843080 cites W2031637294 @default.
• W2083843080 cites W2032117354 @default.
• W2083843080 cites W2035481611 @default.
• W2083843080 cites W2048952408 @default.
• W2083843080 cites W2061914106 @default.
• W2083843080 cites W2078075091 @default.
• W2083843080 cites W2079389643 @default.
• W2083843080 cites W2093969743 @default.
• W2083843080 cites W2097838137 @default.
• W2083843080 cites W2118885924 @default.
• W2083843080 cites W2151175078 @default.
• W2083843080 cites W2160315270 @default.
• W2083843080 cites W2160971992 @default.
• W2083843080 cites W2162244331 @default.
• W2083843080 cites W2164015929 @default.
• W2083843080 cites W2169224393 @default.
• W2083843080 cites W2169726677 @default.
• W2083843080 cites W2172692903 @default.
• W2083843080 cites W2321364863 @default.
• W2083843080 cites W4230870013 @default.
• W2083843080 cites W4234393699 @default.
• W2083843080 cites W4246592598 @default.
• W2083843080 doi "https://doi.org/10.1074/jbc.m502740200" @default.
• W2083843080 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/16096283" @default.
• W2083843080 hasPublicationYear "2005" @default.
• W2083843080 type Work @default.
• W2083843080 sameAs 2083843080 @default.
• W2083843080 citedByCount "84" @default.
• W2083843080 countsByYear W20838430802012 @default.
• W2083843080 countsByYear W20838430802013 @default.
• W2083843080 countsByYear W20838430802014 @default.
• W2083843080 countsByYear W20838430802015 @default.
• W2083843080 countsByYear W20838430802016 @default.
• W2083843080 countsByYear W20838430802017 @default.
• W2083843080 countsByYear W20838430802018 @default.
• W2083843080 countsByYear W20838430802019 @default.
• W2083843080 countsByYear W20838430802020 @default.
• W2083843080 countsByYear W20838430802021 @default.
• W2083843080 countsByYear W20838430802022 @default.
• W2083843080 countsByYear W20838430802023 @default.
• W2083843080 crossrefType "journal-article" @default.
• W2083843080 hasAuthorship W2083843080A5022181301 @default.
• W2083843080 hasAuthorship W2083843080A5028489682 @default.
• W2083843080 hasAuthorship W2083843080A5033039819 @default.
• W2083843080 hasAuthorship W2083843080A5036643076 @default.
• W2083843080 hasAuthorship W2083843080A5039146718 @default.
• W2083843080 hasBestOaLocation W20838430801 @default.
• W2083843080 hasConcept C104317684 @default.
• W2083843080 hasConcept C134018914 @default.
• W2083843080 hasConcept C138626823 @default.
• W2083843080 hasConcept C150194340 @default.
• W2083843080 hasConcept C185592680 @default.
• W2083843080 hasConcept C2776188179 @default.
• W2083843080 hasConcept C2778996579 @default.
• W2083843080 hasConcept C55493867 @default.
• W2083843080 hasConcept C86803240 @default.
• W2083843080 hasConcept C95444343 @default.
• W2083843080 hasConceptScore W2083843080C104317684 @default.
• W2083843080 hasConceptScore W2083843080C134018914 @default.
• W2083843080 hasConceptScore W2083843080C138626823 @default.
• W2083843080 hasConceptScore W2083843080C150194340 @default.
• W2083843080 hasConceptScore W2083843080C185592680 @default.
• W2083843080 hasConceptScore W2083843080C2776188179 @default.
• W2083843080 hasConceptScore W2083843080C2778996579 @default.
• W2083843080 hasConceptScore W2083843080C55493867 @default.
• W2083843080 hasConceptScore W2083843080C86803240 @default.
• W2083843080 hasConceptScore W2083843080C95444343 @default.
• W2083843080 hasIssue "41" @default.
• W2083843080 hasLocation W20838430801 @default.
• W2083843080 hasOpenAccess W2083843080 @default.
• W2083843080 hasPrimaryLocation W20838430801 @default.
• W2083843080 hasRelatedWork W2009966535 @default.

• next