FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2083884524> ?p ?o ?g. }

• W2083884524 endingPage "230" @default.
• W2083884524 startingPage "223" @default.
• W2083884524 abstract "The present study was designed to explore the possible presence and location of Vitamin D response elements (VDREs) in the human insulin receptor (hIR) gene promoter. To this end, the -1819 to -271 bp fragment of the hIR promoter (wild type promoter) and progressive 5' deletions of this promoter (up to -1473 and -876 bp) were linked to the luciferase pGL2-basic vector to construct the reported plasmids: phIR (-1819)-GL2, phIR(-1473)-GL2 and phIR(-876)-GL2, respectively. U-937 cells were transiently transfected with these plasmids, and then the cells were either untreated or treated for 24h with 10(-8) M 1,25-dihydroxyvitamin D(3) (1,25D(3)). Luciferase determinations revealed that, while the activity of the wild promoter was increased 1.6-fold by the hormone, the activities of progressive 5' deletions of this promoter were enhanced 1.7-, and 1.6-fold, respectively. Thus, the region extending from -876 to -271bp of the hIR promoter, appears to contain VDREs, and to be sufficient for induction by 1,25D(3). In order to identify these potential VDREs, we performed a computer search of candidate sequences by homology with a consensus VDRE sequence. This search yielded a sequence located between -761 and -732 bp (5'CGTCGGGCCTGTGGGGCGCCTCCGGGGGTC3'), which includes an overlapping AP-2 like sequence, as a good candidate. Electrophoretic mobility shift assays revealed that the Vitamin D receptor (VDR) specifically recognized this sequence, since a VDR-DNA complex was able to compete with the unlabeled probe and was cleared by the specific anti-VDR antibody 9A7. These data represent the first identification of a VDRE in the hIR gene promoter." @default.
• W2083884524 created "2016-06-24" @default.
• W2083884524 creator A5039116048 @default.
• W2083884524 creator A5086317190 @default.
• W2083884524 creator A5090294564 @default.
• W2083884524 creator A5091371608 @default.
• W2083884524 date "2003-02-01" @default.
• W2083884524 modified "2023-10-06" @default.
• W2083884524 title "Identification of a Vitamin D response element in the human insulin receptor gene promoter" @default.
• W2083884524 cites W1483414388 @default.
• W2083884524 cites W1485317916 @default.
• W2083884524 cites W1543414397 @default.
• W2083884524 cites W1559756705 @default.
• W2083884524 cites W1596857047 @default.
• W2083884524 cites W1833357961 @default.
• W2083884524 cites W1919133853 @default.
• W2083884524 cites W1981010726 @default.
• W2083884524 cites W1983966345 @default.
• W2083884524 cites W1987030705 @default.
• W2083884524 cites W1991841533 @default.
• W2083884524 cites W1995622189 @default.
• W2083884524 cites W1997791083 @default.
• W2083884524 cites W2009874139 @default.
• W2083884524 cites W2010972666 @default.
• W2083884524 cites W2029506276 @default.
• W2083884524 cites W2029820081 @default.
• W2083884524 cites W2033900037 @default.
• W2083884524 cites W2039201496 @default.
• W2083884524 cites W2055654988 @default.
• W2083884524 cites W2066668961 @default.
• W2083884524 cites W2073870011 @default.
• W2083884524 cites W2091044779 @default.
• W2083884524 cites W2098067476 @default.
• W2083884524 cites W2099240835 @default.
• W2083884524 cites W2118456958 @default.
• W2083884524 cites W2128090742 @default.
• W2083884524 cites W2128252687 @default.
• W2083884524 cites W2136706713 @default.
• W2083884524 cites W2140115103 @default.
• W2083884524 cites W2162741492 @default.
• W2083884524 cites W2335257837 @default.
• W2083884524 cites W2350931375 @default.
• W2083884524 cites W2895845142 @default.
• W2083884524 cites W4232445272 @default.
• W2083884524 cites W4241189084 @default.
• W2083884524 cites W4243135996 @default.
• W2083884524 cites W4245029404 @default.
• W2083884524 cites W4255795633 @default.
• W2083884524 doi "https://doi.org/10.1016/s0960-0760(03)00032-3" @default.
• W2083884524 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/12711007" @default.
• W2083884524 hasPublicationYear "2003" @default.
• W2083884524 type Work @default.
• W2083884524 sameAs 2083884524 @default.
• W2083884524 citedByCount "296" @default.
• W2083884524 countsByYear W20838845242012 @default.
• W2083884524 countsByYear W20838845242013 @default.
• W2083884524 countsByYear W20838845242014 @default.
• W2083884524 countsByYear W20838845242015 @default.
• W2083884524 countsByYear W20838845242016 @default.
• W2083884524 countsByYear W20838845242017 @default.
• W2083884524 countsByYear W20838845242018 @default.
• W2083884524 countsByYear W20838845242019 @default.
• W2083884524 countsByYear W20838845242020 @default.
• W2083884524 countsByYear W20838845242021 @default.
• W2083884524 countsByYear W20838845242022 @default.
• W2083884524 countsByYear W20838845242023 @default.
• W2083884524 crossrefType "journal-article" @default.
• W2083884524 hasAuthorship W2083884524A5039116048 @default.
• W2083884524 hasAuthorship W2083884524A5086317190 @default.
• W2083884524 hasAuthorship W2083884524A5090294564 @default.
• W2083884524 hasAuthorship W2083884524A5091371608 @default.
• W2083884524 hasConcept C101762097 @default.
• W2083884524 hasConcept C104317684 @default.
• W2083884524 hasConcept C111335760 @default.
• W2083884524 hasConcept C121608353 @default.
• W2083884524 hasConcept C132376346 @default.
• W2083884524 hasConcept C150194340 @default.
• W2083884524 hasConcept C153911025 @default.
• W2083884524 hasConcept C179639408 @default.
• W2083884524 hasConcept C22744801 @default.
• W2083884524 hasConcept C51445715 @default.
• W2083884524 hasConcept C530470458 @default.
• W2083884524 hasConcept C54009773 @default.
• W2083884524 hasConcept C54355233 @default.
• W2083884524 hasConcept C84606932 @default.
• W2083884524 hasConcept C86803240 @default.
• W2083884524 hasConceptScore W2083884524C101762097 @default.
• W2083884524 hasConceptScore W2083884524C104317684 @default.
• W2083884524 hasConceptScore W2083884524C111335760 @default.
• W2083884524 hasConceptScore W2083884524C121608353 @default.
• W2083884524 hasConceptScore W2083884524C132376346 @default.
• W2083884524 hasConceptScore W2083884524C150194340 @default.
• W2083884524 hasConceptScore W2083884524C153911025 @default.
• W2083884524 hasConceptScore W2083884524C179639408 @default.
• W2083884524 hasConceptScore W2083884524C22744801 @default.
• W2083884524 hasConceptScore W2083884524C51445715 @default.
• W2083884524 hasConceptScore W2083884524C530470458 @default.
• W2083884524 hasConceptScore W2083884524C54009773 @default.

• next