FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2084489095> ?p ?o ?g. }

• W2084489095 endingPage "24341" @default.
• W2084489095 startingPage "24335" @default.
• W2084489095 abstract "Overexpression of the HER-2 (neu, erb B-2) receptor results in cellular transformation and is associated with a variety of human cancers. Multiple mechanisms, including gene amplification and transcriptional, post-transcriptional, and translational controls contribute to the regulation of HER-2 expression. One of the components of these regulatory mechanisms is a short upstream open reading frame (uORF) in the HER-2 mRNA that represses downstream translation in a variety of cell types. Here we explore the mechanism by which this uORF exerts its inhibitory effect.As judged by comparisons of protein and mRNA abundance and by polysomal distribution analyses, the uORF represses translation of the HER-2 cistron or of a heterologous reporter gene. Despite its conservation among mammalian species, the peptide sequence of the uORF is not required for this inhibitory effect. Rather, the majority of ribosomes that load on the HER-2 mRNA most likely translate the uORF and are then unable to reinitiate at the downstream AUG codon, in part due to the short intercistronic spacing. A minority of ribosomes gain access to the HER-2 initiation codon either by leaky scanning past the upstream AUG codon or by reinitiating after having translated the uORF despite the short intercistronic region. These results suggest that the HER-2 uORF controls synthesis of this oncoprotein by limiting ribosomal access to downstream initiation sites. Overexpression of the HER-2 (neu, erb B-2) receptor results in cellular transformation and is associated with a variety of human cancers. Multiple mechanisms, including gene amplification and transcriptional, post-transcriptional, and translational controls contribute to the regulation of HER-2 expression. One of the components of these regulatory mechanisms is a short upstream open reading frame (uORF) in the HER-2 mRNA that represses downstream translation in a variety of cell types. Here we explore the mechanism by which this uORF exerts its inhibitory effect. As judged by comparisons of protein and mRNA abundance and by polysomal distribution analyses, the uORF represses translation of the HER-2 cistron or of a heterologous reporter gene. Despite its conservation among mammalian species, the peptide sequence of the uORF is not required for this inhibitory effect. Rather, the majority of ribosomes that load on the HER-2 mRNA most likely translate the uORF and are then unable to reinitiate at the downstream AUG codon, in part due to the short intercistronic spacing. A minority of ribosomes gain access to the HER-2 initiation codon either by leaky scanning past the upstream AUG codon or by reinitiating after having translated the uORF despite the short intercistronic region. These results suggest that the HER-2 uORF controls synthesis of this oncoprotein by limiting ribosomal access to downstream initiation sites. upstream open reading frame β-galactosidase nucleotide(s) polymerase chain reaction wild type 4-methylumbelliferyl β-d-galactoside The HER-2 (neu, erb B-2) oncogene encodes a 185-kDa transmembrane receptor tyrosine kinase (1Bargmann C.I. Hung M.C. Weinberg R.A. Nature. 1986; 319: 226-230Crossref PubMed Scopus (934) Google Scholar, 2Coussens L. Yang-Feng T.L. Liao Y.C. Chen E. Gray A. McGrath J. Seeburg P.H. Libermann T.A. Schlessinger J. Francke U. Levinson A. Ullrich A. Science. 1985; 230: 1132-1139Crossref PubMed Scopus (1573) Google Scholar, 3Yamamoto T. Ikawa S. Akiyama T. Semba K. Nomura N. Miyajima N. Saito T. Toyoshima K. Nature. 1986; 319: 230-234Crossref PubMed Scopus (1064) Google Scholar, 4Schechter A.L. Stern D.F. Vaidyanathan L. Decker S.J. Drebin J.A. Greene M.I. Weinberg R.A. Nature. 1984; 312: 513-516Crossref PubMed Scopus (941) Google Scholar). Although HER-2 is involved in normal development as evidenced by neural and myocardial defects in knock-out mice (5Lee K.F. Simon H. Chen H. Bates B. Hung M.C. Hauser C. Nature. 1995; 378: 394-398Crossref PubMed Scopus (1100) Google Scholar), most studies of HER-2 have focused on its role in cancer. Overexpression of HER2 occurs in numerous types of human cancers and has been linked to neoplastic transformation and aggressive tumor growth (6Di Fiore P.P. Pierce J.H. Kraus M.H. Segatto O. King C.R. Aaronson S.A. Science. 1987; 237: 178-182Crossref PubMed Scopus (875) Google Scholar, 7Di Marco E. Pierce J.H. Knicley C.L. Di Fiore P.P. Mol. Cell. Biol. 1990; 10: 3247-3252Crossref PubMed Scopus (72) Google Scholar, 8Hudziak R.M. Schlessinger J. Ullrich A. Proc. Natl. Acad. Sci. U. S. A. 1987; 84: 7159-7163Crossref PubMed Scopus (552) Google Scholar, 9Suda Y. Aizawa S. Furuta Y. Yagi T. Ikawa Y. Saitoh K. Yamada Y. Toyoshima K. Yamamoto T. EMBO J. 1990; 9: 181-190Crossref PubMed Scopus (74) Google Scholar, 10Liu E. Thor A. He M. Barcos M. Ljung B.M. Benz C. Oncogene. 1992; 7: 1027-1032PubMed Google Scholar, 11Slamon D.J. Clark G.M. Wong S.G. Levin W.J. Ullrich A. McGuire W.L. Science. 1987; 235: 177-182Crossref PubMed Scopus (10014) Google Scholar, 12Slamon D.J. Godolphin W. Jones L.A. Holt J.A. Wong S.G. Keith D.E. Levin W.J. Stuart S.G. Udove J. Ullrich A. Press M.F. Science. 1989; 244: 707-712Crossref PubMed Scopus (6289) Google Scholar). Cells from tumors in which HER-2 is overexpressed often contain amplified copies of the HER-2 gene. However, in some cases HER-2 overexpression is due to transcriptional and post-transcriptional mechanisms in the absence of gene amplification (12Slamon D.J. Godolphin W. Jones L.A. Holt J.A. Wong S.G. Keith D.E. Levin W.J. Stuart S.G. Udove J. Ullrich A. Press M.F. Science. 1989; 244: 707-712Crossref PubMed Scopus (6289) Google Scholar, 13Guerin M. Barrois M. Terrier M.J. Spielmann M. Riou G. Oncogene Res. 1988; 3: 21-31PubMed Google Scholar, 14Berger M.S. Locher G.W. Saurer S. Gullick W.J. Waterfield M.D. Groner B. Hynes N.E. Cancer Res. 1988; 48: 1238-1243PubMed Google Scholar, 15Kraus M.H. Popescu N.C. Amsbaugh S.C. King C.R. EMBO J. 1987; 6: 605-610Crossref PubMed Scopus (545) Google Scholar). Moreover, under certain conditions, HER-2 receptor levels vary without changes in mRNA levels, suggesting that translational controls also participate in the control of HER-2 protein synthesis (16Buhring H.J. Sures I. Jallal B. Weiss F.U. Busch F.W. Ludwig W.D. Handgretinger R. Waller H.D. Ullrich A. Blood. 1995; 86: 1916-1923Crossref PubMed Google Scholar, 17Oshima M. Weiss L. Dougall W.C. Greene M.I. Guroff G. J. Neurochem. 1995; 65: 427-433Crossref PubMed Scopus (11) Google Scholar). In eukaryotes, translational regulation of specific genes typically occurs at translational initiation and is mediated by cis-acting sequences present in the 5′ transcript leader, such as upstream AUG codons and associated upstream open reading frames (uORFs1 (18Matthews M.B. Sonenberg N. Hershey J.W.B. Hershey J.W.B. Matthews M.B. Sonenberg N. Translational Control. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1996: 1-29Google Scholar, 19Geballe A.P. Hershey J.W.B. Matthews M.B. Sonenberg N. Translational Control. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1996: 173-197Google Scholar)). Although uORFs are found in only 5 to 10 percent of eukaryotic mRNAs overall, approximately two-thirds of oncogenes including HER-2 and many genes involved in cellular growth and differentiation contain uORFs (20Kozak M. J. Cell Biol. 1991; 115: 887-903Crossref PubMed Scopus (1451) Google Scholar). In the well studied case of the Saccharomyces cerevisiae GCN4 gene, uORFs regulate protein synthesis by affecting which downstream AUG codons are utilized by reinitiating ribosomes (21Hinnebusch A.G. Hershey J.W.B. Matthews M.B. Sonenberg N. Translational Control. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1996: 199-244Google Scholar). Ribosomes translate the first uORF in the GCN4 mRNA under all conditions. They then reinitiate at another uORF when amino acids are plentiful or, under starvation conditions, they bypass the other uORFs and reinitiate at the GCN4 start codon. Several other uORFs have been shown to act by a mechanism that depends on the uORF-encoded peptide sequence and, in some cases, involves ribosomal stalling on the mRNA (19Geballe A.P. Hershey J.W.B. Matthews M.B. Sonenberg N. Translational Control. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1996: 173-197Google Scholar, 22Cao J. Geballe A.P. Mol. Cell. Biol. 1996; 16: 603-608Crossref PubMed Scopus (82) Google Scholar, 23Degnin C.R. Schleiss M.R. Cao J. Geballe A.P. J. Virol. 1993; 67: 5514-5521Crossref PubMed Google Scholar, 24Hill J.R. Morris D.R. J. Biol. Chem. 1993; 268: 726-731Abstract Full Text PDF PubMed Google Scholar, 25Parola A.L. Kobilka B.K. J. Biol. Chem. 1994; 269: 4497-4505Abstract Full Text PDF PubMed Google Scholar, 26Reynolds K. Zimmer A.M. Zimmer A. J. Cell Biol. 1996; 134: 827-835Crossref PubMed Scopus (65) Google Scholar, 27Werner M. Feller A. Messenguy F. Pierard A. Cell. 1987; 49: 805-813Abstract Full Text PDF PubMed Scopus (170) Google Scholar, 28Wang Z. Sachs M.S. J. Biol. Chem. 1997; 272: 255-261Abstract Full Text Full Text PDF PubMed Scopus (58) Google Scholar). For the vast majority of uORFs, insufficient data are available to enable predictions about whether they affect downstream translation and, if so, about the mechanism involved. Previously, we demonstrated that two distinct translational mechanisms control HER-2 protein expression (29Child S.J. Miller M.K. Geballe A.P. Int. J. Biochem. Cell Biol. 1999; 31: 201-213Crossref PubMed Scopus (19) Google Scholar). One is a cell type-dependent mechanism that causes increased HER-2 translation in transformed cells compared with primary cells. The other is a cell type-independent repression of downstream translation mediated by an upstream AUG codon. The upstream AUG codon is in an optimal Kozak context (30Kozak M. Cell. 1986; 44: 283-292Abstract Full Text PDF PubMed Scopus (3598) Google Scholar) and initiates a six-codon uORF that terminates five nt from the HER-2 start codon (see Fig. 1 A). Mutation of the upstream AUG codon eliminates the uORF and results in an approximately 5-fold increase in downstream translation in each of five cell types examined (29Child S.J. Miller M.K. Geballe A.P. Int. J. Biochem. Cell Biol. 1999; 31: 201-213Crossref PubMed Scopus (19) Google Scholar). The position and coding content of the uORF are highly conserved among mammalian species (29Child S.J. Miller M.K. Geballe A.P. Int. J. Biochem. Cell Biol. 1999; 31: 201-213Crossref PubMed Scopus (19) Google Scholar, 31Ishii S. Imamoto F. Yamanashi Y. Toyoshima K. Yamamoto T. Proc. Natl. Acad.Sci. U. S. A. 1987; 84: 4374-4378Crossref PubMed Scopus (66) Google Scholar, 32Tal M. King C.R. Kraus M.H. Ullrich A. Schlessinger J. Givol D. Mol. Cell. Biol. 1987; 7: 2597-2601Crossref PubMed Scopus (60) Google Scholar, 33Suen T.C. Hung M.C. Mol. Cell. Biol. 1990; 10: 6306-6315Crossref PubMed Scopus (41) Google Scholar, 34Nakamura T. Ushijima T. Ishizaka Y. Nagao M. Arai M. Yamazaki Y. Ishikawa T. Gene. 1994; 140: 251-255Crossref PubMed Scopus (7) Google Scholar, 35White M.R. Hung M.C. Oncogene. 1992; 7: 677-683PubMed Google Scholar), suggesting that these features may be important for the regulatory effects of the uORF. In the current report, we present an analysis of the translational mechanism by which the HER-2 uORF affects downstream translation. Our results demonstrate that the HER-2 uORF inhibitory function does not depend on the peptide sequence of the uORF, the identity of the downstream cistron, or the precise 5′ end of the mRNA. Instead, the very short intercistronic spacing between the uORF and the downstream cistron appears to be required for its inhibitory effect. Despite the optimal context of the upstream AUG codon and the short intercistronic spacing, both leaky scanning and ribosomal reinitiation after translation of the uORF contribute to HER-2 protein synthesis. These observations suggest that mammalian uORFs, like those in yeast, may control access of ribosomes to alternative downstream initiation sites. Control plasmids pEQ176 (36Schleiss M.R. Degnin C.R. Geballe A.P. J. Virol. 1991; 65: 6782-6789Crossref PubMed Google Scholar), expressing full-length β-galactosidase (β-gal), and pEQ430 (23Degnin C.R. Schleiss M.R. Cao J. Geballe A.P. J. Virol. 1993; 67: 5514-5521Crossref PubMed Google Scholar), expressing a truncated, inactive β-gal, have been described previously. The highly conserved 93 nt from the 3′ end of the HER-2 mRNA were PCR-amplified from human fibroblast DNA using primers #48 (CAAGAAGCTTGCGCCCGGCCCCCACC) and #49 (GGAAGGTACCATGGTGCTCACTGCGGC), digested with Hin dIII and Asp 718, and inserted into the Hin dIII/Asp 718 sites of pEQ176 to generate pEQ516. pEQ471 is identical to pEQ516, except that the HER-2 uORF AUG codon was mutated to AAG. To construct the HER-2 expression plasmids, the HER-2 ORF was isolated from SV40/erb B2 (6Di Fiore P.P. Pierce J.H. Kraus M.H. Segatto O. King C.R. Aaronson S.A. Science. 1987; 237: 178-182Crossref PubMed Scopus (875) Google Scholar) (provided by S. Aaronson, National Institutes of Health) by digesting with Bsu 36I, blunting with DNA polymerase (Klenow), then digesting with Hin dIII and inserting the HER-2-coding region into the Hin dIII/Hin dII sites of pBS+ (Stratagene). The HER-2 ORF, isolated from this plasmid by digestion with Xba I, blunting with DNA polymerase (Klenow), and cutting with Hin dIII, was ligated into the Hin dIII/Pvu II sites of pEQ176. The resulting plasmid, pEQ580, contains 22 nt of the HER-2 leader immediately upstream from the HER-2 AUG codon but does not contain the upstream AUG codon. The HER-2 transcript leader from pEQ516, isolated by Hin dIII/partial Nco I digestion, was inserted into the Hin dIII/Nco I sites of pEQ580 to generate pEQ582. Plasmid pEQ581 is identical to pEQ582 except that the uORF AUG codon has been mutated to AAG. Plasmid pEQ591, a frameshift mutant of the HER-2 uORF, was constructed by PCR-amplifying the HER-2 transcript leader from pEQ516 using oligos #48 (see above) and #102 (GGAAGGTACCATGGTGCTCACTCGGCTCCGGCCACCATGG). The resulting fragment was digested with Hin dIII and Asp 718 and ligated into the Hin dIII/Asp 718 sites of pEQ176. To create uORF missense mutants pEQ721, pEQ722, and pEQ723, the products of PCR amplification of pEQ516 with oligos #48 and #150 (GGAAGGTACCATGGTGCTCANNNNNNNNNNNNNNCCATGGCT) were cloned into pEQ176 as Hin dIII/Asp 718 fragments. The transcript leaders from pEQ516 and pEQ471 were PCR-amplified with oligos #48 and #61 (GGAAGGTACCATGGTCTTAAGCTCACTGCGG) to introduce an Afl II site just downstream from the uORF. The resulting fragments were cloned as Hin dIII/Asp 718 fragments into pEQ176, yielding pEQ526, the wt construct, and pEQ485, the corresponding AAG mutant. A 50-nt intercistronic spacer consisting of cytomegalovirus UL4 transcript leader sequences, derived by cutting pEQ239 (36Schleiss M.R. Degnin C.R. Geballe A.P. J. Virol. 1991; 65: 6782-6789Crossref PubMed Google Scholar) with Spe I, blunting with DNA polymerase (Klenow), and digesting with Asp 718, was inserted into pEQ526 and pEQ485 that had been digested with Afl II, blunted with DNA polymerase (Klenow), and cut with Asp 718, yielding pEQ717 and pEQ718, respectively. pEQ719 and pEQ720 were generated by inserting a UL4 Rsa I-Asp 718 fragment from pEQ239 into pEQ526 and pEQ485 that had been digested with Spe I, blunted, and digested with Asp 718. A fragment generated by PCR amplification of the UL4 transcript leader with primers gp48.3 (36Schleiss M.R. Degnin C.R. Geballe A.P. J. Virol. 1991; 65: 6782-6789Crossref PubMed Google Scholar) and #105 (CGGCCTTAAGTGAAGAGTCTATAAAG) and digestion with Afl 2/Asp 718 was inserted into pEQ526 and pEQ485 to generate pEQ608 and pEQ607, respectively. A blunted Bgl II/Sal I fragment derived from pM128 (provided by A. Hinnebusch, National Institutes of Health) containing the 3′-most 152 nt of the S. cerevisiae GCN4 transcript leader (37Hinnebusch A.G. Proc. Natl. Acad. Sci. U. S. A. 1984; 81: 6442-6446Crossref PubMed Scopus (280) Google Scholar) was cloned into pEQ526 that had been cut with Afl II and blunted. Plasmid pEQ741 contains this sequence in the same orientation as found in the GCN4 mRNA. The same fragment was cloned into pEQ485 to yield the corresponding AAG mutant pEQ743. The transcript leader and the 5′ end of the HER-2 coding region isolated as Hin dIII, blunted-Apa LI fragments from pEQ578 and pEQ577 were inserted into pEQ176 that had been digested with Xho I, blunted, then digested with Hin dIII to generate pEQ673 containing the wt HER-2 leader and the corresponding AAG mutant pEQ674. pEQ573 was constructed by PCR amplification of pEQ516 with oligos #48 (see above) and #83 (GGAAGGTACCATGGTGCTCCCTGCGGC) to eliminate the uORF stop codon. The resulting fragment was digested with Hin dIII and Asp 718 and cloned into the corresponding sites in pEQ176. The product of PCR amplification with oligos #48 and #99 (GGAAGGTACCATGGTGCTCACTGCGGCTCCGGCCCCATGGTGGCGGCTGGACCC), having a super optimal upstream AUG codon, was cloned into pEQ176 as a Hin dIII/Asp 718 fragment to produce pEQ559. Plasmid pEQ592, the corresponding AAG construct, was produced in the same manner using oligos #48 and #103 (GGAAGGTACCATGGTGCTCACTGCGGCTCCGGCCCCTTGGTGGCGGCTGGACCC). pEQ739, in which the uORF contains a super optimal AUG codon and a mutated stop codon, was produced in the same way by PCR amplification with oligos #48 and #83 using pEQ559 as a template. pEQ751, containing the full-length transcript leader with the HER-2 uORF fused to lacZ, was constructed by PCR amplification with oligos #106 (GGCCAAGCTTATTCCCCTCCATT GGGACCGGAG) and #163 (GGAAGGTACCAAGGATGCTCCCTGCGGC) using pEQ637 as a template. The insert was digested with Hin dIII and Asp 718 and cloned into the same sites in pEQ176. pEQ752, the corresponding uORF AAG mutant was made by the same strategy using pEQ655 as the template. COS-7 cells were maintained in Dulbecco's modified Eagle's medium supplemented with 10% NuSerum (Collaborative Biomedical). 2 μg each of a test β-gal expression plasmid and the pEQ430 control were transfected into COS-7 cells in triplicate 60-mm dishes using calcium phosphate (29Child S.J. Miller M.K. Geballe A.P. Int. J. Biochem. Cell Biol. 1999; 31: 201-213Crossref PubMed Scopus (19) Google Scholar). 48 h post-transfection β-gal activity was measured by a fluorimetric substrate cleavage assay (38Biegalke B.J. Geballe A.P. Virology. 1990; 177: 657-667Crossref PubMed Scopus (20) Google Scholar), then whole cell RNA was harvested by the acid guanidinium isothiocyanate method (39Siebert P.D. Chenchik A. Nucleic Acids Res. 1993; 21: 2019-2020Crossref PubMed Scopus (66) Google Scholar) and analyzed by Northern blot hybridization with a β-gal probe. Polysomes from COS-7 cells transfected with HER-2 expression plasmids were separated on 15–50% sucrose gradients, and the RNA content of each fraction was analyzed by Northern hybridization as described (36Schleiss M.R. Degnin C.R. Geballe A.P. J. Virol. 1991; 65: 6782-6789Crossref PubMed Google Scholar) At 48 h post-transfection, cells were washed with phosphate-buffered saline then lysed with 2% SDS at 65 °C. The resulting cell lysates were denatured at 95–100 °C for 5 min and then electrophoresed through 7.5% SDS-polyacrylamide gels, and the proteins were transferred to polyvinylidene difluoride transfer membrane (TROPIX, Inc.) by electroblotting. Immunoblot analysis was carried out according to the manufacturer's recommendations using the Western-Light Plus chemiluminescent detection system (TROPIX, Inc.) with rabbit polyclonal serum directed against the 14 carboxyl-terminal amino acids of HER-2. Whole cell RNA was harvested from parallel dishes as described above and analyzed by Northern blot analyses using a HER-2 extracellular domain fragment probe (29Child S.J. Miller M.K. Geballe A.P. Int. J. Biochem. Cell Biol. 1999; 31: 201-213Crossref PubMed Scopus (19) Google Scholar). Previous studies revealed that the HER-2 uORF inhibits translation of a downstream reporter gene (29Child S.J. Miller M.K. Geballe A.P. Int. J. Biochem. Cell Biol. 1999; 31: 201-213Crossref PubMed Scopus (19) Google Scholar). To determine whether it also inhibits expression of the authentic HER-2 protein, we constructed plasmids having the HER-2 ORF downstream from transcript leader sequences having or lacking the uORF (Fig. 1 A). After transfection of these plasmids into COS-7 cells, HER-2 protein levels and mRNA accumulation were measured by immunoblot and Northern blot analyses as described under “Experimental Procedures.” The wild-type transcript leader containing the uORF repressed HER-2 protein expression compared with the leader containing a mutation in the upstream AUG codon or to the control containing only a very short leader (Fig. 1 B, compare WT with AAG and SL lanes). mRNA levels were similar among all constructs, indicating that differences in protein expression did not result from variation in transcript accumulation. The low level of expression of HER-2 protein and RNA in mock-transfected cells suggested that most of the protein and RNA detected in the other samples represented products of the transgenes rather than the endogenous gene. Nonetheless, we confirmed these results using FLAG-tagged HER-2 expression plasmids with which we could unambiguously detect transgene expression (data not shown). The transcript leader sequences in pEQ582 contained 93 nt, including the uORF, from the 3′ end of natural HER-2 transcript leader. Although all reported HER-2 sequences share an identical 96 nt at the 3′ end of the transcript leader, some reports have suggested that the 5′ end of the leader may contain alternative sequences (2Coussens L. Yang-Feng T.L. Liao Y.C. Chen E. Gray A. McGrath J. Seeburg P.H. Libermann T.A. Schlessinger J. Francke U. Levinson A. Ullrich A. Science. 1985; 230: 1132-1139Crossref PubMed Scopus (1573) Google Scholar, 3Yamamoto T. Ikawa S. Akiyama T. Semba K. Nomura N. Miyajima N. Saito T. Toyoshima K. Nature. 1986; 319: 230-234Crossref PubMed Scopus (1064) Google Scholar, 31Ishii S. Imamoto F. Yamanashi Y. Toyoshima K. Yamamoto T. Proc. Natl. Acad.Sci. U. S. A. 1987; 84: 4374-4378Crossref PubMed Scopus (66) Google Scholar, 32Tal M. King C.R. Kraus M.H. Ullrich A. Schlessinger J. Givol D. Mol. Cell. Biol. 1987; 7: 2597-2601Crossref PubMed Scopus (60) Google Scholar). In experiments using either β-gal or HER-2 expression plasmids, we found that the uORF had quantitatively similar effects on downstream translation whether it was contained in the full-length 178-nt leader (29Child S.J. Miller M.K. Geballe A.P. Int. J. Biochem. Cell Biol. 1999; 31: 201-213Crossref PubMed Scopus (19) Google Scholar) or only within the conserved 93-nt 3′ region (data not shown). We also analyzed the effects of the uORF on HER-2 translation by examining the polysomal association of mRNAs having and lacking the uORF (Fig. 2). Polysomes in cells transfected with pEQ582 (AUG) and pEQ581 (AAG) were fractionated on sucrose gradients, and transgene mRNAs in each fraction were detected by Northern blot hybridization using a probe specific for the transgene 3′-untranslated region that is not contained in endogenous HER-2 transcripts. Elimination of the uORF resulted in a shift of the HER2 mRNA to larger polysomes, corresponding to more efficient translation. The mean position of wild-type mRNAs was fraction 3, corresponding to disomes, whereas that for the AAG construct was fraction 5, corresponding to approximately 6- and 7-mers. Similarities of the UV absorption profiles (not shown) and of the distribution of actin mRNA (Fig. 2) between the two samples indicated that the shift to larger polysomes, resulting from elimination of the HER-2 uORF, was not an artifact of variation between the two gradients. These results demonstrate that uORF represses HER-2 expression by reducing the ribosomal loading on the mRNA and thus verify that the uORF inhibits HER-2 expression at the translational level. We next investigated the mechanism by which the HER-2 uORF exerts its repressive effect. Inhibition by uORFs in several other eukaryotic genes is dependent upon the peptide-coding sequence of the uORF (19Geballe A.P. Hershey J.W.B. Matthews M.B. Sonenberg N. Translational Control. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1996: 173-197Google Scholar, 26Reynolds K. Zimmer A.M. Zimmer A. J. Cell Biol. 1996; 134: 827-835Crossref PubMed Scopus (65) Google Scholar, 40Luo Z. Sachs M.S. J. Bacteriol. 1996; 178: 2172-2177Crossref PubMed Google Scholar). Because the HER-2 uORF sequence is conserved among mammalian species (29Child S.J. Miller M.K. Geballe A.P. Int. J. Biochem. Cell Biol. 1999; 31: 201-213Crossref PubMed Scopus (19) Google Scholar, 31Ishii S. Imamoto F. Yamanashi Y. Toyoshima K. Yamamoto T. Proc. Natl. Acad.Sci. U. S. A. 1987; 84: 4374-4378Crossref PubMed Scopus (66) Google Scholar, 32Tal M. King C.R. Kraus M.H. Ullrich A. Schlessinger J. Givol D. Mol. Cell. Biol. 1987; 7: 2597-2601Crossref PubMed Scopus (60) Google Scholar, 33Suen T.C. Hung M.C. Mol. Cell. Biol. 1990; 10: 6306-6315Crossref PubMed Scopus (41) Google Scholar, 34Nakamura T. Ushijima T. Ishizaka Y. Nagao M. Arai M. Yamazaki Y. Ishikawa T. Gene. 1994; 140: 251-255Crossref PubMed Scopus (7) Google Scholar, 35White M.R. Hung M.C. Oncogene. 1992; 7: 677-683PubMed Google Scholar), we tested whether it is required for inhibition of downstream translation. β-Gal expression constructs in which the uORF was modified by shifting the reading frame to generate a different amino acid sequence while preserving most of the nucleotide sequence (pEQ591) or by random mutagenesis with a degenerate oligonucleotide (pEQ721, -722, -723) were transfected into COS-7 cells (Fig. 3). β-Gal activity and mRNA accumulation were analyzed as described under “Experimental Procedures.” Like the wt uORF, each of these mutant uORFs inhibited translation of the downstream β-gal gene, demonstrating that the HER-2 uORF functions in a peptide sequence-independent manner. Another feature of the HER-2 uORF that might account for its inhibitory effect is the proximity of its termination codon to the initiation codon of the downstream cistron. In all mammalian species in which the sequence has been reported, this intercistronic spacing is only five nt. To test the role of this spacing on the inhibitory activity of the HER-2 uORF, we lengthened the intercistronic distance in our β-gal reporter construct by inserting various fragments derived from the cytomegalovirus UL4 transcript leader. The fragments used to construct these plasmids contain two adjacent AUG codons, either of which can serve as initiation sites for β-gal synthesis. The size of the intercistronic spacer shown in Fig.4 for pEQ717, pEQ719, and pEQ608 is based on the assumption that initiation occurs at the second of these two AUG codons. If the first one is used, then the actual intercistronic spacing would be three nt shorter. These spacers do not contain other AUG codons and, in other experiments, did not affect downstream reporter gene translation (36Schleiss M.R. Degnin C.R. Geballe A.P. J. Virol. 1991; 65: 6782-6789Crossref PubMed Google Scholar). Nonetheless, we constructed control plasmids containing the same spacer sequences but having a mutation of the AUG codon of the uORF to detect unexpected uORF-independent effects of the spacer sequences. These plasmids were transfected into COS-7 cells and analyzed as described under “Experimental Procedures” (Fig. 4). Expansion of the intercistronic spacing to 10 nt (pEQ526) had little effect on downstream translation compared with the wt spacing. However, expansion to 50, 116, or 148 nt increased β-gal expression approximately 2-fold. The sequences used to expand the intercistronic spacing also inhibited expression from the controls lacking the uORF. This reduction may be due to the modest reduction in β-gal RNA accumulation after transfection of constructs having the longer insertions (Fig. 4, right panel). The inhibitory effect of the uORF, when measured as the ratio of expression from the AUG– to the corresponding AUG+ plasmid, decreased from 7-fold with the wt spacing to 1.4-fold when the spacing was 148 nt. These results suggest that repression by the HER-2 uORF is alleviated, at least in part, by increasing the intercistronic spacing. In addition to effects due to intercistronic length, the sequence of the intercistronic region may affect reinitiation frequency (41Lincoln A.J. Monczak Y. Williams S.C. Johnson P.F. J. Biol. Chem. 1998; 273: 9552-9560Abstract Full Text Full Text PDF PubMed Scopus (73) Google Scholar,42Grant C.M. Hinnebusch A.G. Mol. Cell. Biol. 1994; 14: 606-618Crossref PubMed Scopus (84) Google Scholar). To further examine the role of intercistronic sequence on translational inhibition, we tested the effects of a second spacer sequence derived from a portion of the S. cerevisiae GCN4 transcript leader that has no upstream AUG codons or other known translational regulatory elements. Constructs containing the uORF or the upstream AUG– mutation with an intercistronic spacing of 171 nt were transfected into COS-7 cells, and β-gal expression was analyzed (Fig. 5). For unknown reasons, the GCN4 spacer greatly reduced the abundance of reporter gene transcript accumulation from pEQ741 and pEQ743 compared with plasmids lacking the GCN4 sequences. Nonetheless, this intercistronic spacer also reduced the inhibitory effect of the uORF to 1.6-fold, similar to the results using the CMV UL4 spacer sequences (Fig. 4). To evaluate the reinitiation potential of ribosomes that have translated the authentic uORF, we constructed plasmids more closely resembling the structure of the natural HER-2 mRNA. In pEQ673, the β-gal ORF initiates 92 nt downstream from the uORF termination codon. The “intercistronic” spacer" @default.
• W2084489095 created "2016-06-24" @default.
• W2084489095 creator A5077485949 @default.
• W2084489095 creator A5081607195 @default.
• W2084489095 creator A5063097195 @default.
• W2084489095 date "1999-08-01" @default.
• W2084489095 modified "2023-09-30" @default.
• W2084489095 title "Translational Control by an Upstream Open Reading Frame in the HER-2/neu Transcript" @default.
• W2084489095 cites W1491077584 @default.
• W2084489095 cites W1506019467 @default.
• W2084489095 cites W1551420438 @default.
• W2084489095 cites W1560771952 @default.
• W2084489095 cites W1849730822 @default.
• W2084489095 cites W187705992 @default.
• W2084489095 cites W1964606534 @default.
• W2084489095 cites W1966823692 @default.
• W2084489095 cites W1973033337 @default.
• W2084489095 cites W1977876483 @default.
• W2084489095 cites W1982210988 @default.
• W2084489095 cites W1987339939 @default.
• W2084489095 cites W2001627828 @default.
• W2084489095 cites W2017213758 @default.
• W2084489095 cites W2028387622 @default.
• W2084489095 cites W2034914156 @default.
• W2084489095 cites W2047457165 @default.
• W2084489095 cites W2049661143 @default.
• W2084489095 cites W2076943860 @default.
• W2084489095 cites W2084136761 @default.
• W2084489095 cites W2092229345 @default.
• W2084489095 cites W2095156669 @default.
• W2084489095 cites W2110374270 @default.
• W2084489095 cites W2121497509 @default.
• W2084489095 cites W2126505147 @default.
• W2084489095 cites W2127667224 @default.
• W2084489095 cites W2127994165 @default.
• W2084489095 cites W2131814529 @default.
• W2084489095 cites W2139995230 @default.
• W2084489095 cites W2140913315 @default.
• W2084489095 cites W2141393790 @default.
• W2084489095 cites W2147402219 @default.
• W2084489095 cites W2149918090 @default.
• W2084489095 cites W2154128645 @default.
• W2084489095 cites W2159363679 @default.
• W2084489095 cites W2168847939 @default.
• W2084489095 cites W308778881 @default.
• W2084489095 doi "https://doi.org/10.1074/jbc.274.34.24335" @default.
• W2084489095 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/10446211" @default.
• W2084489095 hasPublicationYear "1999" @default.
• W2084489095 type Work @default.
• W2084489095 sameAs 2084489095 @default.
• W2084489095 citedByCount "103" @default.
• W2084489095 countsByYear W20844890952013 @default.
• W2084489095 countsByYear W20844890952014 @default.
• W2084489095 countsByYear W20844890952015 @default.
• W2084489095 countsByYear W20844890952016 @default.
• W2084489095 countsByYear W20844890952017 @default.
• W2084489095 countsByYear W20844890952019 @default.
• W2084489095 countsByYear W20844890952020 @default.
• W2084489095 countsByYear W20844890952021 @default.
• W2084489095 countsByYear W20844890952022 @default.
• W2084489095 countsByYear W20844890952023 @default.
• W2084489095 crossrefType "journal-article" @default.
• W2084489095 hasAuthorship W2084489095A5063097195 @default.
• W2084489095 hasAuthorship W2084489095A5077485949 @default.
• W2084489095 hasAuthorship W2084489095A5081607195 @default.
• W2084489095 hasBestOaLocation W20844890951 @default.
• W2084489095 hasConcept C104317684 @default.
• W2084489095 hasConcept C126042441 @default.
• W2084489095 hasConcept C138885662 @default.
• W2084489095 hasConcept C153911025 @default.
• W2084489095 hasConcept C166258313 @default.
• W2084489095 hasConcept C167625842 @default.
• W2084489095 hasConcept C191172861 @default.
• W2084489095 hasConcept C31258907 @default.
• W2084489095 hasConcept C41008148 @default.
• W2084489095 hasConcept C41895202 @default.
• W2084489095 hasConcept C47289529 @default.
• W2084489095 hasConcept C54355233 @default.
• W2084489095 hasConcept C554936623 @default.
• W2084489095 hasConcept C86803240 @default.
• W2084489095 hasConceptScore W2084489095C104317684 @default.
• W2084489095 hasConceptScore W2084489095C126042441 @default.
• W2084489095 hasConceptScore W2084489095C138885662 @default.
• W2084489095 hasConceptScore W2084489095C153911025 @default.
• W2084489095 hasConceptScore W2084489095C166258313 @default.
• W2084489095 hasConceptScore W2084489095C167625842 @default.
• W2084489095 hasConceptScore W2084489095C191172861 @default.
• W2084489095 hasConceptScore W2084489095C31258907 @default.
• W2084489095 hasConceptScore W2084489095C41008148 @default.
• W2084489095 hasConceptScore W2084489095C41895202 @default.
• W2084489095 hasConceptScore W2084489095C47289529 @default.
• W2084489095 hasConceptScore W2084489095C54355233 @default.
• W2084489095 hasConceptScore W2084489095C554936623 @default.
• W2084489095 hasConceptScore W2084489095C86803240 @default.
• W2084489095 hasIssue "34" @default.
• W2084489095 hasLocation W20844890951 @default.
• W2084489095 hasOpenAccess W2084489095 @default.
• W2084489095 hasPrimaryLocation W20844890951 @default.

• next