FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2085328698> ?p ?o ?g. }

• W2085328698 endingPage "30010" @default.
• W2085328698 startingPage "30002" @default.
• W2085328698 abstract "In eukaryotes cell division is accompanied by phosphorylation of histone H3 at serine 10. In this work we have studied the kinase activity responsible for this histone H3 modification by using cell-free extracts prepared fromXenopus eggs. We have found that the Xenopusaurora-A kinase pEg2, immunoprecipitated from the extract, is able to phosphorylate specifically histone H3 at serine 10. The enzyme is incorporated into chromatin during in vitro chromosome assembly, and the kinetics of this incorporation parallels that of histone H3 phosphorylation. Recombinant pEg2 phosphorylates efficiently histone H3 at serine 10 in reconstituted nucleosomes and in sperm nuclei decondensed in heated extracts. These data identify pEg2 as a good candidate for mitotic histone H3 kinase. However, immunodepletion of pEg2 does not interfere with the chromosome assembly properties of the extract nor with the pattern of H3 phosphorylation, suggesting the existence of multiple kinases involved in this H3 modification inXenopus eggs. This hypothesis is supported by in gel activity assay experiments using extracts from Saccharomyces cerevisiae. In eukaryotes cell division is accompanied by phosphorylation of histone H3 at serine 10. In this work we have studied the kinase activity responsible for this histone H3 modification by using cell-free extracts prepared fromXenopus eggs. We have found that the Xenopusaurora-A kinase pEg2, immunoprecipitated from the extract, is able to phosphorylate specifically histone H3 at serine 10. The enzyme is incorporated into chromatin during in vitro chromosome assembly, and the kinetics of this incorporation parallels that of histone H3 phosphorylation. Recombinant pEg2 phosphorylates efficiently histone H3 at serine 10 in reconstituted nucleosomes and in sperm nuclei decondensed in heated extracts. These data identify pEg2 as a good candidate for mitotic histone H3 kinase. However, immunodepletion of pEg2 does not interfere with the chromosome assembly properties of the extract nor with the pattern of H3 phosphorylation, suggesting the existence of multiple kinases involved in this H3 modification inXenopus eggs. This hypothesis is supported by in gel activity assay experiments using extracts from Saccharomyces cerevisiae. Never in Mitosis A glutathione S-transferase electrophoretic mobility shift analysis base pair Cell division requires accurate condensation and faithful segregation of chromosomes. Despite the great efforts invested, the mechanisms of these two processes still remain unclear. However, during the last few years an impressive progress has been made in their understanding by using two complementary approaches as follows: genetics in yeast and experiments in extracts prepared fromXenopus eggs (reviewed in Ref. 1Hirano T. Annu. Rev. Biochem. 2000; 69: 115-144Crossref PubMed Scopus (225) Google Scholar). The biochemical manipulations of the Xenopus egg extract were extremely useful since they have led to the identification of multiprotein complexes, termed condensins, required for chromosome condensation (2Hirano T. Kobayashi R. Hirano M. Cell. 1997; 89: 511-521Abstract Full Text Full Text PDF PubMed Scopus (452) Google Scholar). Targeting of condensins is mitotic-specific, and their phosphorylation may trigger chromosome condensation (3Kimura K. Hirano M. Kobayashi R. Hirano T. Science. 1998; 282: 487-490Crossref PubMed Scopus (247) Google Scholar). Several lines of evidence indicate that the master kinase Cdc-2 might be involved in the phosphorylation and activation of condensins (3Kimura K. Hirano M. Kobayashi R. Hirano T. Science. 1998; 282: 487-490Crossref PubMed Scopus (247) Google Scholar). Chromosome assembly is also accompanied by phosphorylation of linker histone H1 (4Bradbury E.M. Inglis R.J. Matthews H.R. Sarner N. Eur. J. Biochem. 1973; 33: 131-139Crossref PubMed Scopus (163) Google Scholar, 5Bradbury E.M. BioEssays. 1992; 14: 9-16Crossref PubMed Scopus (346) Google Scholar) and core histone H3 (6Gurley L.R. D'Anna J.A. Barham S.S. Deaven L.L. Tobey R.A. Eur. J. Biochem. 1978; 84: 1-15Crossref PubMed Scopus (403) Google Scholar, 7Allis C.D. Gorovsky M.A. Biochemistry. 1981; 20: 3828-3833Crossref PubMed Scopus (65) Google Scholar, 8Guo X.W. Th'ng J.P. Swank R.A. Anderson H.J. Tudan C. Bradbury E.M. Roberge M. EMBO J. 1995; 14: 976-985Crossref PubMed Scopus (154) Google Scholar, 9Goto H. Tomono Y. Ajiro K. Kosako H. Fujita M. Sakurai M. Okawa K. Iwamatsu A. Okigaki T. Takahashi T. Inagaki M. J. Biol. Chem. 1999; 274: 25543-25549Abstract Full Text Full Text PDF PubMed Scopus (376) Google Scholar). However, the presence of linker histones is not necessary for chromosome and nucleus formation (10Ohsumi K. Katagiri C. Kishimoto T. Science. 1993; 262: 2033-2035Crossref PubMed Scopus (137) Google Scholar, 11Dasso M. Dimitrov S. Wolffe A.P. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 12477-12481Crossref PubMed Scopus (70) Google Scholar, 12Shen X., Yu, L. Weir J.W. Gorovsky M.A. Cell. 1995; 82: 47-56Abstract Full Text PDF PubMed Scopus (262) Google Scholar, 13Barra J.L. Rhounim L. Rossignol J.L. Faugeron G. Mol. Cell. Biol. 2000; 20: 61-69Crossref PubMed Scopus (80) Google Scholar, 14Ramon A. Muro-Pastor M.I. Scazzocchio C. Gonzalez R. Mol. Microbiol. 2000; 35: 223-233Crossref PubMed Scopus (65) Google Scholar), and consequently their phosphorylation should not be required for these processes. In contrast, the phosphorylation of serine 10 in the amino-terminal domain of histone H3 is essential for cell division. Phosphorylation of histone H3 has been observed and characterized in organisms as divergent as yeast (15Hsu J.Y. Sun Z.W. Li X. Reuben M. Tatchell K. Bishop D.K. Grushcow J.M. Brame C.J. Caldwell J.A. Hunt D.F. Lin R. Smith M.M. Allis C.D. Cell. 2000; 102: 279-291Abstract Full Text Full Text PDF PubMed Scopus (712) Google Scholar), Tetrahymena thermophila (16Wei Y., Yu, L. Bowen J. Gorovsky M.A. Allis C.D. Cell. 1999; 97: 99-109Abstract Full Text Full Text PDF PubMed Scopus (591) Google Scholar), Aspergillus nidulans (17De Souza C.P. Osmani A.H. Wu L.P. Spotts J.L. Osmani S.A. Cell. 2000; 102: 293-302Abstract Full Text Full Text PDF PubMed Scopus (133) Google Scholar),Caenorhabditis elegans (15Hsu J.Y. Sun Z.W. Li X. Reuben M. Tatchell K. Bishop D.K. Grushcow J.M. Brame C.J. Caldwell J.A. Hunt D.F. Lin R. Smith M.M. Allis C.D. Cell. 2000; 102: 279-291Abstract Full Text Full Text PDF PubMed Scopus (712) Google Scholar, 18Speliotes E.K. Uren A. Vaux D. Horvitz H.R. Mol. Cell. 2000; 6: 211-223Abstract Full Text Full Text PDF PubMed Scopus (222) Google Scholar), plants (19Kaszas E. Cande W.Z. J. Cell Sci. 2000; 113: 3217-3226Crossref PubMed Google Scholar), and vertebrates (20Hendzel M.J. Wei Y. Mancini M.A. Van Hooser A. Ranalli T. Brinkley B.R. Bazett-Jones D.P. Allis C.D. Chromosoma. 1997; 106: 348-360Crossref PubMed Scopus (1504) Google Scholar, 21Van Hooser A. Goodrich D.W. Allis C.D. Brinkley B.R. Mancini M.A. J. Cell Sci. 1998; 111: 3497-3506Crossref PubMed Google Scholar). It was also described during in vitrochromosome assembly in Xenopus egg extract (22de la Barre A.E. Gerson V. Gout S. Creaven M. Allis C.D. Dimitrov S. EMBO J. 2000; 19: 379-391Crossref PubMed Scopus (99) Google Scholar). A mutantT. thermophila strain, containing a non-phosphorylatable histone H3, exhibited perturbed chromosome condensation, abnormal segregation, and chromosome loss during mitosis and meiosis (16Wei Y., Yu, L. Bowen J. Gorovsky M.A. Allis C.D. Cell. 1999; 97: 99-109Abstract Full Text Full Text PDF PubMed Scopus (591) Google Scholar), demonstrating the primary significance of this histone H3 modification. This was further supported by experiments on blocking of the mitotic histone H3 kinase and, thus, histone H3 phosphorylation, which has resulted in inhibition of chromosome assembly in vitro (22de la Barre A.E. Gerson V. Gout S. Creaven M. Allis C.D. Dimitrov S. EMBO J. 2000; 19: 379-391Crossref PubMed Scopus (99) Google Scholar) and in cells in culture (21Van Hooser A. Goodrich D.W. Allis C.D. Brinkley B.R. Mancini M.A. J. Cell Sci. 1998; 111: 3497-3506Crossref PubMed Google Scholar). Nonetheless, the mechanism of action of histone H3 phosphorylation in cell division is still poorly understood. A real progress toward elucidation of this mechanism will be the identification of the enzymes involved in the regulation of mitotic H3 phosphorylation. Recently, reports from two different groups identified two distinct kinases Never in Mitosis A (NIMA)1 inA. nidulans (17De Souza C.P. Osmani A.H. Wu L.P. Spotts J.L. Osmani S.A. Cell. 2000; 102: 293-302Abstract Full Text Full Text PDF PubMed Scopus (133) Google Scholar) and an aurora kinase Ipl1 (Increase in Ploidy) in budding yeast S. cerevisiae and air2 (aurora Ipl1-related kinase 2) in the worm C. elegans (15Hsu J.Y. Sun Z.W. Li X. Reuben M. Tatchell K. Bishop D.K. Grushcow J.M. Brame C.J. Caldwell J.A. Hunt D.F. Lin R. Smith M.M. Allis C.D. Cell. 2000; 102: 279-291Abstract Full Text Full Text PDF PubMed Scopus (712) Google Scholar) as the mitotic histone H3 kinases. In vitro NIMA phosphorylated histone H3 at serine 10, and the in vivo phosphorylation of the histone is dependent on the presence of the kinase activity (17De Souza C.P. Osmani A.H. Wu L.P. Spotts J.L. Osmani S.A. Cell. 2000; 102: 293-302Abstract Full Text Full Text PDF PubMed Scopus (133) Google Scholar). At the onset of mitosis, NIMA is detected on chromatin and subsequently colocalized with spindle microtubules and spindle pole bodies. The chromatin localization of this enzyme is tightly correlated with histone H3 phosphorylation (17De Souza C.P. Osmani A.H. Wu L.P. Spotts J.L. Osmani S.A. Cell. 2000; 102: 293-302Abstract Full Text Full Text PDF PubMed Scopus (133) Google Scholar). The budding yeast genome encodes for a single aurora kinase Ipl1 that is required for cell cycle progression, and strains bearing genetics defects in this enzyme showed abnormal chromosome segregation and suffered severe nondysjunction (23Chan C.S. Botstein D. Genetics. 1993; 135: 677-691Crossref PubMed Google Scholar). The enzyme expression peaks at mitosis, and when a temperature-sensitive lethal Ipl1 strain was grown at permissive temperature, a markedly reduced H3 phosphorylation was detected (15Hsu J.Y. Sun Z.W. Li X. Reuben M. Tatchell K. Bishop D.K. Grushcow J.M. Brame C.J. Caldwell J.A. Hunt D.F. Lin R. Smith M.M. Allis C.D. Cell. 2000; 102: 279-291Abstract Full Text Full Text PDF PubMed Scopus (712) Google Scholar). In vitro, the kinase phosphorylated both H3 and H2B in a mixture of free histones and on nucleosomes. The C. elegans genome encodes for two aurora kinases, air1 and air2, and the last one was observed on chromosomes at mitosis and meiosis (15Hsu J.Y. Sun Z.W. Li X. Reuben M. Tatchell K. Bishop D.K. Grushcow J.M. Brame C.J. Caldwell J.A. Hunt D.F. Lin R. Smith M.M. Allis C.D. Cell. 2000; 102: 279-291Abstract Full Text Full Text PDF PubMed Scopus (712) Google Scholar,18Speliotes E.K. Uren A. Vaux D. Horvitz H.R. Mol. Cell. 2000; 6: 211-223Abstract Full Text Full Text PDF PubMed Scopus (222) Google Scholar). However, only the disruption by RNA interference of air2 expression in C. elegans embryos led to undetectable histone H3 phosphorylation (15Hsu J.Y. Sun Z.W. Li X. Reuben M. Tatchell K. Bishop D.K. Grushcow J.M. Brame C.J. Caldwell J.A. Hunt D.F. Lin R. Smith M.M. Allis C.D. Cell. 2000; 102: 279-291Abstract Full Text Full Text PDF PubMed Scopus (712) Google Scholar, 18Speliotes E.K. Uren A. Vaux D. Horvitz H.R. Mol. Cell. 2000; 6: 211-223Abstract Full Text Full Text PDF PubMed Scopus (222) Google Scholar). The situation is different in vertebrates where three aurora kinases, recently renamed as aurora-A, -B, and -C, have been described (reviewed in Refs. 24Giet R. Prigent C. J. Cell Sci. 1999; 112: 3591-3601Crossref PubMed Google Scholar, 25Nigg E.A. Nat. Rev. Mol. Cell. Biol. 2001; 2: 21-32Crossref PubMed Scopus (1244) Google Scholar, 26Adams R.R. Carmena M. Earnshaw W.C. Trends Cell Biol. 2001; 11: 49-54Abstract Full Text Full Text PDF PubMed Scopus (469) Google Scholar) The Xenopus laevis kinase pEg2 belongs to the aurora kinase protein family, and according to the new nomenclature is the Xenopus aurora-A kinase. pEg2 was found associated with centrosomes in a cell cycle-dependent manner. It also binds to the spindle microtubules, and its activity is required for bipolar spindle assembly (27Roghi C. Giet R. Uzbekov R. Morin N. Chartrain I. Le Guellec R. Couturier A. Doree M. Philippe M. Prigent C. J. Cell Sci. 1998; 111: 557-572Crossref PubMed Google Scholar). In vivo pEg2 has been reported to associate with the kinesin-related protein XlEg5 and to the cytoplasmic polyadenylation element binding factor. Both proteins are phosphorylated by pEg2 in vitro in residues found phosphorylated in vivo (24Giet R. Prigent C. J. Cell Sci. 1999; 112: 3591-3601Crossref PubMed Google Scholar, 28Mendez R. Hake L.E. Andresson T. Littlepage L.E. Ruderman J.V. Richter J.D. Nature. 2000; 404: 302-307Crossref PubMed Scopus (290) Google Scholar). In vertebrate cells the aurora kinase(s) that phosphorylates histone H3 is not known. Moreover, none of the X. laevis H3 mitotic kinases have been identified yet. The aim of this work was to search for such enzyme(s). To this end extracts from Xenopus eggs were used, and in vitro chromosome assembly was performed. We have identified the aurora-A kinase pEg2 as a potentially good candidate for histone H3 mitotic kinase in Xenopus eggs. Mitotic extracts from Xenopus eggs were prepared essentially as described (49Losada A. Yokochi T. Kobayashi R. Hirano T. J. Cell Biol. 2000; 150: 405-416Crossref PubMed Scopus (258) Google Scholar). Dejellied eggs were crushed by centrifugation for 15 min at 15,000 rpm in an SW41 rotor (Beckman Instruments) at 16 °C in XBE2 buffer (100 mm KCl, 2 mm MgCl2, 0.1 mm CaCl2, 10 mm K-HEPES, pH 7.7, 5 mm K-EGTA, 0.05m sucrose) supplemented with 10 µg/ml leupeptin and aprotinin and 100 µg/ml cytochalasin D. The cytoplasmic layer was collected using a 20-gauge needle via a side puncture and kept on ice. Protease inhibitors (leupeptin and aprotinin) and cytochalasin D at final concentration of 10 µg/ml and 1/20 volume of 20× energy mix (20 mm phosphocreatine, 2 mm ATP, and 5 µg/ml creatine kinase, final concentration) were added, and the extract was clarified by centrifuging at the same speed as above, but at 4 °C. The golden layer (low speed supernatant) was collected and transferred in 2 ml of polypropylene tubes for a TLS-55 rotor (Beckman Instruments) and spun at 52,000 rpm for 2 h at 4 °C. The top lipid layer was aspirated under vacuum, and the clear cytoplasmic fraction was recentrifuged at 4 °C for 30 min at 52,000 rpm to remove the residual membranes. The extract (high speed supernatant) was collected, aliquoted in 25-µl fractions, immediately frozen in liquid nitrogen, and stored at −80 °C. Heated extracts were prepared as described previously (35Dimitrov S. Wolffe A.P. EMBO J. 1996; 15: 5897-5906Crossref PubMed Scopus (112) Google Scholar). Demembraned sperm nuclei were isolated according to a protocol published previously (50de la Barre A.-E. Robert-Nicoud M. Dimitrov S. Methods Mol. Biol. 1999; 119: 219-229PubMed Google Scholar). They were aliquoted in 5-µl fractions at a concentration of 1 µg/µl DNA and stored at −80 °C. Each aliquot was used only once, since after refreezing and a second thawing the demembraned sperm nuclei strongly tend to aggregate. Recombinant X. laevis full-length and globular domain histone proteins were made in bacteria and purified to homogeneity as described by Luger et al. (34Luger K. Rechsteiner T.J. Flaus A.J. Waye M.M. Richmond T.J. J. Mol. Biol. 1997; 272: 301-311Crossref PubMed Scopus (369) Google Scholar). The mutations of serine 10 and of serine 28 to alanine in histone H3 were made according to the standard site-directed mutagenesis approach by using QuickChangeTM site-directed mutagenesis kit (Stratagene). For the first mutation the oligonucleotides used were pet3aH3S10A (cagaccgcccgtaaagctaccggagggaagg) and pet3bH3S10A (ccttccctccggtagctttacgggcggtctg), and the mutagenesis at serine 28 was carried out with pet3aH3S28A (caccaaggcagccaggaaggctgctcctgctacc) and pet3bH3S28A (ggtagcaggagcagccttcctggctgccttggtg) oligonucleotides. The mutated histone H3 was expressed and purified exactly as the non-mutated one. The GST-histone tail fusion proteins were prepared as described (22de la Barre A.E. Gerson V. Gout S. Creaven M. Allis C.D. Dimitrov S. EMBO J. 2000; 19: 379-391Crossref PubMed Scopus (99) Google Scholar). The concentration of the recombinant proteins was determined by using both Bradford assay and spectrophotometrically. pEg2 was depleted from the extract by the already characterized 1C1 monoclonal antibody (27Roghi C. Giet R. Uzbekov R. Morin N. Chartrain I. Le Guellec R. Couturier A. Doree M. Philippe M. Prigent C. J. Cell Sci. 1998; 111: 557-572Crossref PubMed Google Scholar). The immunodepletion was carried out essentially according to a protocol described previously (37Dimitrov S. Dasso M.C. Wolffe A.P. J. Cell Biol. 1994; 126: 591-601Crossref PubMed Scopus (117) Google Scholar). Briefly, protein A-agarose beads (Amersham Pharmacia Biotech) were washed with EB buffer (80 mm β-glycerophosphate, pH 7.3, 15 mm MgCl2, 20 mm EGTA, 1 mm dithiothreitol) and blocked with 5 times volume of bovine serum albumin at a concentration of 10 mg/ml. After three successive washings with EB, 500 µl of the hybridoma supernatant was added to 50 µl of pelleted beads, and the suspension was incubated for 1 h under rotation at 4 °C. For the mock immunodepletion, 25 µl of preimmune serum was diluted with EB to 500 µl final volume, mixed with 50 µl of settled beads, and incubated as above. Once the incubation completed, the beads were washed 3 times with 10 volumes of EB. The cytosol was depleted by adding 4 volumes of extract to 1 volume of settled beads followed by incubation under rotation at 4 °C for 1 h. After centrifugation, the supernatant was treated with additional 50 µl of fresh beads under the conditions described. Quantitative measurements showed that this protocol removed 95–98% of pEg2 present in the extract. The native pEg2 immobilized to the beads was further used in kinase assay experiments. Recombinant pEg2 was expressed and purified essentially as described (27Roghi C. Giet R. Uzbekov R. Morin N. Chartrain I. Le Guellec R. Couturier A. Doree M. Philippe M. Prigent C. J. Cell Sci. 1998; 111: 557-572Crossref PubMed Google Scholar). Briefly, cDNA of pEg2 was prepared by differential screening of Xenopusegg cDNA library. The coding sequence of the protein was amplified by polymerase chain reaction and inserted inNheI/XhoI restriction sites of the His tag expression vector pET21 (Novagen Inc.) using primers described previously (27Roghi C. Giet R. Uzbekov R. Morin N. Chartrain I. Le Guellec R. Couturier A. Doree M. Philippe M. Prigent C. J. Cell Sci. 1998; 111: 557-572Crossref PubMed Google Scholar). The catalytically inactive form of the enzyme pEg2KR was engineered with Transformer Site-directed Mutagenesis Kit (CLONTECH) to change the lysine 169 of pEg2 to arginine. The kinases were expressed in Escherichia colistrain BL21(DE3) and the tagged proteins purified on a nickel column (Qiagen). The purified enzymes were dialyzed overnight against EB, aliquoted in 20-µl fractions, and stored at −20 °C at concentration 0.2–0.5 µg/µl. For the kinase assay 1 µl of recombinant pEg2 was added to 50 µl of EB containing 1 µg of recombinant histones or 5 µg of reconstituted nucleosomes. After addition of 20 µCi of [γ-32P]ATP, the reaction was allowed to proceed for 15 min at room temperature, and then the proteins were precipitated with 20% trichloroacetic acid (final concentration). The pellet was dissolved in 8 m urea, and after adding sample buffer the proteins were separated on 18% SDS-polyacrylamide gel, and the gel was dried and autoradiographed. The immunoblotting protocol was already described (22de la Barre A.E. Gerson V. Gout S. Creaven M. Allis C.D. Dimitrov S. EMBO J. 2000; 19: 379-391Crossref PubMed Scopus (99) Google Scholar). The dilution used for the anti-phosphorylated histone H3 antiserum was 1:3000, whereas the hybridoma supernatant was diluted 1:500. The filters were developed by using the enhanced chemiluminescence system (ECL, Amersham Pharmacia Biotech) following the instructions of the manufacturer. The extract was prepared by using Saccharomyces cerevisiae strain GA59. This yeast strain has the advantage of exhibiting low protease activity. An overnight preculture, grown in YPD medium, was diluted toA 600 = 0.2–0.3 with the same medium. The yeast were further grown at 30 °C to A 600 = 0.5 and then supplemented with nocodazole to 10 µg/ml final concentration. The control and the nocodazole-containing cultures (50 ml each) were next incubated for 5 h and harvested by centrifugation. The pellets were washed twice with ice-cold water and resuspended in 1 ml of lysis buffer (10 mmMgCl2, 20 mm NaCl, 1% Triton X-100, 1 mm phenylmethylsulfonyl fluoride, 0.05% SDS, 1 µm okadaic acid, 50 mm Tris-HCl, pH 8.0). The suspension was then transferred in 2-ml Eppendorf tubes containing glass beads, and the cells were lysed by 5 min of vortexing. The cell debris were removed by centrifugation, and the supernatant was used in gel activity assay experiments. The gel activity assay was performed in 10- × 8-cm × 1-mm 10% SDS-polyacrylamide gel containing 50 µg/ml gel-incorporated substrate (GST-histone H3 tail fusions or the globular domain of histone H3). After separation of the extracts, the gel was incubated twice in 50 ml of buffer A (50 mmTris-HCl, pH 8.0, 20% 2-propanol) for 30 min, followed by two washings (50 ml each) in buffer B (50 mm Tris-HCl, pH 8.0, 5 mm β-mercaptoethanol) and two successive 30-min denaturation steps in 50 ml of buffer C (50 mm Tris-HCl, pH 8.0, 5 mm β-mercaptoethanol, 6 m guanidine chloride). Furthermore, the proteins were renatured by incubation of the gel for 30 min at 4 °C in 50 ml buffer D (50 mmTris-HCl, pH 8.0, 5 mm β-mercaptoethanol, 0.04% Tween 20). Then the gel was preincubated for 30 min in 50 ml of the activity buffer E (40 mm HEPES, pH 7.5, 25 mmMgCl2, 0.5 mm CaCl2, 50 mm dithiothreitol) followed by 1-h incubation in 10 ml of EB supplemented with 15 µCi of [γ-32P]ATP (3000 Ci/mmol, Amersham Pharmacia Biotech). Finally, after five washings (50 ml each) with 5% trichloroacetic acid, 1% tetrapyrophosphate, the gel was dried and autoradiographed. Mitotic chromosomes were assembled in Xenopus egg extract at 23 °C following a standard protocol (50de la Barre A.-E. Robert-Nicoud M. Dimitrov S. Methods Mol. Biol. 1999; 119: 219-229PubMed Google Scholar). 20–25 µl of extract were used for 40–60,000 demembraned sperm nuclei. In some experiments 1 µl of cyclin BΔ90 (the nondegradable form of cyclin B) was added. To follow the kinetics of assembly, 5-µl aliquots from the mock-depleted and pEg2-depleted extract were taken at different times after initial incubation and fixed immediately with 5 µl of the fix/stain buffer (Hoechst 33258 at 1 µg/ml in 200 mmsucrose, 10 mm HEPES, pH 7.5, 7.4% formaldehyde, 0.23% 1,4-diazabicycle-[2.2.2]octane, 0.02% B NaN3, and 70% glycerol). The decondensation of sperm nuclei in heated extract was carried out as described previously (35Dimitrov S. Wolffe A.P. EMBO J. 1996; 15: 5897-5906Crossref PubMed Scopus (112) Google Scholar). The immunofluorescence analysis was carried out as described by de la Barre et al. (50de la Barre A.-E. Robert-Nicoud M. Dimitrov S. Methods Mol. Biol. 1999; 119: 219-229PubMed Google Scholar). The anti-phosphorylated histone H3 antibody was used at dilution 1:5000. Finally, the chromosomes were counterstained with 8 µl of fix/stain buffer. Hen erythrocyte nuclei were isolated as described by Mirzabekov et al. (51Mirzabekov A.D. Pruss D.V. Ebralidze K.K. J. Mol. Biol. 1990; 211: 479-491Crossref PubMed Scopus (41) Google Scholar). Oligosomes were prepared by digestion of the nuclei with micrococcal nuclease and linker histones, and non-histone proteins were removed by centrifugation of the oligosomes over 5–20% sucrose, containing 0.65m NaCl (52Mutskov V. Gerber D. Angelov D. Ausio J. Workman J. Dimitrov S. Mol. Cell. Biol. 1998; 18: 6293-6304Crossref PubMed Scopus (118) Google Scholar). After overnight dialysis against a solution of 10 mm Tris-HCl, pH 7.5, 10 mm NaCl, 1 mm EDTA, oligonucleosomes were aliquoted and stored frozen at −20 °C. In the reconstitution experiments, “bulk” nucleosomal DNA, prepared from native hen erythrocyte nucleosomes, was used. A strictly stoichiometric amount of the four histones (determined spectrometrically and checked on a SDS gel) in 10 mm HCl was dialyzed overnight at 4 °C against 2 m NaCl, 50 mm Tris-HCl, pH 7.8, 1 mm EDTA. The next morning a mixture of bulk nucleosomal DNA and 32P-end-labeled 152-bp EcoRI-RsaI fragment containing a Xenopus borealis somatic 5 S RNA gene was added to the dialysis tubing. The ratio of the added DNA to the core histone octamer was 1:0.8. Nucleosome reconstitution was performed by successively lowering the concentration of the NaCl in the dialysis buffer. Finally, the reconstituted particles were dialyzed against 10 mm Tris, pH 7.8, 10 mm NaCl, 1 mmEDTA and used for kinase assay. The extent of reconstitution and the integrity of the nucleosomes were checked by electrophoretic mobility shift analysis (EMSA) and DNase I footprinting. The EMSA was carried out in 2% agarose gel at room temperature in 0.5× TBE (Tris borate/EDTA) buffer. Upon completion of the electrophoresis, the gel was stained with ethidium bromide. The footprinting of the reconstituted nucleosomes was performed by using DNase I. The digestion was carried out with 10 ng of DNase I per 10 µl of nucleosome solution (10 ng/µl) in 10 mmTris-HCl, pH 7.6, 5 mm MgCl2 for 2 min at room temperature. The reaction was stopped by adding 100 µl of stop solution (10 mm EDTA, 0.1% SDS, 50 ng/µl proteinase K) followed by 30 min of incubation at 37 °C. Then the samples were phenol-extracted, ethanol-precipitated, and separated on 8% polyacrylamide sequencing gel containing urea. The dried gel was exposed overnight on a PhosphorImager screen. We were interested in determining the Xenopus kinase(s) responsible for the mitotic-specific phosphorylation of histone H3 at serine 10. However, various bona fide candidates for histone H3 mitotic kinases were identified in different organisms (15Hsu J.Y. Sun Z.W. Li X. Reuben M. Tatchell K. Bishop D.K. Grushcow J.M. Brame C.J. Caldwell J.A. Hunt D.F. Lin R. Smith M.M. Allis C.D. Cell. 2000; 102: 279-291Abstract Full Text Full Text PDF PubMed Scopus (712) Google Scholar, 17De Souza C.P. Osmani A.H. Wu L.P. Spotts J.L. Osmani S.A. Cell. 2000; 102: 293-302Abstract Full Text Full Text PDF PubMed Scopus (133) Google Scholar), which suggests either that distinct kinases operate in different systems or that several kinases can act in the same organism. If the last suggestion is true, it will be important to find the relative contribution of each enzyme in the mitotic phosphorylation of histone H3. Since in vitroserine 10 of histone H3 can be phosphorylated by a multitude of kinases (protein kinase A (29Shibata K. Inagaki M. Ajiro K. Eur. J. Biochem. 1990; 192: 87-93Crossref PubMed Scopus (70) Google Scholar), NIMA (17De Souza C.P. Osmani A.H. Wu L.P. Spotts J.L. Osmani S.A. Cell. 2000; 102: 293-302Abstract Full Text Full Text PDF PubMed Scopus (133) Google Scholar), Ipl1/aurora-B (15Hsu J.Y. Sun Z.W. Li X. Reuben M. Tatchell K. Bishop D.K. Grushcow J.M. Brame C.J. Caldwell J.A. Hunt D.F. Lin R. Smith M.M. Allis C.D. Cell. 2000; 102: 279-291Abstract Full Text Full Text PDF PubMed Scopus (712) Google Scholar), Msk1 (30Thomson S. Clayton A.L. Hazzalin C.A. Rose S. Barratt M.J. Mahadevan L.C. EMBO J. 1999; 18: 4779-4793Crossref PubMed Scopus (402) Google Scholar), mitogen-activated protein kinase-dependent kinases (31Thomson S. Mahadevan L.C. Clayton A.L. Cell. Dev. Biol. 1999; 10: 205-214Crossref PubMed Scopus (188) Google Scholar), and Rsk-2 (32Sassone-Corsi P. Mizzen C.A. Cheung P. Crosio C. Monaco L. Jacquot S. Hanauer A. Allis C.D. Science. 1999; 285: 886-891Crossref PubMed Scopus (425) Google Scholar)), the determination of the active mitotic kinases could be done more easily by using yeast, which is a somewhat simpler system, instead of Xenopus. As H3 phosphorylation is highly conserved in evolution, the major mitotic kinases modifying this protein should belong to the same families in different organisms. Thus, the identification of the yeast enzymes will undoubtedly be instrumental for the analysis of the Xenopus system. Since the yeast genome is already sequenced, the kinase molecular weight determination will allow their identification. Following this rationale, we carried out a series of in gel activity assays using crude extracts isolated from nocodazole-treated or control, non-treatedS. cerevisiae cells (Fig. 1). As substrates for the kinases we have incorporated into the gels either the non-mutated GST-histone H3 tail fusion (GSTH3) or the same fusion, but mutated at serine 10 to alanine (GSTH3S10), or the globular domain of histone H3 (GH3). As a control, we have used gel-incorporated GST. When the mitotic extract (isolated from the nocodazole-treated cells) was subjected to the assay, three specific bands were detected by autoradiography in the gel containing GST-H3. The strongest band migrated with molecular mass of 40–42 kDa. The incorporation of32P in these three positions was characteristic for the yeast mitotic extract in the gel comprising GST-H3; very faint or no32P-labeled bands with the above molecular masses were observed in all other cases (Fig. 1, compare lane 1 withlanes 2–8). These data suggest that at least three different kinases from the yeast mitot" @default.
• W2085328698 created "2016-06-24" @default.
• W2085328698 creator A5001176567 @default.
• W2085328698 creator A5007944015 @default.
• W2085328698 creator A5033301617 @default.
• W2085328698 creator A5043854543 @default.
• W2085328698 creator A5052866417 @default.
• W2085328698 creator A5067638671 @default.
• W2085328698 date "2001-08-01" @default.
• W2085328698 modified "2023-09-30" @default.
• W2085328698 title "pEg2 Aurora-A Kinase, Histone H3 Phosphorylation, and Chromosome Assembly in Xenopus Egg Extract" @default.
• W2085328698 cites W1547045190 @default.
• W2085328698 cites W1591026223 @default.
• W2085328698 cites W1709965902 @default.
• W2085328698 cites W1765359824 @default.
• W2085328698 cites W1886278373 @default.
• W2085328698 cites W1963611529 @default.
• W2085328698 cites W1966219754 @default.
• W2085328698 cites W1971870945 @default.
• W2085328698 cites W1973704051 @default.
• W2085328698 cites W1975622188 @default.
• W2085328698 cites W1987357877 @default.
• W2085328698 cites W1989394815 @default.
• W2085328698 cites W1989429888 @default.
• W2085328698 cites W1990313351 @default.
• W2085328698 cites W1991085321 @default.
• W2085328698 cites W1993283206 @default.
• W2085328698 cites W1994197082 @default.
• W2085328698 cites W1994762541 @default.
• W2085328698 cites W2000073432 @default.
• W2085328698 cites W2006343823 @default.
• W2085328698 cites W2009876130 @default.
• W2085328698 cites W2018966815 @default.
• W2085328698 cites W2026161399 @default.
• W2085328698 cites W2032794324 @default.
• W2085328698 cites W2033097911 @default.
• W2085328698 cites W2034980302 @default.
• W2085328698 cites W2038932046 @default.
• W2085328698 cites W2048109276 @default.
• W2085328698 cites W2051237347 @default.
• W2085328698 cites W2055203805 @default.
• W2085328698 cites W2061805545 @default.
• W2085328698 cites W2066607735 @default.
• W2085328698 cites W2067738632 @default.
• W2085328698 cites W2108408221 @default.
• W2085328698 cites W2114202198 @default.
• W2085328698 cites W2115659567 @default.
• W2085328698 cites W2125624250 @default.
• W2085328698 cites W2128240046 @default.
• W2085328698 cites W2134256488 @default.
• W2085328698 cites W2138090834 @default.
• W2085328698 cites W2148598813 @default.
• W2085328698 cites W2155058162 @default.
• W2085328698 cites W2155716214 @default.
• W2085328698 cites W2160731157 @default.
• W2085328698 cites W2162327622 @default.
• W2085328698 cites W2163046373 @default.
• W2085328698 cites W2170016329 @default.
• W2085328698 cites W2189063705 @default.
• W2085328698 cites W2276913308 @default.
• W2085328698 cites W276165663 @default.
• W2085328698 doi "https://doi.org/10.1074/jbc.m102701200" @default.
• W2085328698 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/11402032" @default.
• W2085328698 hasPublicationYear "2001" @default.
• W2085328698 type Work @default.
• W2085328698 sameAs 2085328698 @default.
• W2085328698 citedByCount "54" @default.
• W2085328698 countsByYear W20853286982012 @default.
• W2085328698 countsByYear W20853286982014 @default.
• W2085328698 countsByYear W20853286982015 @default.
• W2085328698 countsByYear W20853286982016 @default.
• W2085328698 countsByYear W20853286982019 @default.
• W2085328698 crossrefType "journal-article" @default.
• W2085328698 hasAuthorship W2085328698A5001176567 @default.
• W2085328698 hasAuthorship W2085328698A5007944015 @default.
• W2085328698 hasAuthorship W2085328698A5033301617 @default.
• W2085328698 hasAuthorship W2085328698A5043854543 @default.
• W2085328698 hasAuthorship W2085328698A5052866417 @default.
• W2085328698 hasAuthorship W2085328698A5067638671 @default.
• W2085328698 hasBestOaLocation W20853286981 @default.
• W2085328698 hasConcept C104317684 @default.
• W2085328698 hasConcept C11960822 @default.
• W2085328698 hasConcept C153911025 @default.
• W2085328698 hasConcept C184235292 @default.
• W2085328698 hasConcept C185592680 @default.
• W2085328698 hasConcept C2776745794 @default.
• W2085328698 hasConcept C2779535977 @default.
• W2085328698 hasConcept C552990157 @default.
• W2085328698 hasConcept C55493867 @default.
• W2085328698 hasConcept C64927066 @default.
• W2085328698 hasConcept C86803240 @default.
• W2085328698 hasConcept C95444343 @default.
• W2085328698 hasConcept C97029542 @default.
• W2085328698 hasConceptScore W2085328698C104317684 @default.
• W2085328698 hasConceptScore W2085328698C11960822 @default.
• W2085328698 hasConceptScore W2085328698C153911025 @default.
• W2085328698 hasConceptScore W2085328698C184235292 @default.
• W2085328698 hasConceptScore W2085328698C185592680 @default.

• next