FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2085384522> ?p ?o ?g. }

• W2085384522 endingPage "33553" @default.
• W2085384522 startingPage "33537" @default.
• W2085384522 abstract "Resensitization of G protein-coupled receptors (GPCR) following prolonged agonist exposure is critical for restoring the responsiveness of the receptor to subsequent challenges by agonist. The 3′-5′ cyclic AMP-dependent protein kinase (PKA) and serine 312 in the third intracellular loop of the human β1-adrenergic receptor (β1-AR) were both necessary for efficient recycling and resensitization of the agonist-internalized β1-AR (Gardner, L. A., Delos Santos, N. M., Matta, S. G., Whitt, M. A., and Bahouth, S. W. (2004) J. Biol. Chem. 279, 21135-21143). Because PKA is compartmentalized near target substrates by interacting with protein kinase A anchoring proteins (AKAPs), the present study was undertaken to identify the AKAP involved in PKA-mediated phosphorylation of the β1-AR and in its recycling and resensitization. Here, we report that Ht-31 peptide-mediated disruption of PKA/AKAP interactions prevented the recycling and functional resensitization of heterologously expressed β1-AR in HEK-293 cells and endogenously expressed β1-AR in SK-N-MC cells and neonatal rat cortical neurons. Whereas several endogenous AKAPs were identified in HEK-293 cells, small interfering RNA-mediated down-regulation of AKAP79 prevented the recycling of the β1-AR in this cell line. Co-immunoprecipitations and fluorescence resonance energy transfer (FRET) microscopy experiments in HEK-293 cells revealed that the β1-AR, AKAP79, and PKA form a ternary complex at the carboxyl terminus of the β1-AR. This complex was involved in PKA-mediated phosphorylation of the third intracellular loop of the β1-AR because disruption of PKA/AKAP interactions or small interfering RNA-mediated down-regulation of AKAP79 both inhibited this response. Thus, AKAP79 provides PKA to phosphorylate the β1-AR and thereby dictate the recycling and resensitization itineraries of the β1-AR. Resensitization of G protein-coupled receptors (GPCR) following prolonged agonist exposure is critical for restoring the responsiveness of the receptor to subsequent challenges by agonist. The 3′-5′ cyclic AMP-dependent protein kinase (PKA) and serine 312 in the third intracellular loop of the human β1-adrenergic receptor (β1-AR) were both necessary for efficient recycling and resensitization of the agonist-internalized β1-AR (Gardner, L. A., Delos Santos, N. M., Matta, S. G., Whitt, M. A., and Bahouth, S. W. (2004) J. Biol. Chem. 279, 21135-21143). Because PKA is compartmentalized near target substrates by interacting with protein kinase A anchoring proteins (AKAPs), the present study was undertaken to identify the AKAP involved in PKA-mediated phosphorylation of the β1-AR and in its recycling and resensitization. Here, we report that Ht-31 peptide-mediated disruption of PKA/AKAP interactions prevented the recycling and functional resensitization of heterologously expressed β1-AR in HEK-293 cells and endogenously expressed β1-AR in SK-N-MC cells and neonatal rat cortical neurons. Whereas several endogenous AKAPs were identified in HEK-293 cells, small interfering RNA-mediated down-regulation of AKAP79 prevented the recycling of the β1-AR in this cell line. Co-immunoprecipitations and fluorescence resonance energy transfer (FRET) microscopy experiments in HEK-293 cells revealed that the β1-AR, AKAP79, and PKA form a ternary complex at the carboxyl terminus of the β1-AR. This complex was involved in PKA-mediated phosphorylation of the third intracellular loop of the β1-AR because disruption of PKA/AKAP interactions or small interfering RNA-mediated down-regulation of AKAP79 both inhibited this response. Thus, AKAP79 provides PKA to phosphorylate the β1-AR and thereby dictate the recycling and resensitization itineraries of the β1-AR. The β1-AR 2The abbreviations used are: β1-AR, β1-adrenergic receptor; GPCR, G protein-coupled receptors; PKA, cyclic AMP-dependent protein kinase; 3rd IC, third intracellular loop; AKAP, A-kinase anchoring proteins; FRET, fluorescence resonance energy transfer; st-Ht31, stearated Ht31 peptide; GRK, G protein-coupled receptor kinase; WT, wild type; mPKI, myristolated protein kinase inhibitory peptide; FRETN, normalized FRET; AMPA, α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid; HEK, human embryonic kidney; DMEM, Dulbecco's modified Eagle's medium; CFP, cyan fluorescent protein; YFP, yellow fluorescent protein; siRNA, small interfering RNA; PBS, phosphate-buffered saline; GFP, green fluorescent protein; GST, glutathione S-transferase; Tricine, N-[2-hydroxy-1,1-bis(hydroxymethyl)ethyl]glycine. is a major receptor for the physiological regulation of cardiac function by the sympathetic nervous system and plays an important role in clinical management of hypertension and heart failure (2Lohse M.J. Engelhardt S. Eschenhagen T. Circ. Res. 2003; 93: 896-906Crossref PubMed Scopus (615) Google Scholar). Agonist-mediated activation of the β1-AR results in the generation of intracellular cyclic AMP and in the activation of PKA, which in turn phosphorylates numerous intracellular targets that mediate the familiar effects of β-agonists (3Xiao R.P. Zhu W. Zheng M. Chakir K. Bond R. Lakatta E.G. Cheng H. Trends Pharmacol. Sci. 2004; 25: 358-365Abstract Full Text Full Text PDF PubMed Scopus (123) Google Scholar). As a consequence of their activation, the β1-AR and other G protein-coupled receptors (GPCR) can undergo desensitization, which is characterized by attenuation of GPCR signaling intensity (4Freedman N.J. Lefkowitz R.J. Recent Prog. Horm. Res. 1996; 51: 319-353PubMed Google Scholar). The biochemical mechanisms of desensitization are numerous, but appear to be initiated by the phosphorylation of the agonist-occupied GPCR by G protein-coupled receptor kinases (GRK), followed by uncoupling of the GPCR from its cognate G protein by β-arrestins, which culminates in the internalization or sequestration of the GPCR away from its signaling platform (5Lefkowitz R.J. J. Biol. Chem. 1998; 273: 18677-18680Abstract Full Text Full Text PDF PubMed Scopus (911) Google Scholar, 6Luttrell L.M. Ferguson S.S. Daaka Y. Miller W.E. Maudsley S. Della Rocca G.J. Lin F. Kawakatsu H. Owada K. Luttrell D.K. Caron M.G. Lefkowitz R.J. Science. 1999; 283: 655-661Crossref PubMed Scopus (1276) Google Scholar). Internalization of the GPCR appears to produce different outcomes depending on the type of GPCR and cell line under study. For β1-AR, β2-AR, and other GPCR, internalization is a prerequisite for resensitization because intracellular trafficking and subsequent recycling of resensitized GPCR promotes their insertion into the cell membrane to maintain agonist responsiveness (1Gardner L.A. Delos Santos N.M. Matta S.G. Whitt M.A. Bahouth S.W. J. Biol. Chem. 2004; 279: 21135-21143Abstract Full Text Full Text PDF PubMed Scopus (32) Google Scholar, 7Yu S.S. Lefkowitz R.J. Hausdorff W.P. J. Biol. Chem. 1993; 268: 337-341Abstract Full Text PDF PubMed Google Scholar, 8Kreuger K.M. Daaka Y. Pitcher J.A. Lefkowitz R.J. J. Biol. Chem. 1997; 272: 5-8Abstract Full Text Full Text PDF PubMed Scopus (318) Google Scholar, 9Pipping S. Andexinger S. Lohse M.J. Mol. Pharmacol. 1995; 47: 666-676PubMed Google Scholar). For the δ-opioid, other GPCRs, the internalized receptors do not recycle back, instead they are retained intracellularly and later degraded either by lysosomal or proteasomal pathways (10Whistler J.L. Enquist J. Marley A. Fong J. Gladher F. Tsuruda J. Murray S.R. von Zastrow M. Science. 2002; 297: 615-620Crossref PubMed Scopus (277) Google Scholar, 11Garland A.M. Grady E.F. Lovett M. Vigna S.R. Frucht M.M. Krause J.E. Bunnett N.W. Mol. Pharmacol. 1996; 49: 438-446PubMed Google Scholar, 12Bremnes T. Paasche J.D. Mehlum A. Sandberg C. Bremnes B. Attramadal H. J. Biol. Chem. 2000; 275: 17596-17604Abstract Full Text Full Text PDF PubMed Scopus (215) Google Scholar). Recently, PKA and its putative substrate, serine at position 312 (Ser312) in the third intracellular loop (3rd IC) of the human β1-AR, were found to be critical determinants of the ability of the β1-AR to recycle and resensitize (1Gardner L.A. Delos Santos N.M. Matta S.G. Whitt M.A. Bahouth S.W. J. Biol. Chem. 2004; 279: 21135-21143Abstract Full Text Full Text PDF PubMed Scopus (32) Google Scholar). Inhibition of PKA or mutagenesis of Ser312 to alanine (S312A) prevented the recycling and resensitization of the agonist-internalized β1-AR (1Gardner L.A. Delos Santos N.M. Matta S.G. Whitt M.A. Bahouth S.W. J. Biol. Chem. 2004; 279: 21135-21143Abstract Full Text Full Text PDF PubMed Scopus (32) Google Scholar). PKA-mediated resensitization of the β1-AR is termed “homologous resensitization” because PKA is activated through the β1-AR signaling pathway. Therefore, desensitization and resensitization of the β1-AR are orchestrated through interplay between GRK- and PKA-mediated phosphorylation of this receptor. The involvement of kinases such as GRK, PKA, PKC, and phosphatidylintositol 3-kinase in setting of the trafficking itinerary of GPCR and other cell surface proteins is well established (6Luttrell L.M. Ferguson S.S. Daaka Y. Miller W.E. Maudsley S. Della Rocca G.J. Lin F. Kawakatsu H. Owada K. Luttrell D.K. Caron M.G. Lefkowitz R.J. Science. 1999; 283: 655-661Crossref PubMed Scopus (1276) Google Scholar, 8Kreuger K.M. Daaka Y. Pitcher J.A. Lefkowitz R.J. J. Biol. Chem. 1997; 272: 5-8Abstract Full Text Full Text PDF PubMed Scopus (318) Google Scholar). For example, PKA-mediated phosphorylation of the cystic fibrosis transmembrane conductance regulator at Ser753 is involved in its recycling, which otherwise is impaired in cystic fibrosis (13Seibert F.S. Tabcharani J.A. Chang X.B. Dulhanty A.M. Mathews C. Hanrahan J.W. Riordan J.R. J. Biol. Chem. 1995; 270: 2158-2162Abstract Full Text Full Text PDF PubMed Scopus (80) Google Scholar). Likewise, PKA is involved in vasopressin-mediated translocation of the water-channel forming protein aquaporin-2 from the intracellular compartment into the plasma membrane, as well as in the trafficking of the AMPA receptor and its insertion into neuronal membranes (14Katsura T. Gustafson C.E. Ausiello D.A. Brown D. Am. J. Physiol. 1997; 272: F817-F822Crossref PubMed Google Scholar, 15Ehlers M.D. Neuron. 2000; 28: 511-525Abstract Full Text Full Text PDF PubMed Scopus (909) Google Scholar). PKA is assembled as a tetramer composed of two regulatory (R) and two catalytic (C) subunits. Eukaryotic cells express four isoforms (RI α, β, and RII α, β) of the R subunit and three isoforms (α, β, γ) of the C subunit (16Chrivia J.C. Uhler M.D. McKnight G.S. J. Biol. Chem. 1988; 263: 5739-5744Abstract Full Text PDF PubMed Google Scholar). The RIα and RIIα subunits are ubiquitously expressed, whereas the expression of RIβ and RIIβ is more restricted (16Chrivia J.C. Uhler M.D. McKnight G.S. J. Biol. Chem. 1988; 263: 5739-5744Abstract Full Text PDF PubMed Google Scholar). PKA is a kinase with broad substrate specificity that is involved in numerous biological events (17Kim C. Xuong N.H. Taylor S.S. Science. 2005; 301: 690-696Crossref Scopus (290) Google Scholar). The fidelity of PKA-mediated phosphorylation of target proteins is regulated by spatial mechanisms that target PKA toward its substrate and by temporal mechanisms involving phosphodiesterases that degrade cyclic AMP to limit the duration of the biological effects of PKA (18Wong W. Scott J.D. Nat. Rev. Mol. Cell Biol. 2004; 5: 959-970Crossref PubMed Scopus (865) Google Scholar, 19Lynch M.J. Baillie G.S. Mohamed A. Li X. Maisonneuve C. Klussmann E. van Heeke G. Houslay M.D. J. Biol. Chem. 2005; 280: 33178-33189Abstract Full Text Full Text PDF PubMed Scopus (186) Google Scholar). The PKA holoenzyme is targeted near potential substrates principally via RII subunit association with AKAPs (20Klauck T.M. Faux M.C. Labudda K. Langeberg L.K. Jaken S. Scott J.D. Science. 1996; 271: 1589-1592Crossref PubMed Scopus (484) Google Scholar). Each AKAP contains a PKA binding site and a unique subcellular targeting domain that restricts its location within the cell to either unique cellular compartments or specific substrates (20Klauck T.M. Faux M.C. Labudda K. Langeberg L.K. Jaken S. Scott J.D. Science. 1996; 271: 1589-1592Crossref PubMed Scopus (484) Google Scholar). Many AKAPs serve as organizing centers for signal transduction either by linking upstream signal generators to down-stream targets or by recruiting multiple signaling enzymes within signaling hubs (18Wong W. Scott J.D. Nat. Rev. Mol. Cell Biol. 2004; 5: 959-970Crossref PubMed Scopus (865) Google Scholar, 20Klauck T.M. Faux M.C. Labudda K. Langeberg L.K. Jaken S. Scott J.D. Science. 1996; 271: 1589-1592Crossref PubMed Scopus (484) Google Scholar). In this study, we examined whether the effects of PKA on recycling of the β1-AR were dependent on PKA anchoring and identified AKAP79 as the specific AKAP involved in recycling and resensitization of the β1-AR in HEK-293 cells. Cell Cultures—Human embryonic kidney 293 (HEK-293) cells and neuroepithelioma SK-N-MC cells were obtained from American Type Culture Collection (Manassas, VA). HEK-293 and SK-N-MC cultures were maintained in DMEM with 10% fetal bovine serum (HyClone, Logan, UT). Cortices from 1-day-old rats were dissociated by papain treatment, triturated through Pasteur pipettes, and suspended in media consisting of minimal essential medium with 10% fetal bovine serum and plated at a density of 106 cells/ml (21Tavalin S.J. Colledge M. Hell J.W. Langeberg L.K. Huganir R.L. Scott J.D. J. Neurosci. 2002; 22: 3044-3051Crossref PubMed Google Scholar). After 6 h, cells were washed with Neurobasal media with B27 supplement and 0.5 mm l-glutamine. Construction of FLAG-tagged or Myc-tagged β1-AR—To allow rapid assessment of cell surface expression of the β1-AR, the NH2-terminal initiator methionine was replaced either by the FLAG (DYKDDDDK) or Myc (EQKLISEEDL) sequences, resulting in N-FLAG/Myc-tagged WT β1-AR. The 8-amino acid FLAG epitope sequence (between parentheses) was inserted at the NH2 terminus of the β1-AR by the polymerase chain reaction using a sense primer 5′-AAGCTT(ATGGACTACAAGGACGACGATGACAAG)GGCGCGGGGGGCTCGTCCTGGGCG-3′ and antisense primer 5′-CATGAATTCTACACCTTGGATTCCGAGGCGAAGCCGGG. The Myc tag sequence (between parentheses) was inserted in the NH2 terminus of the β1-AR using sense primer 5′-AAGCTTA(ATGGAACAAAAACTCATCTCAGAAGAGGATCTG)GGCGCGGGGGGCTCGTCCTGGGCG-3′ and the antisense primer described earlier. The 1.5-kb β1-AR cDNA flanked with HindIII (5′) and EcoRI (3′) sites was cloned into the multiple cloning site of mammalian expression vector pcDNA3.1 (Invitrogen). To generate the β1-AR-(1-424) construct, the full-length β1-AR cDNA was cut with SmaI and the resulting 1.3-kb cDNA was cloned into pcDNA3.1. Sequences of the epitope-tagged β1-AR were verified by dideoxy sequencing. Construction of Fluorescently Tagged β1-AR, AKAP79, and RIIα Subunit—The coding sequence of the FLAG-tagged WT β1-AR was amplified by PCR using synthetic oligonucleotides to introduce a 5′ HindIII site, followed by the coding sequence and then by a 3′ BamHI site. The amplification primers for the β1-AR were: forward primer (5′-AAGCTTATGGACTACAAGGACGACGATGACAAGGGCGCGGGGGTGCTCGTCCTGGGCG) and reverse primer (TGGATCCACCTTGGATTCCGAGGCGAAGCC). The resulting 1.5-kb HindIII-BamHI cDNA was fused in-frame 5′ to the CFP/YFP coding sequence in the pECFP-N1 and pECYFP-N1 vectors (BD Bioscience) to generate NH2-terminal fusions of the β1-AR to CFP and YFP. For AKAP79, the coding sequence of human AKAP79 was amplified by PCR using a forward primer (5′-AAGCTTATGGAAACCACAATTTCAGAA) and a reverse primer (3′-TGAATTCTGTAGAAGATTGTTTATTTT) to generate 1.6-kb HindIII-EcoRI cDNA, which was later fused into the pECFP-N1 and pEYFP-N1. Expression of the fusion proteins was confirmed by fluorescence microscopy and Western blot analysis. The cloned sequences were verified by DNA sequencing. Mouse PKA-RIIα in the pECFP and pEYFP vectors (22Oliveria S.F. Gomez L.L. Dell'Acqua M.L. J. Cell Biol. 2003; 160: 101-112Crossref PubMed Scopus (107) Google Scholar) was provided by Mark Dell'Acqua (University of Colorado HSC, Denver, CO). Antibodies, siRNA, Peptides, and Additional Reagents—The antibodies against FLAG (M2) and Myc (9E-10) epitopes were purchased from Sigma and Upstate (Charlottesville, VA), respectively. The monoclonal antibodies to human AKAP79 and to the various subunits of PKA were from BD Bioscience. st-Ht31 and st-Ht31-pro peptides were obtained from Promega Corp. The anti-β1-AR (A-20 and V-19) antibodies were from Santa Cruz Biotechnology (Santa Cruz, CA) and the anti-rat AKAP150 antibody was from Upstate (Charlottesville, VA). AKAP79 siRNA (AAgagaucagcagaagguagu) corresponding to nucleotides 48-66 in human AKAP79 or its scrambled control siRNA (AAggcaacaaaggcuaaguca) and human gravin siRNA (cgaggcggcgccagacaccac) corresponding to nucleotides 161-181 or its scrambled control (ggagcgcggcgaccaacccca) were synthesized by Dharmacon Corp. (Lafayette, CO). siRNAs were transfected at a concentration of 50-100 nm into HEK-293 by the Lipofectamine 2000™ transfection reagent (Invitrogen). After 2 days, cell extracts were probed for AKAP79 or gravin expression by Northern and Western blots. To determine the effect of the siRNAs on recycling of the WT β1-AR, cells stably expressing the FLAG-tagged β1-AR were transiently transfected with 100 nm of each duplex siRNA for 2 days, before conducting the confocal recycling assay described below. Acid Strip Confocal Recycling Microscopy Protocol— HEK-293 cells stably expressing the FLAG- or Myc-tagged WT β1-AR were grown on poly-l-lysine-coated glass coverslips and serum-starved at 37 °C for 1 h in DMEM supplemented with 25 mm HEPES, pH 7.4. The receptors were labeled with fluorescein isothiocyanate-conjugated, anti-FLAG M2 IgG (10 μg/ml) for 1 h at 37 °C. Cells were treated with 10 μm isoproterenol for 30 min at 37 °C to promote agonist-mediated receptor internalizaion. Then the cells were chilled in 4 °C Tris-buffered saline to stop endocytosis, and exposed to 0.5 m NaCl, 0.2 m acetic acid (pH 3.5) for 4 min on ice to remove antibody bound to extracellular β1-AR (1Gardner L.A. Delos Santos N.M. Matta S.G. Whitt M.A. Bahouth S.W. J. Biol. Chem. 2004; 279: 21135-21143Abstract Full Text Full Text PDF PubMed Scopus (32) Google Scholar, 15Ehlers M.D. Neuron. 2000; 28: 511-525Abstract Full Text Full Text PDF PubMed Scopus (909) Google Scholar, 23Snyder E.M. Philpot B.D. Huber K.M. Dong X. Fallon J.R. Bear M.F. Nat. Neurosci. 2001; 4: 1079-1085Crossref PubMed Scopus (462) Google Scholar). Cultures were quickly rinsed in warm DMEM supplemented with HEPES, then incubated with 100 μm of the β-antagonist alprenolol at 37 °C for 10, 20, 30, or 45 min to establish the recycle time. After each time period, the coverslips were rinsed and fixed in 4% paraformaldehyde with 4% sucrose in PBS (pH 7.4) for 10 min at room temperature (23Snyder E.M. Philpot B.D. Huber K.M. Dong X. Fallon J.R. Bear M.F. Nat. Neurosci. 2001; 4: 1079-1085Crossref PubMed Scopus (462) Google Scholar). Analysis of Immunocytochemical Data—Analyses were performed blind to the stimulation history of the culture. Microscope fields had 1-3 cells displaying generally healthy morphology. Six to 10 fields were imaged per culture and n = 10 cultures were processed per condition. Confocal fluorescence microscopy was performed using a Zeiss Axiovert LSM 510 (100 × 1.4 DIC oil immersion objective). Fluorescein isothiocyanate was excited with the 488-nm argon laser and imaged through the 520-nm long-pass emission filter. Thresholds were set by visual inspection and kept constant for each condition. Z-stacks of images were exported as TIFF files and individual sections were analyzed with Zeiss LSM 510 and NIH Image 1.6 software as previously described (1Gardner L.A. Delos Santos N.M. Matta S.G. Whitt M.A. Bahouth S.W. J. Biol. Chem. 2004; 279: 21135-21143Abstract Full Text Full Text PDF PubMed Scopus (32) Google Scholar). To determine the distribution of receptors between the membranous and intracellular compartments, a circular boundary was drawn around the inner circumference of all acid/stripped cells to define a 300-nm wide membrane delimited area (24Delos Santos N.M. Gardner L.A. White S.B. Bahouth S.W. J. Biol. Chem. 2006; 281: 12896-12907Abstract Full Text Full Text PDF PubMed Scopus (68) Google Scholar). Fluorescence intensity measurements were calculated in the areas outside and inside the boundary to estimate the membranous versus internal pixels. These measurements were repeated in slides with similar threshold settings in which the radii for each boundary did not differ by ±15%. Pixel intensities in the intracellular boundary (internalized β1-AR) of isoproterenol-treated cells were set arbitrarily as 100% and pixel intensities in the intracellular boundaries of alprenolol-treated cells were calculated as percent of this initial value. In confocal recycling assays, the time constants (τ) for β1-AR recycling were determined by fitting the percent internal β1-AR pixel data to a single exponential decay function from y = yo + Ae-t/τ, where yo and A are constants. The data are presented as the mean ± S.E. Dual Confocal Microscopy—HEK-293 cells stably expressing the Myc-tagged β1-AR were transiently transfected with AKAP79-GFP. The cells were treated with 10 μm isoproterenol for 30 min, acid washed, and then exposed to 100 μm alprenolol for 30 min or 1 h. The coverslips were fixed with 4% paraformaldehyde and stained with Cy3 conjugated to 9E10 anti-Myc tag antibody and visualized by dual confocal microscopy (GFP, λex = 488 nm, λem = 505-530 BP; Cy3, λex = 543 nm, λem = 560 LP) using LSM-510 multitracking configuration. FRET Microscopy—These experiments were performed on live or fixed cells using sensitized emission and acceptor photobleaching methods, respectively (25Kenworthy A.K. Methods (Orlando). 2001; 24: 289-296Google Scholar, 26Sekar R.B. Periasamy A. J. Cell Biol. 2003; 160: 629-633Crossref PubMed Scopus (674) Google Scholar). Double stable cell lines expressing AKAP79-CFP and β1-AR-YFP, AKAP79-YFP and RII PKA-CFP, and β1-AR-YFP and RII PKA-CFP were established. In some cases, HEK-293 cells were transfected with the desired plasmids using Lipofectamine for 24-36 h. For live cell microscopy, transiently transfected or double-stable cells were plated onto glass-bottom Petri dishes (Mat-Tek, Ashland, MA) for 24 h and imaged live at room temperature. For fixed cell microscopy, cells were plated on poly-l-lysine-covered coverslips for 24 h. The coverslips were washed with PBS, fixed with 4% paraformaldehyde, pH 7.4, and mounted onto glass slides in Fluoromount G mounting media (Electron Microscopy Sciences, Hatfield, PA). Coverslips were sealed with clear nail polish and imaged within 24 h after fixation. Sensitized Emission FRET Microscopy—FRET was recorded using the three-channel sensitized emission mode (27Gordon G.W. Berry G. Liang X.H. Levin B. Herman B. Biophys. J. 1998; 74: 2702-2713Abstract Full Text Full Text PDF PubMed Scopus (729) Google Scholar, 28Sorkin A. McClure F. Huang G. Carter R. Curr. Biol. 2000; 10: 1395-1398Abstract Full Text Full Text PDF PubMed Scopus (255) Google Scholar). Donor channel (CFP) was acquired using donor excitation (λ = 458 nm) and donor emission (λ = 475-525 nm) with BP filter. Acceptor channel (YFP) was acquired using acceptor excitation (λ = 514 nm) and emission (λ = 530 nm) with LP filter. FRET was acquired using excitation (λ = 458 nm) and emission (λ = 530 nm) with LP filters. Images were taken from donor, acceptor, and FRET samples. Donor and acceptor images were used to evaluate the cross-talk of signals that is caused by image settings and fluorophore properties. The same acquisition parameters were used for donor, acceptor, and FRET samples (28Sorkin A. McClure F. Huang G. Carter R. Curr. Biol. 2000; 10: 1395-1398Abstract Full Text Full Text PDF PubMed Scopus (255) Google Scholar). FRET Calculations—LSM 510 FRET Macro tool was used to calculate FRETN values. FRETN is a measure of FRET that is normalized for the concentrations of donor and acceptor fluorophores and therefore represents a fully corrected measure of FRET (27Gordon G.W. Berry G. Liang X.H. Levin B. Herman B. Biophys. J. 1998; 74: 2702-2713Abstract Full Text Full Text PDF PubMed Scopus (729) Google Scholar). Quantitative comparisons of different FRET methods has determined that FRETN provides the most accurate measure of FRET efficiencies (29Gu Y. Di W.L. Kelsell D.P. Zicha D. J. Microsc. 2004; 215: 162-173Crossref PubMed Scopus (76) Google Scholar). In this method the corrected FRET value for each pixel is calculated and then divided by concentration values for donor and acceptor (27Gordon G.W. Berry G. Liang X.H. Levin B. Herman B. Biophys. J. 1998; 74: 2702-2713Abstract Full Text Full Text PDF PubMed Scopus (729) Google Scholar). FRETN was calculated on a pixel-by-pixel basis for the entire image and in regions of interest (marked by rectangles) using Equation 1. FRETN=FRET1Dfd×Afa∞[bound][total d]×[total a](Eq. 1) The equation indicates the proportional (∞) relationship between FRETN and the concentrations of the interacting and noninteracting species. In the equation [bound] represents the concentration of interacting pairs of donor labeled species and acceptor labeled species. The values for [total d] and [total a] represent the total concentrations (interacting and non-interacting) of the donor and acceptor labeled species, respectively. FRET1 is proportional to the FRET signal from the specimen. Dfd is the donor signal that would take place if no FRET occurred and is therefore proportional to the total concentration of donor. Afa is the acceptor signal that would take place if no FRET occurred and is therefore proportional to the total concentration of acceptor. Donor and acceptor coefficients were determined in the beginning of each experiment and kept the same throughout. Donor, acceptor, and FRET thresholds were set to determine the background value. Threshold values were subtracted from all pixels before FRET calculations. Extreme values were excluded from both, the FRET image as well as data table calculation. FRETN images are presented in pseudocolor mode. Acceptor Photobleaching FRET Microscopy—Changes in the intensity of the donor channel were observed upon complete photobleaching the acceptor (YFP) by a 514-nm argon laser (30Berney C. Danuser G. Biophys. J. 2003; 84: 3992-4010Abstract Full Text Full Text PDF PubMed Scopus (540) Google Scholar). During each photobleaching session, we obtained an image set consisting of time-lapse recordings of donor and acceptor channel intensities. FRET was recorded by examining the quenching of CFP during YFP photobleaching. FRET images were analyzed by the LSM FRET tool version 1.5 (AIM software release 3.2) to calculate the FRET efficiencies using selected area averages for donor CFP before and after bleaching: FRETEfficiency = (donor CFPafter bleaching - donor CFPbefore bleaching)/donor CFPafter bleaching. Thresholds were set for donor (CFP), acceptor (YFP), and FRET images at the beginning of data collection and the threshold was kept the same for the entire data analysis. FRET efficiencies (%) are presented as mean ± S.E. from 3 to 10 separate acquisition experiments on 5-10 images per experiment. Effect of Disrupting AKAP-PKA Interactions on the Recycling of the Biotinylated β1-AR in Neuronal Cells—β1-AR recycling in human neuroepithelioma SK-N-MC cells and in neonatal rat cortical neurons was measured by the loss of internalized biotinylated β1-AR. In this assay, the cells were incubated with 50 μm st-Ht31 or st-Ht-31-pro for 30 min at 37 °C to inhibit PKA-AKAP interactions. Then cell surface proteins were biotinylated by incubating the cells in ice-cold Hanks' balanced salt solution supplemented with 1.5 mg/ml of sulfo-NHS-SS-biotin (Pierce Biotechnology) for 20 min, followed by quenching of excess biotinylation reagent with glycine. Biotinylated cells were rewarmed to 37 °C in complete culture medium and exposed to isoproterenol for 30 min at 37 °C to induce the internalization of the β1-AR, followed by chilling of each culture dish on ice to stop membrane trafficking. The remaining surface biotin was quantitatively cleaved with glutathione cleavage buffer (50 mm glutathione in 75 mm NaCl and 10 mm EDTA containing 1% bovine serum albumin and 0.075 n NaOH) twice for 15 min at 4 °C. Cultures were then warmed to 37 °C in complete culture medium containing 10 μm of the β-antagonist alprenolol and 10 μm of each st-Ht31 peptide for 15, 30, and 60 min to allow the internalized β1-AR to recycle back to the cell surface (1Gardner L.A. Delos Santos N.M. Matta S.G. Whitt M.A. Bahouth S.W. J. Biol. Chem. 2004; 279: 21135-21143Abstract Full Text Full Text PDF PubMed Scopus (32) Google Scholar). After each time period, the cells were quickly chilled on ice and incubated for a second time with glutathione cleavage buffer to ensure complete cleavage of any newly appearing (recycled) surface biotin. Then the cells were lysed in radioimmunoprecipitation (RIPA) buffer (150 mm NaCl, 50 mm Tris, pH 8.0, 5 mm EDTA, 1% (v/v) Triton X-100 0.1% SDS, 10 mm NaF, 10 mm Na2-pyrophosphate, and protease inhibitors). Equal amounts of protein from these cells were mixed with 50 μl of bovine serum albumin-blocked ultralink-neutra avidin beads (Pierce Biotechnology) at 4 °C overnight. The resin was collected by centrifugation, washed several times with lysis buffer, and then extracted with 10 μl/100 μg of input protein of 2× Laemmli sample buffer with 40 mm dithiothreitol at 37 °C for 40 min. The supernatant was subjected to electrophoresis on SDS-containing 4-12% gels, transferred to nitrocellulose, and probed with 1:250 dilution of the anti-β1-AR antibody and visualized with horseradish peroxidase-conjugated donkey anti-rabbit IgG (GE Healthcare) using the Super Signal detection reagent (Pier" @default.
• W2085384522 created "2016-06-24" @default.
• W2085384522 creator A5008840086 @default.
• W2085384522 creator A5033799076 @default.
• W2085384522 creator A5063642053 @default.
• W2085384522 creator A5066264199 @default.
• W2085384522 creator A5080499274 @default.
• W2085384522 date "2006-11-01" @default.
• W2085384522 modified "2023-10-14" @default.
• W2085384522 title "AKAP79-mediated Targeting of the Cyclic AMP-dependent Protein Kinase to the β1-Adrenergic Receptor Promotes Recycling and Functional Resensitization of the Receptor" @default.
• W2085384522 cites W1483932465 @default.
• W2085384522 cites W1505363336 @default.
• W2085384522 cites W1507084693 @default.
• W2085384522 cites W1544954412 @default.
• W2085384522 cites W1545502776 @default.
• W2085384522 cites W1573292604 @default.
• W2085384522 cites W1573387643 @default.
• W2085384522 cites W1596299456 @default.
• W2085384522 cites W1606657325 @default.
• W2085384522 cites W1611419331 @default.
• W2085384522 cites W1964330366 @default.
• W2085384522 cites W1980445909 @default.
• W2085384522 cites W1981653194 @default.
• W2085384522 cites W1985826042 @default.
• W2085384522 cites W1995605077 @default.
• W2085384522 cites W1995720011 @default.
• W2085384522 cites W1996880521 @default.
• W2085384522 cites W1997857150 @default.
• W2085384522 cites W1999383552 @default.
• W2085384522 cites W2001668793 @default.
• W2085384522 cites W2008844827 @default.
• W2085384522 cites W2015314915 @default.
• W2085384522 cites W2018146224 @default.
• W2085384522 cites W2021278190 @default.
• W2085384522 cites W2026669832 @default.
• W2085384522 cites W2027436298 @default.
• W2085384522 cites W2038527467 @default.
• W2085384522 cites W2048410843 @default.
• W2085384522 cites W2051699208 @default.
• W2085384522 cites W2053320675 @default.
• W2085384522 cites W2067859370 @default.
• W2085384522 cites W2068924803 @default.
• W2085384522 cites W2072961652 @default.
• W2085384522 cites W2073893214 @default.
• W2085384522 cites W2078148536 @default.
• W2085384522 cites W2092455126 @default.
• W2085384522 cites W2095250075 @default.
• W2085384522 cites W2102417288 @default.
• W2085384522 cites W2102557954 @default.
• W2085384522 cites W2106178916 @default.
• W2085384522 cites W2106434831 @default.
• W2085384522 cites W2116354283 @default.
• W2085384522 cites W2126920991 @default.
• W2085384522 cites W2129218046 @default.
• W2085384522 cites W2129763785 @default.
• W2085384522 cites W2130907973 @default.
• W2085384522 cites W2132740087 @default.
• W2085384522 cites W2137096206 @default.
• W2085384522 cites W2137500801 @default.
• W2085384522 cites W2138354938 @default.
• W2085384522 cites W2143518247 @default.
• W2085384522 cites W2151312020 @default.
• W2085384522 cites W2165685835 @default.
• W2085384522 cites W2165902043 @default.
• W2085384522 cites W2171530560 @default.
• W2085384522 cites W97060682 @default.
• W2085384522 doi "https://doi.org/10.1074/jbc.m601809200" @default.
• W2085384522 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/16940053" @default.
• W2085384522 hasPublicationYear "2006" @default.
• W2085384522 type Work @default.
• W2085384522 sameAs 2085384522 @default.
• W2085384522 citedByCount "75" @default.
• W2085384522 countsByYear W20853845222012 @default.
• W2085384522 countsByYear W20853845222013 @default.
• W2085384522 countsByYear W20853845222014 @default.
• W2085384522 countsByYear W20853845222015 @default.
• W2085384522 countsByYear W20853845222016 @default.
• W2085384522 countsByYear W20853845222017 @default.
• W2085384522 countsByYear W20853845222018 @default.
• W2085384522 countsByYear W20853845222019 @default.
• W2085384522 countsByYear W20853845222021 @default.
• W2085384522 countsByYear W20853845222022 @default.
• W2085384522 countsByYear W20853845222023 @default.
• W2085384522 crossrefType "journal-article" @default.
• W2085384522 hasAuthorship W2085384522A5008840086 @default.
• W2085384522 hasAuthorship W2085384522A5033799076 @default.
• W2085384522 hasAuthorship W2085384522A5063642053 @default.
• W2085384522 hasAuthorship W2085384522A5066264199 @default.
• W2085384522 hasAuthorship W2085384522A5080499274 @default.
• W2085384522 hasBestOaLocation W20853845221 @default.
• W2085384522 hasConcept C170493617 @default.
• W2085384522 hasConcept C184235292 @default.
• W2085384522 hasConcept C185592680 @default.
• W2085384522 hasConcept C40465926 @default.
• W2085384522 hasConcept C55493867 @default.
• W2085384522 hasConcept C86803240 @default.
• W2085384522 hasConcept C95444343 @default.
• W2085384522 hasConcept C97029542 @default.

• next