FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2085718084> ?p ?o ?g. }

• W2085718084 endingPage "30045" @default.
• W2085718084 startingPage "30032" @default.
• W2085718084 abstract "Intracellular levels of the light (L) and heavy (H) ferritin subunits are regulated by iron at the level of message translation via a modulated interaction between the iron regulatory proteins (IRP1 and IRP2) and a 5′-untranslated region. Iron-responsive element (IRE). Here we show that iron and interleukin-1β (IL-1β) act synergistically to increase H- and L-ferritin expression in hepatoma cells. A GC-rich cis-element, the acute box (AB), located downstream of the IRE in the H-ferritin mRNA 5′-untranslated region, conferred a substantial increase in basal and IL-1β-stimulated translation over a similar time course to the induction of endogenous ferritin. A scrambled version of the AB was unresponsive to IL-1. Targeted mutation of the AB altered translation; reverse orientation and a deletion of the AB abolished the wild-type stem-loop structure and abrogated translational enhancement, whereas a conservative structural mutant had little effect. Labeled AB transcripts formed specific complexes with hepatoma cell extracts that contained the poly(C)-binding proteins, iso-αCP1 and -αCP2, which have well defined roles as translation regulators. Iron influx increased the association of αCP1 with ferritin mRNA and decreased the αCP2-ferritin mRNA interaction, whereas IL-1β reduced the association of αCP1 and αCP2 with H-ferritin mRNA. In summary, the H-ferritin mRNA AB is a key cis-acting translation enhancer that augments H-subunit expression in Hep3B and HepG2 hepatoma cells, in concert with the IRE. The regulated association of H-ferritin mRNA with the poly(C)-binding proteins suggests a novel role for these proteins in ferritin translation and iron homeostasis in human liver. Intracellular levels of the light (L) and heavy (H) ferritin subunits are regulated by iron at the level of message translation via a modulated interaction between the iron regulatory proteins (IRP1 and IRP2) and a 5′-untranslated region. Iron-responsive element (IRE). Here we show that iron and interleukin-1β (IL-1β) act synergistically to increase H- and L-ferritin expression in hepatoma cells. A GC-rich cis-element, the acute box (AB), located downstream of the IRE in the H-ferritin mRNA 5′-untranslated region, conferred a substantial increase in basal and IL-1β-stimulated translation over a similar time course to the induction of endogenous ferritin. A scrambled version of the AB was unresponsive to IL-1. Targeted mutation of the AB altered translation; reverse orientation and a deletion of the AB abolished the wild-type stem-loop structure and abrogated translational enhancement, whereas a conservative structural mutant had little effect. Labeled AB transcripts formed specific complexes with hepatoma cell extracts that contained the poly(C)-binding proteins, iso-αCP1 and -αCP2, which have well defined roles as translation regulators. Iron influx increased the association of αCP1 with ferritin mRNA and decreased the αCP2-ferritin mRNA interaction, whereas IL-1β reduced the association of αCP1 and αCP2 with H-ferritin mRNA. In summary, the H-ferritin mRNA AB is a key cis-acting translation enhancer that augments H-subunit expression in Hep3B and HepG2 hepatoma cells, in concert with the IRE. The regulated association of H-ferritin mRNA with the poly(C)-binding proteins suggests a novel role for these proteins in ferritin translation and iron homeostasis in human liver. The mechanisms governing the regulation of ferritin mRNA translation are complex, but their elucidation is critical to understanding iron homeostasis. Iron and oxidative stress are known to modulate the first stage of translation of ferritin mRNAs when the 43 S ribosome subunit attaches to the 5′ cap-specific M7GpppN in the 5′-UTR 1The abbreviations used are: 5′-UTR, 5′-untranslated region; L, light; H, heavy; nt, nucleotide(s); Ab, antibody; AB, ferritin mRNA acute box; AGP, α-1 acid glycoprotein; α1AT, α-1 antitrypsin; CAT, chloramphenicol acetyltransferase; DesF, desferrioxamine; Fe2Tf, iron transferrin; IL-1, interleukin-1; TfR, transferrin receptor; IRP, iron regulatory protein; IRE, iron-responsive element; IRES, internal ribosome entry site; PCBP, poly(C)-binding protein; REMSA, RNA electrophoretic mobility shift assay; RPC, RNA-protein complex; UVXL, UV cross-link assay; Scr, scrambled; Pipes, 1,4-piperazinediethanesulfonic acid; GST, glutathione S-transferase; MES, 4-morpholineethanesulfonic acid; IP, immunoprecipitation; RT, reverse transcription; CAT, chloramphenicol acetyl transferase. 1The abbreviations used are: 5′-UTR, 5′-untranslated region; L, light; H, heavy; nt, nucleotide(s); Ab, antibody; AB, ferritin mRNA acute box; AGP, α-1 acid glycoprotein; α1AT, α-1 antitrypsin; CAT, chloramphenicol acetyltransferase; DesF, desferrioxamine; Fe2Tf, iron transferrin; IL-1, interleukin-1; TfR, transferrin receptor; IRP, iron regulatory protein; IRE, iron-responsive element; IRES, internal ribosome entry site; PCBP, poly(C)-binding protein; REMSA, RNA electrophoretic mobility shift assay; RPC, RNA-protein complex; UVXL, UV cross-link assay; Scr, scrambled; Pipes, 1,4-piperazinediethanesulfonic acid; GST, glutathione S-transferase; MES, 4-morpholineethanesulfonic acid; IP, immunoprecipitation; RT, reverse transcription; CAT, chloramphenicol acetyl transferase. of L- and H-ferritin mRNAs (1Leibold E.A. Munro H.N. Proc. Natl. Acad. Sci. U. S. A. 1988; 85: 2171-2175Crossref PubMed Scopus (552) Google Scholar, 2Thomson A.M. Rogers J.T. Leedman P.J. Int. J. Biochem. Cell Biol. 1999; 31: 1139-1152Crossref PubMed Scopus (181) Google Scholar, 3Fillebeen C. Caltagirone A. Martelli A. Moulis J.M. Pantopoulos K. Biochem. J. 2005; 388: 143-150Crossref PubMed Scopus (22) Google Scholar, 4LaVaute T. Smith S. Cooperman S. Iwai K. Land W. Meyron-Holtz E. Drake S.K. Miller G. Abu-Asab M. Tsokos M. Switzer R. Grinberg A. Love P. Tresser N. Rouault T.A. Nat. Genet. 2001; 27: 209-214Crossref PubMed Scopus (407) Google Scholar). The iron regulatory proteins (IRP1 and IRP2, iso-IRPs) play a central role in regulating ferritin mRNA translation. During conditions of intracellular iron chelation with desferrioxamine (DesF) and oxidative stress, the IRPs bind with higher affinity to the conserved iron-response element (IRE) RNA stem loop 40 nucleotides (nt) downstream of the 5′ cap sites of the L- and H-ferritin mRNAs (1Leibold E.A. Munro H.N. Proc. Natl. Acad. Sci. U. S. A. 1988; 85: 2171-2175Crossref PubMed Scopus (552) Google Scholar). This translational repression event prevents attachment of the small ribosome subunit to the 5′ cap sites of the L- and H-ferritin mRNAs and inhibits ferritin translation (2Thomson A.M. Rogers J.T. Leedman P.J. Int. J. Biochem. Cell Biol. 1999; 31: 1139-1152Crossref PubMed Scopus (181) Google Scholar). In contrast, after iron influx the iso-IRPs are released from the 5′ cap IREs, and ferritin translation is no longer inhibited, increasing the cellular iron storage capacity (2Thomson A.M. Rogers J.T. Leedman P.J. Int. J. Biochem. Cell Biol. 1999; 31: 1139-1152Crossref PubMed Scopus (181) Google Scholar, 3Fillebeen C. Caltagirone A. Martelli A. Moulis J.M. Pantopoulos K. Biochem. J. 2005; 388: 143-150Crossref PubMed Scopus (22) Google Scholar). The IRP2 knock-out mouse, which is characterized by unregulated ferritin mRNA translation and ferritin accumulation in neurons and gut epithelial cells in a gene-dose manner, validated these observations in vivo (4LaVaute T. Smith S. Cooperman S. Iwai K. Land W. Meyron-Holtz E. Drake S.K. Miller G. Abu-Asab M. Tsokos M. Switzer R. Grinberg A. Love P. Tresser N. Rouault T.A. Nat. Genet. 2001; 27: 209-214Crossref PubMed Scopus (407) Google Scholar). Recently zinc and cadmium were reported to interfere with the RNA binding activity of IRP-1, extending the spectrum of IRP binding modulators to these two metal elements (5Martelli A. Moulis J.M. J. Inorg. Biochem. 2004; 98: 1413-1420Crossref PubMed Scopus (39) Google Scholar). Thyroid hormone (T3), which displaces iso-IRPs from the iso-IREs in iron-loaded cells, increases ferritin translation (6Leedman P.J. Stein A.R. Chin W.W. Rogers J.T. J. Biol. Chem. 1996; 271: 12017-12023Abstract Full Text Full Text PDF PubMed Scopus (74) Google Scholar). Other factors also regulate ferritin expression via altered IRP-IRE interactions. These include phorbol esters, endothelial growth factor and thyrotropin-releasing hormones, each of which modulates the phosphorylation status of the iso-IRPs (7Thomson A.M. Rogers J.T. Leedman P.J. J. Biol. Chem. 2000; 275: 31609-31615Abstract Full Text Full Text PDF PubMed Scopus (37) Google Scholar). The thyrotropin-releasing hormone/endothelial growth factor-induced changes in ferritin subunit synthesis were IRP-dependent in one pituitary cell line and IRP-independent in another, suggesting that other sequences within L- and H-ferritin mRNAs contribute to translation regulation (2Thomson A.M. Rogers J.T. Leedman P.J. Int. J. Biochem. Cell Biol. 1999; 31: 1139-1152Crossref PubMed Scopus (181) Google Scholar). IRP-independent ferritin subunit synthesis is also induced in human epidermal A431 cells when they are infected with Neisseria meningitidis (8Bonnah R.A. Muckenthaler M.U. Carlson H. Minana B. Enns C.A. Hentze M.W. So M. Cell. Microbiol. 2004; 6: 473-484Crossref PubMed Scopus (23) Google Scholar). These data indicate that mechanisms other than the IRP-IRE interaction can modulate L- and H-ferritin mRNA translation. Interleukin-1 (IL-1) appears to control the rate of L- and H-ferritin subunit synthesis at the second stage of 43 S ribosome translation scanning, immediately upstream from the start codon before the complete 80 S ribosome translates the open reading frame into protein (9Rogers J.T. Leiter L.M. McPhee J. Cahill C.M. Zhan S.S. Potter H. Nilsson L.N. J. Biol. Chem. 1999; 274: 6421-6431Abstract Full Text Full Text PDF PubMed Scopus (257) Google Scholar, 10Kozak M. Mol. Cell. Biol. 1989; 9: 5134-5142Crossref PubMed Scopus (482) Google Scholar, 11Rogers J.T. Bridges K.R. Durmowicz G.P. Glass J. Auron P.E. Munro H.N. J. Biol. Chem. 1990; 265: 14572-14578Abstract Full Text PDF PubMed Google Scholar). We have shown previously that IL-1β stimulates the rate of L- and H-ferritin subunit translation in both hepatomas (11Rogers J.T. Bridges K.R. Durmowicz G.P. Glass J. Auron P.E. Munro H.N. J. Biol. Chem. 1990; 265: 14572-14578Abstract Full Text PDF PubMed Google Scholar). In particular, IL-1β induced both L- and H-ferritin mRNAs and activated their recruitment to the polyribosome from stored ribonucleoproteins (11Rogers J.T. Bridges K.R. Durmowicz G.P. Glass J. Auron P.E. Munro H.N. J. Biol. Chem. 1990; 265: 14572-14578Abstract Full Text PDF PubMed Google Scholar). A distinct 63-nt G+C-rich RNA sequence 105 nt downstream from the H-ferritin mRNA IRE was found to confer 2–3-fold IL-1β-dependent enhancement of the translation of hybrid H-ferritin-chloramphenicol acetyltransferase (CAT) reporter mRNAs in human HepG2 hepatoma cells (13Rogers J.T. Andriotakis J.L. Lacroix L. Durmowicz G.P. Kasschau K.D. Bridges K.R. Nucleic Acids Res. 1994; 22: 2678-2686Crossref PubMed Scopus (42) Google Scholar). This IL-1β-dependent translation enhancement element encodes a core 25-nt consensus motif (CGCCGCGCAGCCACCGCCGCCGCCG, the acute box (AB)), homologous to sequences encoded in the 5′-UTRs of several hepatic acute phase reactant mRNAs, including α-1 acid glycoprotein (AGP), α-1 antitrypsin (α1AT), and haptoglobin (14Dente L. Ciliberto G. Cortese R. Nucleic Acids Res. 1985; 13: 3941-3952Crossref PubMed Scopus (80) Google Scholar, 15Morrone G. Ciliberto G. Oliviero. S. Arcone R. Dente L. Content J. Cortese R.J. J. Biol. Chem. 1988; 263: 12554-12558Abstract Full Text PDF PubMed Google Scholar). In both hepatoma and endothelial cells, a highly homologous L-ferritin AB also conferred translation enhancement to reporter mRNA (16Rogers J. Blood. 1996; 87: 2525-2537Crossref PubMed Google Scholar). A third transcript containing the AB is the Alzheimer amyloid precursor protein (APP), which confers IL-1β-induced regulation of APP translation (9Rogers J.T. Leiter L.M. McPhee J. Cahill C.M. Zhan S.S. Potter H. Nilsson L.N. J. Biol. Chem. 1999; 274: 6421-6431Abstract Full Text Full Text PDF PubMed Scopus (257) Google Scholar). Based on the fact that repression of upstream IRE-dependent translation by DesF was dominant over the IL-1β-induced stimulation of ferritin translation (9Rogers J.T. Leiter L.M. McPhee J. Cahill C.M. Zhan S.S. Potter H. Nilsson L.N. J. Biol. Chem. 1999; 274: 6421-6431Abstract Full Text Full Text PDF PubMed Scopus (257) Google Scholar), we suggested previously that the AB operated to enhance the 60 S ribosome joining step of ribosome translational scanning of H-ferritin mRNA by the 43 S ribosome according to the Kozak model (10Kozak M. Mol. Cell. Biol. 1989; 9: 5134-5142Crossref PubMed Scopus (482) Google Scholar) rather than providing an internal ribosome entry site (IRES). Current models for ferritin translation only incorporate iron-dependent IRP-1 and IRP-2 binding to the 5′-UTR of H-ferritin mRNA for modulating the interaction with the incoming ribosome and translation initiation factors (12Muckenthaler M. Gray N.K. Hentze M.W. Mol. Cell. 1998; 2: 383-388Abstract Full Text Full Text PDF PubMed Scopus (206) Google Scholar). There are currently no reports identifying other RNA-binding proteins that may selectively interact with the H-ferritin mRNA 5′-UTR via the AB to regulate basal ferritin translation. The poly(C)-binding proteins (PCBPs) are a structurally diverse family, including heterogeneous nuclear ribonucleoprotein K and αCP1–4 (17Makayev A.V. Liebhaber S.A. RNA. 2002; 8: 265-278Crossref PubMed Scopus (338) Google Scholar). They bind mRNA sequences that contain either a single C run (heterogeneous nuclear ribonucleoprotein K) or stretch of C's (αCPs) via their K-homology (KH) domains (18Yeap B.B. Voon D.C. Vivian J.P. McCulloch R.K. Thomson A.M. Giles K.M. Czyzyk-Krzeska M.F. Furneaux H. Wilce M.C. Wilce J.A. Leedman P.J. J. Biol. Chem. 2002; 277: 27183-27192Abstract Full Text Full Text PDF PubMed Scopus (122) Google Scholar). The PCBPs have been implicated in regulation of mRNA stability, translation silencing (mainly through interactions with 3′-UTR sequences), and enhancement. The PCBP family members bind to each other and to other mRNA binding proteins, including AUF-1 (AU-rich element RNA-binding protein) and PABP, which are important in modulating decay of globin mRNAs (19Rodgers N. Wang Z. Kiledjian M. RNA. 2002; 8: 1526-1537PubMed Google Scholar). αCP2 regulates translation of poliovirus mRNA via a specific IRES (20Blyn L.B. Towner J.S. Semler B.L. Ehrenfeld E. J. Virol. 1997; 71: 6243-6246Crossref PubMed Google Scholar, 21Gamarnik A.V. Andino R. Genes Dev. 1998; 12: 2293-2304Crossref PubMed Scopus (400) Google Scholar) and 15 lipoxygenase mRNA translation via a C-rich element in the 3′-UTR (17Makayev A.V. Liebhaber S.A. RNA. 2002; 8: 265-278Crossref PubMed Scopus (338) Google Scholar, 22Ostareck D.H. Ostareck-Lederer A. Shatsky I.N. Hentze M.W. Cell. 2001; 104: 281-290Abstract Full Text Full Text PDF PubMed Scopus (215) Google Scholar). Pertinent to this report, human HepG2 and Hep3B hepatoma cells are reported to contain αCP1 and αCP2 that bind 3′-UTR elements of erythropoietin and tyrosine hydroxylase mRNAs (23Czyzyk-Krzeska M.F. Bendixen A.C. Blood. 1999; 93: 2111-2120Crossref PubMed Google Scholar). To determine the structural and functional characteristics of the AB in the regulation of ferritin translation, we tested the effects of mutations of the AB element on IL-1- and iron-dependent translation in two different human liver cell lines. We found that the predicted shape and sequence of the AB element, independent of the IRE, was critical for maintaining enhanced base-line translation in addition to a IL-1β-induced increase in translation. In a time course the AB responded to IL-1β signals at the same time that endogenous ferritin was induced. Transfections using an H-ferritin promoter and 5′-UTR sequences together with either the wild-type AB or an equivalent length scrambled AB demonstrated that the AB was a novel basal and IL-1-dependent translational enhancer. Furthermore, in RNA gel-shift (RNA electrophoretic mobility shift assay (REMSA)) and UV cross-linking experiments we demonstrated that the H-ferritin mRNA AB cis-element interacts specifically with recombinant αCP1 and that both αCP1 and αCP2 associate with H-ferritin mRNA in vivo. These data provide evidence that the AB is an important contributor to H-ferritin expression in human liver cells, responsible for enhancing both basal and IL-1-mediated translation and also identified the PCBPs (αCP1 and αCP2) as novel H-ferritin mRNA-binding proteins that may act in a coordinate manner with the IRPs to control the overall rate of ferritin translation. Cell Culture—Human hepatoma HepG2 (ATCC HB-8065) and Hep3B (ATCC HB-8064) cells were grown in Dulbecco's minimal essential medium (Invitrogen) supplemented with 10% fetal bovine serum, l-glutamine, essential amino acids, penicillin, and streptomycin (Invitrogen) (7Thomson A.M. Rogers J.T. Leedman P.J. J. Biol. Chem. 2000; 275: 31609-31615Abstract Full Text Full Text PDF PubMed Scopus (37) Google Scholar). Metabolic Labeling and Immunoprecipitation—Cells were incubated in Dulbecco's minimal essential medium with IL-1α, IL-1β, IL-6 (0.5 ng/ml; Invitrogen), iron-transferrin (Fe2Tf) (10 μm), or desferrioxamine mesylate (50 μm DesF) for different time periods. Cells were washed in methionine-deficient media (RPMI 1640, Invitrogen) and then grown in the presence of 25–100 μCi/ml [35S]methionine for 30 min and subsequently washed twice in phosphate-buffered saline at 4 °C. Equal numbers of cells (107 cells) were lysed in 1 ml of lysis buffer (10 mm Tris HCl, pH 8.0, 1% Triton X-100, 0.5% Nonidet P-40, 0.15 m NaCl, 5 mm EDTA, 2 μm phenylmethylsulfonyl fluoride). Total protein synthesis was measured by the amount of lsqb]35S]methionine incorporated into trichloroacetic acid-precipitable material. 20 μg of human ferritin- or α1AT-IgG was added to each sample for immunoprecipitation assay as described previously (9Rogers J.T. Leiter L.M. McPhee J. Cahill C.M. Zhan S.S. Potter H. Nilsson L.N. J. Biol. Chem. 1999; 274: 6421-6431Abstract Full Text Full Text PDF PubMed Scopus (257) Google Scholar). After extensive washing, immunoprecipitated H- and L-ferritin and α1AT (21, 19, and 55 kDa, respectively) were separated by denaturing PAGE (15% polyacrylamide, 6 m urea, 0.1% SDS, 0.1 m sodium phosphate, pH 7.2, gels or on 15% Laemmli-SDS gels) and visualized by autofluorography with Amplify-fluorographic enhancer (Amersham Biosciences) on Kodak XAR-5 film. Densitometric scanning of the autofluorographs was performed with a Bio-Rad model 620 video densitometer. Plasmid Constructs for Transient Transfections—pUC-HFER (a gift from Dr. J. Drysdale, Tufts University School of Medicine, Boston, MA) containing a 454-bp SstI fragment from the H-ferritin gene cloned into pUC12 (9Rogers J.T. Leiter L.M. McPhee J. Cahill C.M. Zhan S.S. Potter H. Nilsson L.N. J. Biol. Chem. 1999; 274: 6421-6431Abstract Full Text Full Text PDF PubMed Scopus (257) Google Scholar, 13Rogers J.T. Andriotakis J.L. Lacroix L. Durmowicz G.P. Kasschau K.D. Bridges K.R. Nucleic Acids Res. 1994; 22: 2678-2686Crossref PubMed Scopus (42) Google Scholar) comprises 162 bp of H-ferritin gene sequence upstream of the 5′-UTR cap site and 292 bp of the first exon including 5′ leader sequences. All subsequent constructs were derived from H-ferritin sequences encoded by pUC-HFER, and their identity was confirmed by double-stranded DNA sequencing to preclude the presence of artificial AUG sites upstream of the CAT initiation codon. HIRECAT contains 302 nt. A SstI-StyI fragment from pUC-HFER ligated into the unique SstI and HincII sites in the polylinker of pUC12CAT (Fig. 1C), directly in front of the CAT start codon. 5′-UTRCAT contains 363 nt. A SstI-DdeI fragment from pUC-HFER ligated into the unique SstI and HincII sites in the polylinker of pUC12CAT (a gift from Dr. W. Chin, Harvard Medical School, Boston, MA) (Fig. 1D). Each transcript derives from the bona fide H-ferritin core promoter. The AB-HIRECAT and Scr-HIRE-CAT constructs were prepared by inserting annealed 63-base oligonucleotide cassettes (acute box (AB) or scrambled (Scr) sequences) into PstI-digested HIRECAT (Fig. 3C). Oligonucleotides were designed to encode a PstI site at the 5′ and 3′ ends (24Milligan J.F. Groebe D.R. Witherell G.W. Uhlenbeck O.C. Nucleic Acids Res. 1987; 15: 8783-8798Crossref PubMed Scopus (1869) Google Scholar, 25Thomson A.M. Rogers J.T. Walker C.E. Staton J.M. Leedman P.J. Biotechniques. 1999; 27: 1032-1039Crossref PubMed Scopus (47) Google Scholar). After annealing, oligos were digested and ligated into PstI-digested HIRECAT. All constructs were sequenced to confirm the correct alignment and incorporation of regulatory domains.Fig. 3The H-ferritin AB mRNA domain confers an increase in basal and IL-1β-dependent CAT reporter mRNA translation. Panel A, time course of CAT reporter expression (enzyme-linked immunosorbent assay) in 5′-UTRCAT transfectants stimulated with and without IL-1α or IL-1β (0.5 ng/ml) for 2, 6, and 24 h. Panel B, the relative effect of IL-1β and iron (Fe2Tf) on CAT gene expression in HIRECAT and 5′-UTRCAT transfectants with and without IL-1β (0.5 ng/ml) or Fe2Tf (10 μm) for 24 h. Error bars, S.D.; n = 3. Panel C, AB-HIRECAT with a 63-bp wild-type AB DNA cassette ligated into the 5′-UTR PstI site of HIRECAT. Scr-HIRECAT with a 63-bp Scr acute box cassette ligated into the 5′-UTR PstI site of HIRECAT. Panel D, CAT reporter expression (enzyme-linked immunosorbent assay) in AB-HIRECAT (black bars) relative to Scr-HIRECAT (gray bars) in HepG2 transfectants incubated for 16 h with either no ligand (i), IL-1α (ii), IL-1β (iii), IL-6 (iv), Fe-Tf (v), or DesF (vi). Error bars, S.E.; n = 6. Panel E, 2° structure prediction plot of AB-HIRECAT where b is the 5′ end of the AB insert, and e is the 3′ end of the AB insert; *, 5′ end of the entire sequence. Panel F, 2° structure prediction plot of Scr-HIRECAT where b is the 5′ end of the Scr insert, and e is the 3′ end of the Scr insert; *, 5′ end of the entire sequence. CAP, chloramphenicol.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Fig. 3The H-ferritin AB mRNA domain confers an increase in basal and IL-1β-dependent CAT reporter mRNA translation. Panel A, time course of CAT reporter expression (enzyme-linked immunosorbent assay) in 5′-UTRCAT transfectants stimulated with and without IL-1α or IL-1β (0.5 ng/ml) for 2, 6, and 24 h. Panel B, the relative effect of IL-1β and iron (Fe2Tf) on CAT gene expression in HIRECAT and 5′-UTRCAT transfectants with and without IL-1β (0.5 ng/ml) or Fe2Tf (10 μm) for 24 h. Error bars, S.D.; n = 3. Panel C, AB-HIRECAT with a 63-bp wild-type AB DNA cassette ligated into the 5′-UTR PstI site of HIRECAT. Scr-HIRECAT with a 63-bp Scr acute box cassette ligated into the 5′-UTR PstI site of HIRECAT. Panel D, CAT reporter expression (enzyme-linked immunosorbent assay) in AB-HIRECAT (black bars) relative to Scr-HIRECAT (gray bars) in HepG2 transfectants incubated for 16 h with either no ligand (i), IL-1α (ii), IL-1β (iii), IL-6 (iv), Fe-Tf (v), or DesF (vi). Error bars, S.E.; n = 6. Panel E, 2° structure prediction plot of AB-HIRECAT where b is the 5′ end of the AB insert, and e is the 3′ end of the AB insert; *, 5′ end of the entire sequence. Panel F, 2° structure prediction plot of Scr-HIRECAT where b is the 5′ end of the Scr insert, and e is the 3′ end of the Scr insert; *, 5′ end of the entire sequence. CAP, chloramphenicol.View Large Image Figure ViewerDownload Hi-res image Download (PPT) To prepare pSV2CAT-derived constructs, pSV2(Ac)CAT and pSV2(rev)CAT were prepared by ligating the 63 bp of StyI-DdeI fragment from the 5′-UTR of the H-ferritin mRNA (previously 5′ end filled by Klenow polymerase) (Fig. 1, A and B) into a unique StuI site of pSV2CAT, residing 42 nt downstream of the SV40 early T-antigen promoter and 43 nt upstream of the CAT gene start codon (Fig. 1B). pSV2(Mc)CAT and pSV2(Δ3)CAT contain PCR-mutated versions of the 63-bp StyI-DdeI fragment from the 5′-UTR of the H-ferritin mRNA inserted in the StuI site of pSV2CAT (Fig. 1, A and B). pRSVLuc is as described (9Rogers J.T. Leiter L.M. McPhee J. Cahill C.M. Zhan S.S. Potter H. Nilsson L.N. J. Biol. Chem. 1999; 274: 6421-6431Abstract Full Text Full Text PDF PubMed Scopus (257) Google Scholar). Transient Transfections—HepG2 and Hep3B hepatoma cells (107 cells) were transiently transfected with 10 μg of each H-ferritin 5′-UTR-derived construct and 5 μg of pRSVLuc as a control using either calcium phosphate-precipitated DNA (13Rogers J.T. Andriotakis J.L. Lacroix L. Durmowicz G.P. Kasschau K.D. Bridges K.R. Nucleic Acids Res. 1994; 22: 2678-2686Crossref PubMed Scopus (42) Google Scholar, 20Blyn L.B. Towner J.S. Semler B.L. Ehrenfeld E. J. Virol. 1997; 71: 6243-6246Crossref PubMed Google Scholar) or by Lipofectamine (Invitrogen) according to manufacturer's recommendations (9Rogers J.T. Leiter L.M. McPhee J. Cahill C.M. Zhan S.S. Potter H. Nilsson L.N. J. Biol. Chem. 1999; 274: 6421-6431Abstract Full Text Full Text PDF PubMed Scopus (257) Google Scholar). After transfection cells were passaged to equal density into 10-cm2 flasks before exposure of the cells to iron (2.5 μm Fe2Tf) and/or cytokines (IL-1α, IL-1β, IL-6; 1 ng/ml). Lysates were prepared by harvesting cells in 500 μl of lysis buffer (125 mm Tris-HCl, pH 7.6, 0.5% Triton) followed by 3 rounds of freezing and thawing. CAT and Luciferase (Luc) Enzyme Assays—The level of CAT expression was determined in cells that had been stimulated with iron and/or IL-1β at various times. CAT assays were performed as described (13Rogers J.T. Andriotakis J.L. Lacroix L. Durmowicz G.P. Kasschau K.D. Bridges K.R. Nucleic Acids Res. 1994; 22: 2678-2686Crossref PubMed Scopus (42) Google Scholar) on lysates from HepG2 and Hep3B transient transfections using a liquid scintillation counting assay. To validate the data, CAT assays were also performed with thin layer chromatography (13Rogers J.T. Andriotakis J.L. Lacroix L. Durmowicz G.P. Kasschau K.D. Bridges K.R. Nucleic Acids Res. 1994; 22: 2678-2686Crossref PubMed Scopus (42) Google Scholar) and quantified using a Betagen scanner (Betagen Corp., Waltham, MA). As a transfection control, each cell lysate (150 μl) was also assayed in duplicate for luciferase activity using a luminometer and luciferin (Analytical Luminescence Laboratory, San Diego, CA) according to the manufacturer's instructions. CAT enzyme-linked immunosorbent assay assays were also performed according to manufacturer's instructions (Roche Applied Science). Briefly, cells were lysed in Roche reporter gene lysis buffer after washing in phosphate-buffered saline. Cleared lysate (200 μl) was incubated in anti-CAT microplates (37 °C, 60 min) followed by the addition of anti-CAT-digoxigenin (200 μl, 37 °C, 60 min) and anti-digoxigenin-peroxidase (200 μl, 37 °C, 60 min). Samples were analyzed by absorbance at 405 nm, where CAT concentration was determined against a known concentration CAT standard curve and normalized with respect to sample protein concentration determined by Bio-Rad protein assay. Ferritin and CAT mRNA Detection by Slot-blotting and RNase Protection—Transfected HepG2 and Hep3B cells (107) were treated with IL-1β (1 ng/ml), Fe2Tf (5 μm) or DesF (100 μm), RNA extracted using the guanidinium-HCl purification method (9Rogers J.T. Leiter L.M. McPhee J. Cahill C.M. Zhan S.S. Potter H. Nilsson L.N. J. Biol. Chem. 1999; 274: 6421-6431Abstract Full Text Full Text PDF PubMed Scopus (257) Google Scholar, 11Rogers J.T. Bridges K.R. Durmowicz G.P. Glass J. Auron P.E. Munro H.N. J. Biol. Chem. 1990; 265: 14572-14578Abstract Full Text PDF PubMed Google Scholar), DNase I (10 μg/ml) treated for 30 min at 37 °C, and slot-blotting was performed after denaturing the RNA (20 μg) for 15 min at 65 °C in formaldehyde solution (6.15 m formaldehyde, 0.15 m sodium citrate, 1.5 m NaCl). RNA was applied to slots aligned on nitrocellulose membranes. A 1.635-kilobase HindIII-BamHI fragment coding for the CAT gene from pSV2CAT was random-primed-labeled (specific activity = 2 × 108 cpm/μg) and used as hybridization probes. Overnight hybridization and washing conditions of the filters was as described previously (9Rogers J.T. Leiter L.M. McPhee J. Cahill C.M. Zhan S.S. Potter H. Nilsson L.N. J. Biol. Chem. 1999; 274: 6421-6431Abstract Full Text Full Text PDF PubMed Scopus (257) Google Scholar). The CAT gene probe, which specifically hybridized to each RNA slot, was quantified by either (i) directly counting each excised slot in a scintillation counter or (ii) comparative densitometry with known denatured pSV2CAT DNA standards (0.01–1 ng) (2Thomson A.M. Rogers J.T. Leedman P.J. Int. J. Biochem. Cell Biol. 1999; 31: 1139-1152Crossref PubMed Scopus (181) Google Scholar). RNase protection assays were performed after T7 polymerase transcription of a 261 nt. 32P-Labeled cRNA from HindIII digested DNA isolated from the CAT gene subclone, pBSCAT. The 32P-labeled CAT cRNA (1 × 108 cpm) was hybridized with total HepG2 RNA (20 μg) in hybridization buffer (80% formamide, 40 mm Pipes. pH 6.7, 0.4 m NaCl, 1 mm EDTA) for 16 h at 45 °C. RNase A (40 μg/ml) and RNase T1 (2 μg/ml) were added, and protected cRNAs and kinase 32P-labeled HaeIII-digested ϕX174 DNA standards were separated by denaturing PAGE (6% polya" @default.
• W2085718084 created "2016-06-24" @default.
• W2085718084 creator A5006704669 @default.
• W2085718084 creator A5008045674 @default.
• W2085718084 creator A5014064967 @default.
• W2085718084 creator A5018507516 @default.
• W2085718084 creator A5024758612 @default.
• W2085718084 creator A5028716880 @default.
• W2085718084 creator A5033014045 @default.
• W2085718084 creator A5038511734 @default.
• W2085718084 date "2005-08-01" @default.
• W2085718084 modified "2023-10-03" @default.
• W2085718084 title "The Acute Box cis-Element in Human Heavy Ferritin mRNA 5′-Untranslated Region Is a Unique Translation Enhancer That Binds Poly(C)-binding Proteins" @default.
• W2085718084 cites W1488522827 @default.
• W2085718084 cites W1516205541 @default.
• W2085718084 cites W1530657831 @default.
• W2085718084 cites W1532211556 @default.
• W2085718084 cites W1578612512 @default.
• W2085718084 cites W1580269759 @default.
• W2085718084 cites W1589258242 @default.
• W2085718084 cites W1621595817 @default.
• W2085718084 cites W1967891590 @default.
• W2085718084 cites W1972537129 @default.
• W2085718084 cites W1977629626 @default.
• W2085718084 cites W1977929928 @default.
• W2085718084 cites W1984002397 @default.
• W2085718084 cites W1992558849 @default.
• W2085718084 cites W1994484797 @default.
• W2085718084 cites W2010029146 @default.
• W2085718084 cites W2010100852 @default.
• W2085718084 cites W2015083014 @default.
• W2085718084 cites W2020721543 @default.
• W2085718084 cites W2025503583 @default.
• W2085718084 cites W2026789634 @default.
• W2085718084 cites W2032099427 @default.
• W2085718084 cites W2034734617 @default.
• W2085718084 cites W2047262638 @default.
• W2085718084 cites W2057893650 @default.
• W2085718084 cites W2063325494 @default.
• W2085718084 cites W2068063980 @default.
• W2085718084 cites W2078300727 @default.
• W2085718084 cites W2084419608 @default.
• W2085718084 cites W2084432680 @default.
• W2085718084 cites W2085272777 @default.
• W2085718084 cites W2085663294 @default.
• W2085718084 cites W2085866164 @default.
• W2085718084 cites W2088833988 @default.
• W2085718084 cites W2094813328 @default.
• W2085718084 cites W2098270395 @default.
• W2085718084 cites W2099378833 @default.
• W2085718084 cites W2101298446 @default.
• W2085718084 cites W2102064340 @default.
• W2085718084 cites W2113207544 @default.
• W2085718084 cites W2114130204 @default.
• W2085718084 cites W2115018128 @default.
• W2085718084 cites W2115110586 @default.
• W2085718084 cites W2117843359 @default.
• W2085718084 cites W2126177402 @default.
• W2085718084 cites W2137319242 @default.
• W2085718084 cites W2141150496 @default.
• W2085718084 cites W2141157874 @default.
• W2085718084 cites W2142282262 @default.
• W2085718084 cites W2143798060 @default.
• W2085718084 cites W2149650428 @default.
• W2085718084 cites W2150943197 @default.
• W2085718084 cites W2157000129 @default.
• W2085718084 cites W2164345271 @default.
• W2085718084 cites W2166064969 @default.
• W2085718084 cites W2444353434 @default.
• W2085718084 cites W4297791699 @default.
• W2085718084 doi "https://doi.org/10.1074/jbc.m502951200" @default.
• W2085718084 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/15967798" @default.
• W2085718084 hasPublicationYear "2005" @default.
• W2085718084 type Work @default.
• W2085718084 sameAs 2085718084 @default.
• W2085718084 citedByCount "30" @default.
• W2085718084 countsByYear W20857180842012 @default.
• W2085718084 countsByYear W20857180842014 @default.
• W2085718084 countsByYear W20857180842015 @default.
• W2085718084 countsByYear W20857180842016 @default.
• W2085718084 countsByYear W20857180842017 @default.
• W2085718084 countsByYear W20857180842018 @default.
• W2085718084 countsByYear W20857180842020 @default.
• W2085718084 countsByYear W20857180842021 @default.
• W2085718084 crossrefType "journal-article" @default.
• W2085718084 hasAuthorship W2085718084A5006704669 @default.
• W2085718084 hasAuthorship W2085718084A5008045674 @default.
• W2085718084 hasAuthorship W2085718084A5014064967 @default.
• W2085718084 hasAuthorship W2085718084A5018507516 @default.
• W2085718084 hasAuthorship W2085718084A5024758612 @default.
• W2085718084 hasAuthorship W2085718084A5028716880 @default.
• W2085718084 hasAuthorship W2085718084A5033014045 @default.
• W2085718084 hasAuthorship W2085718084A5038511734 @default.
• W2085718084 hasBestOaLocation W20857180841 @default.
• W2085718084 hasConcept C104317684 @default.
• W2085718084 hasConcept C105580179 @default.
• W2085718084 hasConcept C107824862 @default.
• W2085718084 hasConcept C111936080 @default.

• next