FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2086947816> ?p ?o ?g. }

• W2086947816 endingPage "2013" @default.
• W2086947816 startingPage "2009" @default.
• W2086947816 abstract "In the liver, transcription of several genes encoding lipogenic and glycolytic enzymes, in particular the gene for fatty acid synthase (FAS), is known to be stimulated by dietary carbohydrates. The molecular dissection of the FAS promoter pointed out the critical role of an E box motif, located at position −65 with respect to the start site of transcription, in mediating the glucose- and insulin-dependent regulation of the gene. Upstream stimulatory factors (USF1 and USF2) and sterol response element binding protein 1 (SREBP1) were shown to be able to interact in vitro with this E box. However, to date, the relative contributions of USFs and SREBP1 ex vivo remain controversial. To gain insight into the specific roles of these factorsin vivo, we have analyzed the glucose responsiveness of hepatic FAS gene expression in USF1 and USF2 knock-out mice. In both types of mouse lines, defective in either USF1 or USF2, induction of the FAS gene by refeeding a carbohydrate-rich diet was severely delayed, whereas expression of SREBP1 was almost normal and insulin response unchanged. Therefore, USF transactivators, and especially USF1/USF2 heterodimers, seem to be essential to sustain the dietary induction of the FAS gene in the liver. In the liver, transcription of several genes encoding lipogenic and glycolytic enzymes, in particular the gene for fatty acid synthase (FAS), is known to be stimulated by dietary carbohydrates. The molecular dissection of the FAS promoter pointed out the critical role of an E box motif, located at position −65 with respect to the start site of transcription, in mediating the glucose- and insulin-dependent regulation of the gene. Upstream stimulatory factors (USF1 and USF2) and sterol response element binding protein 1 (SREBP1) were shown to be able to interact in vitro with this E box. However, to date, the relative contributions of USFs and SREBP1 ex vivo remain controversial. To gain insight into the specific roles of these factorsin vivo, we have analyzed the glucose responsiveness of hepatic FAS gene expression in USF1 and USF2 knock-out mice. In both types of mouse lines, defective in either USF1 or USF2, induction of the FAS gene by refeeding a carbohydrate-rich diet was severely delayed, whereas expression of SREBP1 was almost normal and insulin response unchanged. Therefore, USF transactivators, and especially USF1/USF2 heterodimers, seem to be essential to sustain the dietary induction of the FAS gene in the liver. fatty acid synthase sterol regulatory element-binding protein basic helix-loop-helix leucine zipper upstream stimulatory factor L-type pyruvate kinase Spot 14 electrophoretic mobility shift assay insulin response sequence glucose/carbohydrates response element. Fatty acid synthase (FAS)1 plays a central role in de novo lipogenesis in mammals, catalyzing all reaction steps in the conversion of acetyl-CoA and malonyl-CoA to palmitate. As for many other lipogenic and glycolytic genes involved in maintenance of energy balance, the expression of the FAS gene is highly dependent on nutritional conditions in liver and adipose tissue. Expression of the gene is barely detectable in starved animals and is stimulated by refeeding a high carbohydrate, fat-free diet (for review see Refs. 1Girard J. Ferre P. Foufelle F. Annu. Rev. Nutr. 1997; 17: 325-352Crossref PubMed Scopus (301) Google Scholarand 2Towle H.C. Kaytor E.N. Shih H.M. Annu. Rev. Nutr. 1997; 17: 405-433Crossref PubMed Scopus (247) Google Scholar). This fasting/refeeding transition is accompanied in vivo by an increased circulating insulin level, and it is often difficult to differentiate the effects of insulin from those of carbohydrate metabolism in mediating the regulation of gene expression. To date, the role of insulin, either direct or indirect, in mediating FAS-activated gene expression, is still disputed. It has been proposed that the effects of insulin could be only indirect (3Semenkovich C.F. Coleman T. Goforth R. J. Biol. Chem. 1993; 268: 6961-6970Abstract Full Text PDF PubMed Google Scholar, 4Prip-Buus C. Perdereau D. Foufelle F. Maury J. Ferre P. Girard J. Eur. J. Biochem. 1995; 230: 309-315Crossref PubMed Scopus (88) Google Scholar, 5Mourrieras F. Foufelle F. Foretz M. Morin J. Bouche S. Ferre P. Biochem. J. 1997; 326: 345-349Crossref PubMed Scopus (68) Google Scholar), being permissive to allow for effective glucose metabolism (1Girard J. Ferre P. Foufelle F. Annu. Rev. Nutr. 1997; 17: 325-352Crossref PubMed Scopus (301) Google Scholar). In contrast, others have provided evidence for a direct involvement of insulin bothex vivo (6Wolf S.S. Hofer G. Beck K.F. Roder K. Schweizer M. Biochem. Biophys. Res. Commun. 1994; 203: 943-950Crossref PubMed Scopus (30) Google Scholar) and in vivo (7Katsurada A. Iritani N. Fukuda H. Matsumura Y. Nishimoto N. Noguchi T. Tanaka T. Eur. J. Biochem. 1990; 190: 427-433Crossref PubMed Scopus (138) Google Scholar). In this respect, Sul and co-workers (8Moustaid N. Beyer R.S. Sul H.S. J. Biol. Chem. 1994; 269: 5629-5634Abstract Full Text PDF PubMed Google Scholar) reported, by transfection experiments, that the region between −71/−50 was responsible for mediating the effects of insulin on the rat FAS promoter (see Fig.1). They further demonstrated that upstream stimulatory factors (USFs), USF1 and USF2, were major components of the complex binding to this region (called IRS for insulin response sequence) (9Wang D. Sul H.S. J. Biol. Chem. 1995; 270: 28716-28722Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar). USFs are ubiquitous basic helix-loop-helix-leucine zipper (b-HLH-Zip) transcription factors able to interact as homo- and/or heterodimers on E boxes of CANNTG sequence (for review see Ref. 10Littlewood T.D. Evan G.I. Protein Profile. 1995; 2: 621-702PubMed Google Scholar). The FAS promoter IRS contains such an E box at position −65 (Fig. 1). Mutations impairing binding of USF1 and USF2 to this E box have been demonstrated to abolish the insulin-dependent activation of the FAS promoter (11Wang D. Sul H.S. J. Biol. Chem. 1997; 272: 26367-26374Abstract Full Text Full Text PDF PubMed Scopus (126) Google Scholar). In a recent paper, Kim et al. (12Kim J.B. Sarraf P. Wright M. Yao K.M. Mueller E. Solanes G. Lowell B.B. Spiegelman B.M. J. Clin. Invest. 1998; 101: 1-9Crossref PubMed Scopus (607) Google Scholar) reported data at variance with the data of Wang and Sul (11Wang D. Sul H.S. J. Biol. Chem. 1997; 272: 26367-26374Abstract Full Text Full Text PDF PubMed Scopus (126) Google Scholar), and the authors proposed SREBP1 (sterol response element binding protein 1), instead of USFs, as being the key activator acting through the −65 E box (12Kim J.B. Sarraf P. Wright M. Yao K.M. Mueller E. Solanes G. Lowell B.B. Spiegelman B.M. J. Clin. Invest. 1998; 101: 1-9Crossref PubMed Scopus (607) Google Scholar). As the USFs, SREBPs are b-HLH-Zip transcription factors (for review see Ref. 13Brown M.S. Goldstein J.L. Cell. 1997; 89: 331-340Abstract Full Text Full Text PDF PubMed Scopus (2918) Google Scholar). Two members of this family, encoded by two separate genes, have been characterized so far, SREBP1 and SREBP2 (14Tontonoz P. Kim J.B. Graves R.A. Spiegelman B.M. Mol. Cell. Biol. 1993; 13: 4753-4759Crossref PubMed Scopus (533) Google Scholar, 15Yokoyama C. Wang X. Briggs M.R. Admon A. Wu J. Hua X. Goldstein J.L. Brown M.S. Cell. 1993; 75: 187-197Abstract Full Text PDF PubMed Scopus (776) Google Scholar, 16Hua X. Yokoyama C. Wu J. Briggs M.R. Brown M.S. Goldstein J.L. Wang X. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 11603-11607Crossref PubMed Scopus (497) Google Scholar). Based on in vivo and ex vivo experiments, it is now assumed that SREBP2 is more specifically devoted to the control of genes involved in cholesterol metabolism and SREBP1 in the control of genes involved in fatty acid metabolism (17Sheng Z. Otani H. Brown M.S. Goldstein J.L. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 935-938Crossref PubMed Scopus (275) Google Scholar, 18Kim J.B. Spiegelman B.M. Genes Dev. 1996; 10: 1096-1107Crossref PubMed Scopus (824) Google Scholar, 19Shimano H. Horton J.D. Hammer R.E. Shimomura I. Brown M.S. Goldstein J.L. J. Clin. Invest. 1996; 98: 1575-1584Crossref PubMed Scopus (693) Google Scholar, 20Guan G. Dai P.-H. Osborne T.F. Kim J.B. Shechter I. J. Biol. Chem. 1997; 272: 10295-10302Abstract Full Text Full Text PDF PubMed Scopus (95) Google Scholar). Unlike other members of the b-HLH-Zip family, SREBPs were shown to bind not only to their specific target sites, namely the sterol response elements, but also to canonical E boxes. This unusual ability to bind to two distinct DNA sequences is due to the presence of an atypical tyrosine in the basic DNA-binding domain at a key position that is occupied by an arginine in almost all other b-HLH-Zip proteins (21Kim J.B. Spotts G.D. Halvorsen Y.D. Shih H.M. Ellenberger T. Towle H.C. Spiegelman B.M. Mol. Cell. Biol. 1995; 15: 2582-2588Crossref PubMed Scopus (294) Google Scholar). In an effort to characterize the molecular mechanisms underlying the regulation of gene expression by glucose in the liver, we previously reported the generation of USF1 and USF2 knock-out mice (22Vallet V.S. Henrion A.A. Bucchini D. Casado M. Raymondjean M. Kahn A. Vaulont S. J. Biol. Chem. 1997; 272: 21944-21949Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar, 23Vallet V.S. Casado M. Henrion A.A. Bucchini D. Raymondjean M. Kahn A. Vaulont S. J. Biol. Chem. 1998; 273: 20175-20179Abstract Full Text Full Text PDF PubMed Scopus (115) Google Scholar). To gain insight into the respective roles of USFs and SREBPs in the regulation of FAS gene expression by glucose and insulin, we have investigated the glucose responsiveness of FAS in USF1 and USF2 knock-out mice. In this paper, we demonstrate that USFs are essential components binding to the −65 E box of the FAS promoter and required for a normal transcriptional response of the FAS gene to dietary carbohydrates in vivo. In addition, we provide evidence that this response is likely dependent on the presence of USF1/USF2 heterodimers, USF1 and USF2 homodimers being insufficient to promote a rapid response of the FAS gene to dietary glucose. USF1- and USF2-deficient mice were generated by gene targeting as described previously (22Vallet V.S. Henrion A.A. Bucchini D. Casado M. Raymondjean M. Kahn A. Vaulont S. J. Biol. Chem. 1997; 272: 21944-21949Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar, 23Vallet V.S. Casado M. Henrion A.A. Bucchini D. Raymondjean M. Kahn A. Vaulont S. J. Biol. Chem. 1998; 273: 20175-20179Abstract Full Text Full Text PDF PubMed Scopus (115) Google Scholar). To generate the double heterozygous USF1+/− USF2+/− mice, USF1+/− mice were bred with USF2+/− mice as previously reported (23Vallet V.S. Casado M. Henrion A.A. Bucchini D. Raymondjean M. Kahn A. Vaulont S. J. Biol. Chem. 1998; 273: 20175-20179Abstract Full Text Full Text PDF PubMed Scopus (115) Google Scholar). For metabolic studies, animals were fed a high carbohydrate diet for 18 h after a 24-h fast. Mice were sacrificed between 10 and 12 a.m., and tissue samples were stored at −80 °C. Blood samples were collected from the orbital sinus. Serum insulin levels were determined using an insulin radioimmunoassay kit (Behring Diagnostics) with human insulin as standard. Total RNA was purified by a modified guanidium chloride procedure, and Northern blot analysis was conducted as described previously (24Cuif M.H. Cognet M. Boquet D. Tremp G. Kahn A. Vaulont S. Mol. Cell. Biol. 1992; 12: 4852-4861Crossref PubMed Scopus (43) Google Scholar). FAS (25Coupe C. Perdereau D. Ferre P. Hitier Y. Narkewicz M. Girard J. Am. J. Physiol. 1990; 258: E126-E133PubMed Google Scholar) and SREBP1 (26Moriizumi S. Gourdon L. Lefrançois-Martinez A.M. Kahn A. Raymondjean M. Gene Expr. 1998; 7: 103-113PubMed Google Scholar) cDNA probes were radiolabeled with [α-32P]dCTP using the High Prime system (Boehringer Mannheim). Each Northern blot was stripped and reprobed with a ribosomal 18 S cDNA to check for the integrity and the amount of loaded RNAs. The amount of specific mRNA was quantified using a PhosphorImager (Molecular Dynamics). Nuclear and whole cell extracts were prepared according to Viollet et al. (27Viollet B. Lefrancois-Martinez A.-M. Henrion A. Kahn A. Raymondjean M. Martinez A. J. Biol. Chem. 1996; 271: 1405-1415Abstract Full Text Full Text PDF PubMed Scopus (181) Google Scholar) and Valletet al. (22Vallet V.S. Henrion A.A. Bucchini D. Casado M. Raymondjean M. Kahn A. Vaulont S. J. Biol. Chem. 1997; 272: 21944-21949Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar), respectively. Western blot analyses were performed with 15 μg of nuclear extracts or 60 μg of whole cell extracts using SREBP1 antibody (K-10, Santa Cruz Biotechnology) at a 1:100 dilution. To ensure comparable loading of the samples, blots performed with whole cell extracts were incubated with anti-annexin V antibody, and those performed with nuclear extracts were incubated with USF1-specific peptide antibody (Santa Cruz Biotechnology) or affinity-purified USF2 1–49 antibodies. For electrophoretic mobility shift assays (EMSA), the DNA-binding reaction was performed as described previously (27Viollet B. Lefrancois-Martinez A.-M. Henrion A. Kahn A. Raymondjean M. Martinez A. J. Biol. Chem. 1996; 271: 1405-1415Abstract Full Text Full Text PDF PubMed Scopus (181) Google Scholar) in the presence of either 5 μg of rat liver nuclear extracts or 30 μg of whole cell extracts, 2.5 μg of poly(dI-dC), and 0.1–0.5 ng of end-labeled double-stranded oligonucleotide corresponding to the −65 E box of the FAS promoter (−75 to −52, 5′ GCTGTCAGCCCATGTGGCGTGGCC). For supershift experiments, USF1 and USF2 antibodies were included in the binding reactions (27Viollet B. Lefrancois-Martinez A.-M. Henrion A. Kahn A. Raymondjean M. Martinez A. J. Biol. Chem. 1996; 271: 1405-1415Abstract Full Text Full Text PDF PubMed Scopus (181) Google Scholar). Statistical analysis was performed by the Student's t test for unpaired data using the StatView software. The significance has been considered at *p < 0.05, **p < 0.01, or ***p < 0.001. To determine the impact of USF1 and USF2 deficiency on glucose responsiveness of FAS gene expression, a series of metabolic analyses were performed on either wild type, USF1−/−, or USF2−/− mice. After a 24-h fast, mice were refed a high carbohydrate diet for 18 h. Total liver RNA was purified and analyzed by Northern blot to estimate the content of FAS mRNA (Fig. 2 A). Quantification of this analysis (Fig. 2 B) revealed that the amount of FAS mRNA was dramatically reduced, to 23% in the liver of USF1−/− mice and to 21% in the liver of USF2−/− mice, as compared with wild type mice. This reduction in the abundance of FAS mRNA was specific to the fasted/refed transition. Indeed, inad libitum fed mice or in mice fed a high carbohydrate diet for 5 days, the amount of FAS mRNA was not significantly altered (data not shown). In addition, this reduction was not due to altered circulating insulin level in USFs-deficient mice. Insulin level was indeed found to be similar between USF1−/− and wild type mice (34.64 ± 15.44 (n = 8) and 32.20 ± 13.78 (n = 11) micro-UI/ml insulin for wild type and USF1 −/− groups, respectively), and between USF2−/− and wild type mice (22Vallet V.S. Henrion A.A. Bucchini D. Casado M. Raymondjean M. Kahn A. Vaulont S. J. Biol. Chem. 1997; 272: 21944-21949Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar). Finally, glucose uptake and its utilization by the liver of USF-deficient mice were previously shown to be normal (22Vallet V.S. Henrion A.A. Bucchini D. Casado M. Raymondjean M. Kahn A. Vaulont S. J. Biol. Chem. 1997; 272: 21944-21949Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar, 23Vallet V.S. Casado M. Henrion A.A. Bucchini D. Raymondjean M. Kahn A. Vaulont S. J. Biol. Chem. 1998; 273: 20175-20179Abstract Full Text Full Text PDF PubMed Scopus (115) Google Scholar). Taken together, these results indicate that USF1 and USF2 are likely to be specifically and directly involved in the dietary carbohydrate-dependent activation of FAS gene expression. To determine the nature of USF complexes binding to the specific −65 E box of the FAS gene promoter, EMSA were performed with rat liver nuclear extracts. USF binding activity on this specific E box was shown to be similar to the USF binding activity previously reported on a canonical E box (27Viollet B. Lefrancois-Martinez A.-M. Henrion A. Kahn A. Raymondjean M. Martinez A. J. Biol. Chem. 1996; 271: 1405-1415Abstract Full Text Full Text PDF PubMed Scopus (181) Google Scholar). Indeed, as presented in Fig.3 A, USF1/USF2 heterodimers were largely predominant, whereas the amount of USF1 and USF2 homodimers, as determined after incubation with anti-USF1 (lane 2) and anti-USF2 (lane 3) antibodies, was very low (i.e. <10% of total USF binding activity). The same band shift experiments were performed with liver cellular extracts from USF1- and USF2-deficient mice. As shown in Fig. 3 B, in USF1-deficient mice, the USF binding activity on the −65 E box of FAS promoter was accounted for by USF2 homodimers; anti-USF1 antibody was without any effect on USF binding activity (lane 2), whereas anti-USF2 antibody fully displaced the complex (lane 3). Exactly the opposite was found in USF2-deficient mice (lanes 4–6), i.e. the USF binding activity was accounted for by USF1 homodimers on the −65 E box of FAS promoter. The incapacity of USF1 homodimers in USF2-deficient mice and USF2 homodimers in USF1-deficient mice to support a normal dietary activation of FAS gene transcription suggests that the heterodimeric species could have a specific role in the regulation of the FAS gene compared with the homodimeric species. This idea is strengthened by the fact that FAS mRNA content was reduced to the same extent in both USF1−/− and USF2−/− mice. Therefore, to address further the question of the specific role of USF1/USF2 heterodimer, we examined FAS gene expression in double heterozygous mice where the USF binding activity, mainly accounted for by the heterodimer, was shown to be reduced to 46% (23Vallet V.S. Casado M. Henrion A.A. Bucchini D. Raymondjean M. Kahn A. Vaulont S. J. Biol. Chem. 1998; 273: 20175-20179Abstract Full Text Full Text PDF PubMed Scopus (115) Google Scholar). We compared by Northern blot analysis the amount of hepatic FAS mRNA in USF1+/− USF2+/− mice and wild type mice refed a high carbohydrate diet for 18 h (Fig.4 A). As shown in Fig.4 B, the amount of FAS mRNA in the liver of double heterozygous mice was reduced to 50% of normal, which is to say about 2-fold less than in homozygous USF1−/− and USF2−/− mice. We can speculate that this better response of the FAS gene in double heterozygous mice compared with homozygous mice reflects the higher efficacy of the USF heterodimers compared with both types of homodimers. Indeed, total residual USF binding activity is reduced to the same extent (i.e. to 40–46% of normal) in the three types of knock-out animals (23Vallet V.S. Casado M. Henrion A.A. Bucchini D. Raymondjean M. Kahn A. Vaulont S. J. Biol. Chem. 1998; 273: 20175-20179Abstract Full Text Full Text PDF PubMed Scopus (115) Google Scholar).Figure 4FAS mRNA content in liver of USF1+/− USF2+/− mice as compared with wild type mice. A,Northern blot analysis in animals fasted for 24 h and refed a carbohydrate-rich diet for 18 h. B, quantitated results are expressed as means ± S.D. of eight USF1+/− USF2+/− mice and seven for wild type mice. The values obtained in USF1+/− USF2+/− mice are statistically different from those in wild type mice (p = 0.0398).View Large Image Figure ViewerDownload Hi-res image Download (PPT) Interestingly, this is the first report enlightening the specific role of USF heterodimer species in nutrient gene regulation. Indeed, for two glucose-regulated genes previously investigated, namelyL-PK and S14 genes, the glucose-dependent gene transcription was reported to be impaired in USF2−/− mice but not in USF1−/− mice, suggesting that, in these latter mice, residual USF2 homodimers are as efficient as the heterodimers to allow for a normal glucose responsiveness ofL-PK and S14 genes (22Vallet V.S. Henrion A.A. Bucchini D. Casado M. Raymondjean M. Kahn A. Vaulont S. J. Biol. Chem. 1997; 272: 21944-21949Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar, 23Vallet V.S. Casado M. Henrion A.A. Bucchini D. Raymondjean M. Kahn A. Vaulont S. J. Biol. Chem. 1998; 273: 20175-20179Abstract Full Text Full Text PDF PubMed Scopus (115) Google Scholar). The differential transactivating properties of USF1 and USF2 dimers in activating different sets of glucose-responsive genes could be functionally achieved through the different nature of USF-binding sites as well as of flanking sequences. Indeed, the L-PK and S14 genes have a regulatory element (termed glucose/carbohydrates response element, GlRE) which presents striking similarities (Fig. 1). It consists of two CACGTG type E box motifs whose precise spacing and orientation are critical to create a functional glucose response element (2Towle H.C. Kaytor E.N. Shih H.M. Annu. Rev. Nutr. 1997; 17: 405-433Crossref PubMed Scopus (247) Google Scholar, 28Diaz-Guerra M.J.M. Bergot M.O. Martinez A. Cuif M.H. Kahn A. Raymondjean M. Mol. Cell. Biol. 1993; 13: 7725-7733Crossref PubMed Scopus (97) Google Scholar). This architecture is not found for the −65 FAS E box which is not palindromic and, therefore, does not obey the criteria reported above for the functional glucose/carbohydrates response elements (Fig. 1). Thus, the requirements of these different types of USF-binding sites for USF isoforms can be different. In addition, binding sites for auxiliary factors have been shown to be essential for the S14 andL-PK GlRE (28Diaz-Guerra M.J.M. Bergot M.O. Martinez A. Cuif M.H. Kahn A. Raymondjean M. Mol. Cell. Biol. 1993; 13: 7725-7733Crossref PubMed Scopus (97) Google Scholar, 29Shih H.-M. Liu Z. Towle H.C. J. Biol. Chem. 1995; 270: 21991-21997Abstract Full Text Full Text PDF PubMed Scopus (180) Google Scholar) and could also be involved in the functional specificity of USF dimers. Finally, it is noteworthy that the role of the −65 FAS E box and of USFs in the dietary response of the FAS gene does not signify that this element is itself the “response element” but that it is required, perhaps with other elements, for this response. Our present study seems to establish the fundamental role of USFs in the response of FAS to dietary glucose. However, following the recent report of Kim et al. (12Kim J.B. Sarraf P. Wright M. Yao K.M. Mueller E. Solanes G. Lowell B.B. Spiegelman B.M. J. Clin. Invest. 1998; 101: 1-9Crossref PubMed Scopus (607) Google Scholar) on the predominant role of SREBP1 in the nutritional control of FAS, it was important to establish whether SREBP1 level was affected in USF1- and USF2-deficient mice. To this end, we measured by Northern blot analysis the amount of SREBP1 mRNA in the liver of USF1−/− and USF2−/− mice as compared with wild type mice. Fig.5, A and B, shows that the amount of SREBP1 mRNA was normal in USF1−/− mice and only slightly reduced (30% decreased) in USF2−/− mice as compared with wild type controls. To regulate gene transcription, SREBP must be post-translationally activated by a proteolytic cascade; the mature NH2-terminal domain of the protein is released from the endothelial reticulum membranes into the cytosol and then rapidly translocated into the nucleus (13Brown M.S. Goldstein J.L. Cell. 1997; 89: 331-340Abstract Full Text Full Text PDF PubMed Scopus (2918) Google Scholar). We therefore analyzed the concentrations of mature SREBP1 in the liver of USF1- and USF2-deficient mice. As shown in the Western blot of Fig.6 A, the amount of mature SREBP1 seemed to be similar in liver cellular extracts from either wild type, USF1-, or USF2-deficient mice, indicating that proteolytic processing of SREBP1 was normal in USF-deficient mice. Furthermore, this mature form of SREBP1 was properly translocated into the nucleus as demonstrated by the similar level of SREBP1 in nuclear extracts from wild type and USF-deficient mice (Fig. 6 B). Taken together, these results demonstrate that the absence of USFs is likely the primary event responsible for the dramatic decrease in FAS gene induction upon carbohydrate refeeding and that a normal level of mature SREBP1, in absence of USFs, is unable to support a proper nutritional activation of FAS gene expression.Figure 6SREBP1 content in liver extracts from either wild type, USF1- or USF2-deficient mice. A, Western blot analysis was performed with 60 μg of liver cellular extracts from animals fasted for 24 h and refed a carbohydrate-rich diet for 18 h (three separate animals in each group) using an anti-SREBP1 peptide antibody. Loading of the samples was checked with an anti-annexin V antibody. B, Western blot analysis was performed as above with 15 μg of nuclear extracts. Loading of the samples was checked with anti-USF1 or anti-USF2 antibodies.View Large Image Figure ViewerDownload Hi-res image Download (PPT) Therefore, our results are in accordance with the data of Wang and Sul (11Wang D. Sul H.S. J. Biol. Chem. 1997; 272: 26367-26374Abstract Full Text Full Text PDF PubMed Scopus (126) Google Scholar) and strongly suggest that USFs are required for the nutrition-dependent activity of the FAS promoter. Of course, these results are not sufficient to rule out the possible involvement of SREBP1. However, Shimano et al. (30Shimano H. Shimomura I. Hammer R.E. Herz J. Goldstein J.L. Brown M.S. Horton J.D. J. Clin. Invest. 1997; 100: 2115-2124Crossref PubMed Scopus (349) Google Scholar) recently reported that in the liver and adipocytes of SREBP1−/− mice, the levels of mRNAs for fatty acid synthesis enzymes, including the FAS mRNA, were normal. Although this could be related to compensatory increase of SREBP2 expression in the liver, this factor was undetectable in adipocytes of SREBP1−/− mice in which the abundance of the FAS mRNA was normal (30Shimano H. Shimomura I. Hammer R.E. Herz J. Goldstein J.L. Brown M.S. Horton J.D. J. Clin. Invest. 1997; 100: 2115-2124Crossref PubMed Scopus (349) Google Scholar). These results are consistent with the idea that, on a physiological point of view, SREBPs play a predominant role in regulating the cholesterol synthesis (through sterol response elements and not E box) and have an auxiliary role only in fatty acid synthesis. In this line, Athanikar and Osborne (31Athanikar J.N. Osborne T.F. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 4935-4940Crossref PubMed Scopus (50) Google Scholar) recently suggested that FAS activation through the −65 E box must occur through more specific regulators of fatty acid metabolism than SREBPs factors to provide the mechanism to regulate independently as well as coordinately the biosynthesis of fatty acids and cholesterol. It is noteworthy that this interpretation of the respective role of USFs and SREBPs in dietary activation of lipogenic genes is not inconsistent with the observation that overproduction of truncated form of SREBP1 in the liver results in constitutive activation of these genes, especially the FAS gene (19Shimano H. Horton J.D. Hammer R.E. Shimomura I. Brown M.S. Goldstein J.L. J. Clin. Invest. 1996; 98: 1575-1584Crossref PubMed Scopus (693) Google Scholar, 32Shimano H. Horton J.D. Shimomura I. Hammer R.E. Brown M.S. Goldstein J.L. J. Clin. Invest. 1997; 99: 846-854Crossref PubMed Scopus (671) Google Scholar). In this case, indeed, it could be that processed SREBP1 in excess constitutively binds to the E box and activates transcription, bypassing the USF-dependent regulation. How USFs manage to regulate the transcriptional response to dietary glucose is not yet fully elucidated. Preliminary results in our laboratory suggest that the transactivating potential of USFs is modulated by a glucose-sensor complex interacting, as USFs, with canonical GlREs. 2D-Q. Lou, M. Tannour, L. Selig, D. Thomas, A. Kahn, and M. Vasseur-Cognet, personal communication. However, whether the FAS gene contains authentic GlREs is not clear. Foufelleet al. (33Foufelle F. Lepetit N. Bosc D. Delzenne N. Morin J. Raymondjean M. Ferre P. Biochem. J. 1995; 308: 521-527Crossref PubMed Scopus (39) Google Scholar) reported an element in the FAS gene first intron with similar properties to known glucose-responsive elements. However, this element was demonstrated to be ineffective in supporting the dietary gene regulation in the natural context (29Shih H.-M. Liu Z. Towle H.C. J. Biol. Chem. 1995; 270: 21991-21997Abstract Full Text Full Text PDF PubMed Scopus (180) Google Scholar) and to be dispensable for in vivo response of a FAS transgene to carbohydrate refeeding (34Soncini M. Yet S.-F. Moon Y. Chun J.-Y. Sul H.S. J. Biol. Chem. 1995; 270: 30339-30343Abstract Full Text Full Text PDF PubMed Scopus (63) Google Scholar). As discussed above, the −65 E box, essential in cell culture for the response to insulin, is not an authentic palindromic GlRE, and its cis-effect has not been verifiedin vivo. Whether this element is really involved in the response to insulin or rather to insulin-dependent increase of the glycolytic flux is also not yet clear. As a matter of fact, the sensitivity of the FAS gene to USF deficiencies suggests that this gene belongs to the class of the glucose-responsive genes, such as the L-PK and S14 genes, rather than to that of the strictly insulin-responsive genes, essentially represented by the glucokinase gene (2Towle H.C. Kaytor E.N. Shih H.M. Annu. Rev. Nutr. 1997; 17: 405-433Crossref PubMed Scopus (247) Google Scholar). Indeed, regulation of the glucokinase gene is normal in USF1 and USF2 knock-out mice (22Vallet V.S. Henrion A.A. Bucchini D. Casado M. Raymondjean M. Kahn A. Vaulont S. J. Biol. Chem. 1997; 272: 21944-21949Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar, 23Vallet V.S. Casado M. Henrion A.A. Bucchini D. Raymondjean M. Kahn A. Vaulont S. J. Biol. Chem. 1998; 273: 20175-20179Abstract Full Text Full Text PDF PubMed Scopus (115) Google Scholar). Further investigations on knock-out mice are needed to firmly establish that the dependence of dietary-regulated genes on USF really permits us to predict which of them are authentic glucose-responsive genes and which are rather regulated by insulin or other glucose-dependent hormones. We thank M. Raymondjean for helpful discussions and advice and for providing the rat SREBP1 probe. Help was kindly supplied by M. Blache." @default.
• W2086947816 created "2016-06-24" @default.
• W2086947816 creator A5049781630 @default.
• W2086947816 creator A5056553233 @default.
• W2086947816 creator A5063569210 @default.
• W2086947816 creator A5007060879 @default.
• W2086947816 date "1999-01-01" @default.
• W2086947816 modified "2023-10-03" @default.
• W2086947816 title "Essential Role in Vivo of Upstream Stimulatory Factors for a Normal Dietary Response of the Fatty Acid Synthase Gene in the Liver" @default.
• W2086947816 cites W1560779962 @default.
• W2086947816 cites W1565402256 @default.
• W2086947816 cites W1572134094 @default.
• W2086947816 cites W1679378351 @default.
• W2086947816 cites W1793348193 @default.
• W2086947816 cites W1973754795 @default.
• W2086947816 cites W1990043097 @default.
• W2086947816 cites W1991480596 @default.
• W2086947816 cites W1992864925 @default.
• W2086947816 cites W1993343317 @default.
• W2086947816 cites W2002575581 @default.
• W2086947816 cites W2003114121 @default.
• W2086947816 cites W2006479619 @default.
• W2086947816 cites W2009094549 @default.
• W2086947816 cites W2009616432 @default.
• W2086947816 cites W2013687936 @default.
• W2086947816 cites W2026512448 @default.
• W2086947816 cites W2027228980 @default.
• W2086947816 cites W2028782957 @default.
• W2086947816 cites W2033692327 @default.
• W2086947816 cites W2039999119 @default.
• W2086947816 cites W2040641918 @default.
• W2086947816 cites W2077971415 @default.
• W2086947816 cites W2078600472 @default.
• W2086947816 cites W2123652234 @default.
• W2086947816 cites W2124615340 @default.
• W2086947816 cites W2157371286 @default.
• W2086947816 cites W2171142773 @default.
• W2086947816 cites W2222417653 @default.
• W2086947816 doi "https://doi.org/10.1074/jbc.274.4.2009" @default.
• W2086947816 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/9890958" @default.
• W2086947816 hasPublicationYear "1999" @default.
• W2086947816 type Work @default.
• W2086947816 sameAs 2086947816 @default.
• W2086947816 citedByCount "131" @default.
• W2086947816 countsByYear W20869478162012 @default.
• W2086947816 countsByYear W20869478162013 @default.
• W2086947816 countsByYear W20869478162014 @default.
• W2086947816 countsByYear W20869478162015 @default.
• W2086947816 countsByYear W20869478162016 @default.
• W2086947816 countsByYear W20869478162017 @default.
• W2086947816 countsByYear W20869478162018 @default.
• W2086947816 countsByYear W20869478162019 @default.
• W2086947816 countsByYear W20869478162020 @default.
• W2086947816 countsByYear W20869478162021 @default.
• W2086947816 countsByYear W20869478162022 @default.
• W2086947816 countsByYear W20869478162023 @default.
• W2086947816 crossrefType "journal-article" @default.
• W2086947816 hasAuthorship W2086947816A5007060879 @default.
• W2086947816 hasAuthorship W2086947816A5049781630 @default.
• W2086947816 hasAuthorship W2086947816A5056553233 @default.
• W2086947816 hasAuthorship W2086947816A5063569210 @default.
• W2086947816 hasBestOaLocation W20869478161 @default.
• W2086947816 hasConcept C104317684 @default.
• W2086947816 hasConcept C112243037 @default.
• W2086947816 hasConcept C185592680 @default.
• W2086947816 hasConcept C191172861 @default.
• W2086947816 hasConcept C207001950 @default.
• W2086947816 hasConcept C31258907 @default.
• W2086947816 hasConcept C41008148 @default.
• W2086947816 hasConcept C48289651 @default.
• W2086947816 hasConcept C54355233 @default.
• W2086947816 hasConcept C55493867 @default.
• W2086947816 hasConcept C86803240 @default.
• W2086947816 hasConceptScore W2086947816C104317684 @default.
• W2086947816 hasConceptScore W2086947816C112243037 @default.
• W2086947816 hasConceptScore W2086947816C185592680 @default.
• W2086947816 hasConceptScore W2086947816C191172861 @default.
• W2086947816 hasConceptScore W2086947816C207001950 @default.
• W2086947816 hasConceptScore W2086947816C31258907 @default.
• W2086947816 hasConceptScore W2086947816C41008148 @default.
• W2086947816 hasConceptScore W2086947816C48289651 @default.
• W2086947816 hasConceptScore W2086947816C54355233 @default.
• W2086947816 hasConceptScore W2086947816C55493867 @default.
• W2086947816 hasConceptScore W2086947816C86803240 @default.
• W2086947816 hasIssue "4" @default.
• W2086947816 hasLocation W20869478161 @default.
• W2086947816 hasOpenAccess W2086947816 @default.
• W2086947816 hasPrimaryLocation W20869478161 @default.
• W2086947816 hasRelatedWork W15116001 @default.
• W2086947816 hasRelatedWork W1945094472 @default.
• W2086947816 hasRelatedWork W1985807901 @default.
• W2086947816 hasRelatedWork W1995629748 @default.
• W2086947816 hasRelatedWork W2028430372 @default.
• W2086947816 hasRelatedWork W2046313741 @default.
• W2086947816 hasRelatedWork W2082572360 @default.
• W2086947816 hasRelatedWork W2121113752 @default.
• W2086947816 hasRelatedWork W2588449752 @default.
• W2086947816 hasRelatedWork W4200459043 @default.

• next