FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2087149948> ?p ?o ?g. }

• W2087149948 endingPage "21285" @default.
• W2087149948 startingPage "21276" @default.
• W2087149948 abstract "Berberine bridge enzyme (BBE) is involved in the transformation of (S)-reticuline to (S)-scoulerine in benzophenanthridine alkaloid biosynthesis of plants. In this report, we describe the high level expression of BBE encoded by the gene from Eschscholzia californica (California poppy) in the methylotrophic yeast Pichia pastoris employing the secretory pathway of the host organism. Using a two-step chromatographic purification protocol, 120 mg of BBE could be obtained from 1 liter of fermentation culture. The purified protein exhibits a turnover number for substrate conversion of 8.2 s-1. The recombinant enzyme is glycosylated and carries a covalently attached FAD cofactor. In addition to the previously known covalent attachment of the 8α-position of the flavin ring system to a histidine (His-104), we could also demonstrate that a covalent linkage between the 6-position and a thiol group of a cysteine residue (Cys-166) is present in BBE. The major evidence for the occurrence of a bi-covalently attached FAD cofactor is provided by N-terminal amino acid sequencing and mass spectrometric analysis of the isolated flavin-containing peptide. Furthermore, it could be shown that anaerobic photoirradiation leads to cleavage of the linkage between the 6-cysteinyl group yielding 6-mercaptoflavin and a peptide with the cysteine residue replaced by alanine due to breakage of the C-S bond. Overall, BBE is shown to exhibit typical flavoprotein oxidase properties as exemplified by the occurrence of an anionic flavin semiquinone species and formation of a flavin N(5)-sulfite adduct. Berberine bridge enzyme (BBE) is involved in the transformation of (S)-reticuline to (S)-scoulerine in benzophenanthridine alkaloid biosynthesis of plants. In this report, we describe the high level expression of BBE encoded by the gene from Eschscholzia californica (California poppy) in the methylotrophic yeast Pichia pastoris employing the secretory pathway of the host organism. Using a two-step chromatographic purification protocol, 120 mg of BBE could be obtained from 1 liter of fermentation culture. The purified protein exhibits a turnover number for substrate conversion of 8.2 s-1. The recombinant enzyme is glycosylated and carries a covalently attached FAD cofactor. In addition to the previously known covalent attachment of the 8α-position of the flavin ring system to a histidine (His-104), we could also demonstrate that a covalent linkage between the 6-position and a thiol group of a cysteine residue (Cys-166) is present in BBE. The major evidence for the occurrence of a bi-covalently attached FAD cofactor is provided by N-terminal amino acid sequencing and mass spectrometric analysis of the isolated flavin-containing peptide. Furthermore, it could be shown that anaerobic photoirradiation leads to cleavage of the linkage between the 6-cysteinyl group yielding 6-mercaptoflavin and a peptide with the cysteine residue replaced by alanine due to breakage of the C-S bond. Overall, BBE is shown to exhibit typical flavoprotein oxidase properties as exemplified by the occurrence of an anionic flavin semiquinone species and formation of a flavin N(5)-sulfite adduct. Many alkaloids possess potentially useful pharmaceutical properties, which have been exploited in traditional medicine for centuries. Among these, benzophenanthridines have an antimicrobial activity that prompted the elucidation of its biosynthesis in plants, most notably the California poppy (Eschscholzia californica), a plant used by American Indians as a traditional medicine (1Cheney R.H. Q. J. Crude Drug Res. 1964; 3: 413-416Crossref Scopus (14) Google Scholar). The biosynthesis of these alkaloids leads from the aromatic amino acid l-tyrosine to a central metabolite, (S)-reticuline, a compound that yields isoquinolines of diverse structure, such as protopine, sanguinarine, and berberine, in a series of enzyme-catalyzed transformations (2). Initially, (S)-reticuline is converted to (S)-scoulerine by berberine bridge enzyme (BBE). 2The abbreviations used are: BBE, berberine bridge enzyme ((S)-reticuline: oxygen oxidoreductase, EC 1.21.3.3); ESI-MS, electrospray ionization mass spectrometry; GOOX, glucooligosaccharide oxidase; PAS, periodic acid-Schiff; CAPS, 3-[cyclohexylamino]-1-propanesulfonic acid; HPLC, high-performance liquid chromatography; MALDI-TOF, matrix-assisted laser desorption ionization time-of-flight; Endo Hf, endoglycosidase Hf. This FAD-dependent oxidase affords the transformation of the N-methyl group of (S)-reticuline into the berberine bridge carbon (C-8) of (S)-scoulerine, shown in Scheme 1. The transformation involves the oxidation of the N-methyl group to the methylene iminium ion with subsequent cyclization to the protoberberine carbon skeleton (3Barton D.H.R. Hesse R.H. Kirby G.W. Proc. Chem. Soc. (London). 1963; 1: 267-268Google Scholar, 4Battersby A.R. Francis R.J. Hirst M. Staunton J. Proc. Chem. Soc. (London). 1963; 268Google Scholar). It has been suggested that the substrate-derived electrons are passed on to the covalently attached FAD cofactor either in two one-electron steps or in a single two-electron reduction step, e.g. via transfer of a hydride (5Kutchan T.M. Dittrich H. J. Biol. Chem. 1995; 270: 24475-24481Abstract Full Text Full Text PDF PubMed Scopus (112) Google Scholar). The reduced cofactor is then regenerated by oxidation with dioxygen to yield oxidized FAD and hydrogen peroxide (see reaction scheme (Scheme 1)). The structural requirements for formation of the berberine bridge are (i) (S)-configuration at C-1 in the N-methyltetrahydrobenzylisoquinoline ring system and (ii) hydroxylation of the carbon ortho- to the 2′-carbon of the benzyl moiety (5). This latter requirement was interpreted as evidence for the involvement of an active site base, which deprotonates the hydroxyl group to facilitate nucleophilic attack of the C-2′ on the methylene iminium ion to generate the carbon-carbon bond (5). BBE was first isolated by Zenk and collaborators (6Steffens P. Nagakura N. Zenk M.H. Phytochemistry. 1985; 24: 2577-2583Crossref Scopus (89) Google Scholar) from plant cell cultures producing only minute amounts of a homogenous protein with a molecular mass of 52 ± 4 kDa in a tedious eight-step purification procedure. The cloning of the gene encoding BBE from the California poppy (E. californica) paved the way for the heterologous expression of the enzyme in Saccharomyces cerevisiae and Spodoptera frugiperda (7Dittrich H. Kutchan T.M. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 9969-9973Crossref PubMed Scopus (233) Google Scholar, 8Kutchan T.M. Dittrich H. Phytochemistry. 1994; 35: 353-360Crossref PubMed Scopus (71) Google Scholar). The latter expression system produced ∼4 mg of active enzyme per liter of insect cell culture, allowing some basic characterization of its substrate specificity and spectroscopic properties (5Kutchan T.M. Dittrich H. J. Biol. Chem. 1995; 270: 24475-24481Abstract Full Text Full Text PDF PubMed Scopus (112) Google Scholar). However, the level of protein expression achieved in this system is clearly not sufficient to warrant a detailed investigation of the biochemical, kinetic, and structural properties of the enzyme. The difficulties of achieving high expression of BBE are highlighted by the fact that the gene possesses an N-terminal signal peptide as well as a vacuolar sorting determinant (7Dittrich H. Kutchan T.M. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 9969-9973Crossref PubMed Scopus (233) Google Scholar, 9Bird D.A. Facchini P.J. Planta. 2001; 213: 888-897Crossref PubMed Scopus (56) Google Scholar). In addition, active enzyme requires covalently bound FAD and is N-glycosylated. Here, we report the construction of a new expression system for BBE in the methylotrophic yeast Pichia pastoris by using the secretory pathway of this organism. This approach yields large amounts of highly active BBE enabling us to study some basic properties of the enzyme. In the course of this characterization, we could demonstrate that the enzyme contains an FAD cofactor, which is covalently linked to a histidine (His-104) and a cysteine (Cys-166) residue, as recently reported for glucooligosaccharide oxidase from Acremonium strictum (10Lee M.-H. Lai W.-L. Lin S.-F. Hsu C.-S. Liaw S.-H. Tsai Y.-C. Appl. Environ. Microbiol. 2005; 71: 8881-8887Crossref PubMed Scopus (37) Google Scholar, 11Huang C.-H. Lai W.-L. Lee M.-H. Chen C.-J. Vasella A. Tsai Y.-C. Liaw S.-H. J. Biol. Chem. 2005; 280: 38831-38838Abstract Full Text Full Text PDF PubMed Scopus (80) Google Scholar). Reagents—All chemicals were of the highest grade commercially available and purchased from either Sigma-Aldrich, Fluka, or Merck. Restriction enzymes were obtained from Fermentas, Endo Hf from New England Biolabs, and phenyl-Sepharose 6 FF (high substitution) was purchased from Amersham Biosciences. (S)-Reticuline and (S)-scoulerine were from the natural product collection of the Department of Natural Product Biotechnology of the Leibniz Institute of Plant Biochemistry, Halle/Saale, Germany. Cloning of E. californica BBE—The coding sequence of BBE from E. californica cloned into pUC18 was used for PCR reactions (7). Two different constructs were generated using PCR with especially designed forward primers in combination with a common reverse primer and pUC18 BBE as template. BBE (forward (5′), AAAGTCGACAAAATGGAAAACAAAACT) and BBE-ER (5′, ACCTCGAGAAAAGAGAGGCTGAAGCTGGTAATGATCTCCTTTCTTGTTTG; shared reverse (3′), CATGCGGCCGCCTATATTACAACTTCTCCACCATC) represent a construct with the native BBE coding sequence and one where the native endoplasmic reticulum-targeting signal sequence was deleted. Both constructs were cloned into pCR® 4Blunt-TOPO® vectors (Invitrogen), and amplification of the correct variant was verified by sequence analysis. For expression analysis in P. pastoris the constructs were cloned into the expression vectors pPICZ B and pPICZα B using EcoRI (present on the vector)/NotI and XhoI/NotI for BBE and BBE-ER, respectively. Transformation into P. pastoris KM71H was carried out as outlined in the EasySelect™ Pichia Expression Kit (Invitrogen) following the protocol for lithium chloride transformation with 5 μg of SacI-linearized DNA. The presence of the expression cassette in the genome of P. pastoris was verified by colony PCR as described in a previous study (12Weis R. Luiten R. Skranc W. Schwab H. Wubbolts M. Glieder A. FEMS Yeast Res. 2004; 5: 179-189Crossref PubMed Scopus (136) Google Scholar). Expression and Purification of BBE—For comparison of expression by the two constructs, single transformants with an integrated BBE coding sequence were used to inoculate 25 ml of buffered minimal dextrose medium in 100-ml shake flasks. Generation of biomass and induction with methanol was carried out essentially as described previously (12Weis R. Luiten R. Skranc W. Schwab H. Wubbolts M. Glieder A. FEMS Yeast Res. 2004; 5: 179-189Crossref PubMed Scopus (136) Google Scholar). After a 100-h induction period, the fermentation supernatant was analyzed by SDS-PAGE, and activity assays for expression of BBE were carried out. Large scale expression of BBE for protein purification was carried out in a BBI CT5-2 fermenter (Sartorius) with a digital control unit using the MFCSwin process control system. Cultivation was conducted with a glycerol batch phase followed by a glycerol-fed batch and after generation of enough biomass protein production was initiated by addition of methanol. The different stages followed the basic outline presented in Pichia Fermentation Process Guidelines (Invitrogen). After 90-h methanol induction, the fermentation was stopped and the cells were separated from the medium by centrifugation. For purification of BBE, ammonium sulfate was added to the supernatant to a final concentration of 0.5 m, and the pH was adjusted to 7.5. After an additional centrifugation step, the resulting solution was then loaded onto a XK50/20 phenyl-Sepharose 6 FF (high substitution) column with a 200-ml bed volume equilibrated with 20 mm potassium phosphate buffer (pH 7.5) containing 0.5 m ammonium sulfate (buffer A). After complete loading and washing with buffer A, BBE was step-eluted by a 80%/20% mixture of 20% ethanol/buffer A. BBE-containing fractions (as determined by activity assays) were pooled and concentrated up to 30 mg/ml using the Centriprep system from Amicon (molecular mass cut-off, 10 kDa). Aliquots of 2 ml from the resulting deeply yellow solution were then loaded onto a HiLoad™ 16/60 Superdex™ 75 prep grade (Amersham Biosciences) gel-filtration column equilibrated with the storage buffer of BBE (150 mm NaCl, 50 mm Tris/HCl, pH 9.0) and eluted at a flow rate of 1 ml/min. Fractions of sufficient purity and BBE concentration (analyzed by SDS-PAGE) were pooled and again concentrated by ultrafiltration as described above. Aliquots of ∼40 μl were stored at -80 °C. Activity Assay—Expression of BBE during fermentation and fractions containing the enzyme during purification were followed by conversion of (S)-reticuline to (S)-scoulerine. Reaction mixtures consisted of 1 μl of sample, 1 μl of 10 mm (S)-reticuline in methanol and 3 μl of 0.1 m Tris/HCl (pH 9.0) and were incubated at 37 °C for 10 min. For visualization of conversion the reaction mixtures were separated on tlc using CH2Cl2/MeOH/25% NH4OH (90/9/1) as the mobile phase and authentic standards for substrate and product as reference. BBE turnover rates were determined by following conversion of (S)-reticuline to (S)-scoulerine by HPLC analysis of the reaction mixture. A 100-μl assay consisted of 98.5 μl of 0.1 m Tris/HCl (pH 9.0), 1 μl of 10 mm (S)-reticuline in methanol, and 0.5 μl of BBE (200 nm) resulting in a final substrate concentration of 100 μm, which is ∼30 times the reported Km value for (S)-reticuline (7). The reaction was incubated at 37 °C, and aliquots of 1 μl were removed at various time points and loaded onto an Atlantis® dC18 column (5 μm, 4.6 × 250 mm, Waters). Substrate and product were separated during an isocratic elution at 67% MeOH/33% 50 mm potassium phosphate buffer, pH 7.0, for 8 min. SDS-PAGE—Protein samples were separated by SDS-PAGE (12.5%) under reducing conditions as described by Laemmli (13Laemmli U.K. Nature. 1970; 227: 680-685Crossref PubMed Scopus (207537) Google Scholar). Gels were stained with either Coomassie Brilliant Blue R or PAS stain to visualize N-glycosylation. PAS Staining—After fixing the SDS gel in 50% MeOH for half an hour, it was washed with ddH2O twice. Oxidation was carried out by immersing the gel in 1% w/v periodic acid in 3% v/v acetic acid for 30 min. After two washing steps with ddH2O, it was stained using Schiff's reagent (Sigma) for 1 h followed by reduction with 0.5% w/v sodium metabisulfite for 1 h. After additional washing steps with water the gel was stored in 5% acetic acid. Deglycosylation—20 μl of BBE (1 mg/ml) was denatured by addition of 2.2 μl of 10× denaturing buffer (0.5% SDS, 1% β-mercaptoethanol) and heating to 95 °C for 10 min. After cooling to 37 °C 2.5 μl of 10× reaction buffer (500 mm sodium citrate, pH 5.5) was added, and deglycosylation was initiated by adding 1 μl of Endo Hf (1000 New England Biolabs units). After overnight incubation in the dark at 37 °C the reaction mixture was separated by SDS-PAGE and stained with Coomassie Brilliant Blue R or PAS stain. Coomassie-stained bands were excised and used for in-gel digestion and subsequent MALDI-TOF MS analysis to identify N-glycosylated residues of BBE. Protease Digestion of BBE and Isolation of the Flavin-linked Peptide by HPLC— 0.5 mg of purified BBE was denatured in the presence of 4 m urea, 50 mm Tris/HCl, 75 mm NaCl, pH 8.5, for 45 min at 65 °C. The denatured sample was then diluted with 50 mm Tris/HCl, 1 mm CaCl2, pH 8.0, to 2 m urea and cooled to 37 °C prior to addition of l-1-tosylamido-2-phenylethyl chloromethyl ketone-treated trypsin (Sigma) at a protease:protein ratio of 1:50 (w/w). The digest was then performed at 37 °C for 4 h in the dark. 100 μg of the digested sample was applied to an analytical C18 column (BioSuite™ C18 PA-B, 300 Å, 3.5 μm, 4.6 × 250 mm, Waters) and eluted at a flow rate of 1 ml/min using a gradient from 100% A (water 0.1% v/v formic acid)/0% B (acetonitrile 0.1% formic acid) to 30% A/70% B in 1 min, then kept constant for 5 min, followed by an increase to 45% A/55% B over 30 min and finally to 100% B in 4 min. The flavin-containing peptide was detected by its characteristic absorption at 440 nm, and the corresponding peak was collected, vacuum-dried, and redissolved in 50 μl of 50% A/50% B for subsequent N-terminal sequencing and MS analysis. UV-visible Spectroscopy and Fluorescence—Absorption spectra were recorded with a Specord 205 spectrophotometer (Analytik Jena) at 25 °C using 1-cm quartz cuvettes. Fluorescence measurements with suitable quartz cuvettes were carried out with a Shimadzu RF-5301 PC using excitation and emission slits of 20 nm and an excitation wavelength of 450 nm. MALDI-TOF MS—A MALDI Micro MX (Waters) time-of-flight instrument was used in reflectron mode with 2.3-m effective flight path for analysis of the proteolytic fragments generated from BBE. In-gel digestion with trypsin was carried out as described previously (14Shevchenko A. Jensen O.N. Podtelejnikov A.V. Sagliocco F. Wilm M. Vorm O. Mortensen P. Shevchenko A. Boucherie H. Mann M. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 14440-14445Crossref PubMed Scopus (1303) Google Scholar), including the prewashing steps for Coomassie-stained gels using sequencing grade modified trypsin (Promega) for overnight digestion. The peptide extracts were then dissolved in 20 μl of 0.1% trifluoroacetic acid, and prior to analysis 1 μl of the sample was mixed with an equivalent amount of α-cyano-4-hydroxy-cinnamic acid (10 mg in 495 μl of ethanol, 495 μl of acetonitrile, and 10 μl of 0.1% trifluoroacetic acid). 1 μl of this mixture was deposited on the stainless steel target plate, and the sample mix was allowed to air dry at ambient temperature. Samples were finally rinsed with 4 μl of ice-cold 0.1% trifluoroacetic acid by pipetting up and down after the analyte solution had dried completely. Anaerobic Photoreduction—Photoreduction of BBE was carried out according to the procedure reported in a previous study (15Massey V. Hemmerich P. Biochemistry. 1978; 17: 9-17Crossref PubMed Scopus (293) Google Scholar). Briefly, special quartz cuvettes were rendered anaerobic by alternating cycles of evacuation and flushing with oxygen-free nitrogen. EDTA and 5-deazariboflavin were stored in the side arm during this process and illuminated for 5 min prior to mixing with the enzyme solution (final concentrations of 1 mm and 1 μm, respectively). Photoirradiation was then carried out with a conventional slide projector and cooling of the cuvette at 15 °C. Spectra monitoring the progress of reduction were recorded at the same temperature. Protein Quantification and Calculation of the Extinction Coefficient—Protein concentration of purified BBE was determined by the characteristic absorption of bound FAD. The extinction coefficient was calculated using the value of 6-S-cysteinyl FMN for denatured BBE (16Kasprzak A. Papas E.J. Steenkamp D.J. Biochem. J. 1983; 211: 535-541Crossref PubMed Scopus (34) Google Scholar). This leads to an ϵ445 of 11,600 m-1 cm-1 for native heterologously expressed BBE. Comparative Modeling—The amino acid sequence of BBE was submitted to the Robetta server (17Chivian D. Kim D.E. Malmstrom L. Bradley P. Robertson T. Murphy P. Strauss C.E. Bonneau R. Rohl C.A. Baker D. Proteins Suppl. 2003; 6: 524-533Crossref Scopus (250) Google Scholar), and a model was generated using glucooligosaccharide oxidase from A. strictum as a template (pdb code: 2AXR). The two proteins share a sequence identity of 21%. The FAD cofactor of the oxidase was combined with the newly generated model of BBE, and the supposed covalent linkages with the protein backbone were introduced using the program SYBYL v7.1 (Tripos Inc., St. Louis, MO). A rough geometry optimization to remove unfavorable contacts between the cofactor and the surrounding amino acids was performed with the same program. N-terminal Sequencing Analysis—Purified BBE was electrophoresed using SDS-PAGE, and the separated proteins were transferred to an Immobilon-P polyvinylidene difluoride membrane (Millipore) using 10 mm CAPS buffer (pH 11, 10% methanol) in a tank transfer system. The transfer was performed at a constant current of 150 mA for 1 h with ice cooling. After transfer, protein was stained with Ponceau-S (0.5% Ponceau-S red, 1% acetic acid) for 1 min, and the band corresponding to BBE was excised. After destaining with ddH2O, the membrane was air-dried and subsequently analyzed by N-terminal sequencing on a 494-HT Procise Edman sequencing system (Applied Biosystems). The same facility was used to sequence the flavin-containing peptide by direct injection of the solution obtained after HPLC purification. ESI Mass Spectrometry—High resolution MS spectra of the HPLC-purified peptide were recorded on a Finnigan LTQ FT instrument (Thermo Electron) in positive-ion ESI mode. Cultures of P. pastoris cells carrying the BBE gene from the California poppy E. californica express and secrete large quantities of the protein upon induction with methanol (Fig. 1A). BBE is the dominant protein in the growth medium with expression reaching a maximum after ∼85 h (Fig. 1A, lane 8). Activity of the expressed protein could be demonstrated by incubation of the substrate (S)-reticuline with growth medium and detection of product ((S)-scoulerine) by tlc as described under “Experimental Procedures.” Semiquantitative analysis of activity indicated a higher expression level of BBE from the construct with the α-factor replacing the native endoplasmic reticulum secretion signal sequence. Therefore, this system was used for the large scale expression of BBE, and all further experiments were carried out with this enzyme. Nevertheless, it should be pointed out that P. pastoris also recognizes the native secretion signal of BBE from E. californica and secretes active enzyme into the fermentation broth (results not shown). BBE can be purified in a convenient and rapid two-step purification procedure leading to a homogenous, and intensely yellow, protein preparation with an estimated molecular mass of ∼62 kDa (Fig. 1B). Without any optimization, the P. pastoris expression system produces ∼120 mg of purified BBE per liter of culture medium and hence ∼30-fold as much as previously achieved in insect cell culture (8). Activity of BBE was monitored by incubation of the enzyme with (S)-reticuline and time-dependent HPLC analysis of the conversion of the substrate to (S)-scoulerine, as shown in Fig. 2. The initial velocity of the reaction allowed estimating a turnover rate of 8.2 s-1, which is in the same range as determined for the enzyme expressed in insect cell culture (=6.8 s-1 (8Kutchan T.M. Dittrich H. Phytochemistry. 1994; 35: 353-360Crossref PubMed Scopus (71) Google Scholar)). To ensure secretion of the protein, BBE is initially expressed as an N-terminal fusion protein with the Saccharomyces cerevisiae α-factor prepro signal sequence, including an EAEA spacer (Ste13 cleavage site), which can help to recognize the Kex2 site at the end of the signal sequence efficiently during processing in the secretory pathway of the host cells (18Zsebo K.M. Lu H.S. Fieschko J.C. Goldstein L. Davis J. Duker K. Suggs S.V. Lai P.H. Bitter G.A. J. Biol. Chem. 1986; 261: 5858-5865Abstract Full Text PDF PubMed Google Scholar). N-terminal sequencing of purified protein showed that the Kex2 cleavage site was recognized and cleaved efficiently but not the Ste13 site, resulting in isolated BBE having four additional amino acids at the N-terminal end and starting with the sequence EAEAGNDLL. Based on the integrated full-length cDNA of BBE, the total length of the protein comprises 519 (including the 4 extra amino acids EAEA) amino acids with a theoretical molecular mass of 58,599 Da (including the covalently attached FAD cofactor). This expected mass is clearly lower than the estimated mass suggested by SDS-PAGE (Fig. 1, A and B). The higher than expected molecular mass of expressed BBE can be explained by assuming a post-translational modification of the protein such as glycosylation. The amino acid sequence of BBE possesses three potential N-glycosylation sites, one at the N terminus (N38) and two at the C terminus (Asn-423 and Asn-471) (7). As shown in Fig. 3, treatment of BBE with Endo Hf leads to cleavage of glycosylation leaving only an N-acetylglucosamine attached to the asparagine residues and reducing the molecular mass of the protein by ∼4 kDa (as visualized by SDS-PAGE). To identify the sites of glycosylation, both recombinantly expressed and Endo Hf-treated BBE were subjected to trypsinolysis and subsequent peptide mapping by MALDI-TOF mass spectrometry. A compilation of resulting peptide masses is shown in Table 1. The peptides identified by their expected masses gave rise to a sequence coverage of 78.4%, clearly identifying the expressed and purified protein as BBE. Fragments containing Asn-423 and Asn-471 could be identified without any modification after in-gel digestion of untreated BBE, thus indicating that these consensus sequences are not used for N-glycosylation. The peptide fragment containing Asn-38 was found in the tryptic digest of endoglycosidase-treated BBE with an additional 203.1 Da resulting from the remaining N-acetylglucosamine attached to the asparagine. Interestingly, the fragment harboring Asn-471 could also be identified with the same modification after Endo Hf treatment. Therefore, it can be concluded that N-glycosylation occurs at Asn-38, partially at Asn-471 but not at Asn-423.TABLE 1MALDI-TOF MS analysis of fragments obtained from trypsin digestion of BBE and Endo Hf-treated BBEExperimental mi massCalculated mi massStartEndSequence% of total sequenceDa%1965.901965.93(-4)37EAEAaNew N terminus due to incomplete processing of the α-factor signal peptide (EAEA) followed by the native sequence of the processed protein (GNDLL...). The numbering of BBE residues equals those published before (7)GNDLLSCbCysteines are carbamidomethylatedLTFNGVR3.31914.991914.833852NcAsparagine residue is glycosylated. Observed mass equals the expected peptide mass + 203.1 Da (N-acetylglucosamine) after Endo Hf treatmentHTVFSADSDSDFNR3.03062.803062.745380FLHLSIQNPLFQNSLISKPSAIILPGSK5.3961.50961.498188EELSNTIR1.7719.40719.389398GSWTIR1.23000.32dBoth peptides involved in covalent attachment of the flavin were detected with signal intensities lower than 5% compared to the strongest signal. Their presence can be attributed to a part of the protein preparation with non-covalently attached FAD (see “Results” and “Discussion”)3000.44101127SGGHSYEGLSYTSDTPFILIDLMNLNR5.23352.393351.60128158VSIDLESETAWVESGSTLGELYYAITESSSK5.82698.21dBoth peptides involved in covalent attachment of the flavin were detected with signal intensities lower than 5% compared to the strongest signal. Their presence can be attributed to a part of the protein preparation with non-covalently attached FAD (see “Results” and “Discussion”)2698.23159185LGFTAGWCbCysteines are carbamidomethylatedPTVGTGGHISGGGFGMMSR4.72372.192372.25187209YGLAADNVVDAILIDANGAILDR4.11422.601422.68210221QAMGEDVFWAIR2.51378.681378.69222235GGGGGVWGAIYAWK2.4621.00621.37245249VTVFR1.11410.721410.76253265NVAIDEATSLLHK2.42612.252612.24266288WQFVAEELEEDFTLSVLGGADEK4.51676.901676.90289302QVWLTMLGFHFGLK2.9968.50968.52371378AFYGLLER1.71766.771766.85382398EPNGFIALNGFGGQMSK3.11303.601303.64399409ISSDFTPFPHR2.31837.901837.92414428LMVEYIVAWNePeptide can be identified without a post-translational modification at the N-glycosylation consensusQSEQK3.21180.601180.59431439TEFLDWLEK2.01374.671374.71440450VYEFMKPFVSK2.42099.112099.06454472LGYVNHIDLDLGGIDWGNfAmbiguous results concerning glycosylation of this asparagine residue did not allow a definite statement of glycosylation statusK3.61215.601215.67473483TVVNNAIEISR2.11637.701637.72484496SWGESYFLSNYER2.83014.263014.47502527TLIDPNNVFNHPQSIPPMANFDYLEK5.2Σ = 78.4a New N terminus due to incomplete processing of the α-factor signal peptide (EAEA) followed by the native sequence of the processed protein (GNDLL...). The numbering of BBE residues equals those published before (7Dittrich H. Kutchan T.M. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 9969-9973Crossref PubMed Scopus (233) Google Scholar)b Cysteines are carbamidomethylatedc Asparagine residue is glycosylated. Observed mass equals the expected peptide mass + 203.1 Da (N-acetylglucosamine) after Endo Hf treatmentd Both peptides involved in covalent attachment of the flavin were detected with signal intensities lower than 5% compared to the strongest signal. Their presence can be attributed to a part of the protein preparation with non-covalently attached FAD (see “Results” and “Discussion”)e Peptide can be identified without a post-translational modification at the N-glycosylation consensusf Ambiguous results concerning glycosylation of this asparagine residue did not allow a definite statement of glycosylation status Open table in a new tab BBE was shown to carry a covalently attached FAD moiety, which is bound via its 8-methyl group to a histidine residue contained in a consensus sequence comprising amino acids 100-110 of the protein (5Kutchan T.M. Dittrich H. J. Biol. Chem. 1995; 270: 24475-24481Abstract Full Text Full Text PDF PubMed Scopus (112) Google Scholar, 19Amann M. Nagakura N. Zenk M.H. Eur. J. Biochem. 1988; 175: 17-25Crossref PubMed Scopus (48) Google Scholar). The recombinant BBE exhibits absorbance maxima at 380 and 445 nm, typical for a flavin-containing protein and very similar to the absorbance spectrum previously rep" @default.
• W2087149948 created "2016-06-24" @default.
• W2087149948 creator A5034800344 @default.
• W2087149948 creator A5046566413 @default.
• W2087149948 creator A5055178906 @default.
• W2087149948 creator A5081944506 @default.
• W2087149948 creator A5089695784 @default.
• W2087149948 date "2006-07-01" @default.
• W2087149948 modified "2023-10-17" @default.
• W2087149948 title "Biochemical Evidence That Berberine Bridge Enzyme Belongs to a Novel Family of Flavoproteins Containing a Bi-covalently Attached FAD Cofactor" @default.
• W2087149948 cites W1535516014 @default.
• W2087149948 cites W1607018086 @default.
• W2087149948 cites W1610478082 @default.
• W2087149948 cites W1709437539 @default.
• W2087149948 cites W1880125236 @default.
• W2087149948 cites W1978865842 @default.
• W2087149948 cites W1984485922 @default.
• W2087149948 cites W1991405258 @default.
• W2087149948 cites W2005172776 @default.
• W2087149948 cites W2024581372 @default.
• W2087149948 cites W2044318859 @default.
• W2087149948 cites W2058858269 @default.
• W2087149948 cites W2060812669 @default.
• W2087149948 cites W2065314019 @default.
• W2087149948 cites W2066557962 @default.
• W2087149948 cites W2067420371 @default.
• W2087149948 cites W2087443330 @default.
• W2087149948 cites W2088995397 @default.
• W2087149948 cites W2093573531 @default.
• W2087149948 cites W2100837269 @default.
• W2087149948 cites W2115798299 @default.
• W2087149948 cites W2126024920 @default.
• W2087149948 cites W2134449218 @default.
• W2087149948 cites W2142190987 @default.
• W2087149948 cites W2145149019 @default.
• W2087149948 cites W2149257862 @default.
• W2087149948 cites W2164213081 @default.
• W2087149948 cites W2339221173 @default.
• W2087149948 cites W2889273083 @default.
• W2087149948 doi "https://doi.org/10.1074/jbc.m603267200" @default.
• W2087149948 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/16728404" @default.
• W2087149948 hasPublicationYear "2006" @default.
• W2087149948 type Work @default.
• W2087149948 sameAs 2087149948 @default.
• W2087149948 citedByCount "116" @default.
• W2087149948 countsByYear W20871499482012 @default.
• W2087149948 countsByYear W20871499482013 @default.
• W2087149948 countsByYear W20871499482014 @default.
• W2087149948 countsByYear W20871499482015 @default.
• W2087149948 countsByYear W20871499482016 @default.
• W2087149948 countsByYear W20871499482017 @default.
• W2087149948 countsByYear W20871499482018 @default.
• W2087149948 countsByYear W20871499482019 @default.
• W2087149948 countsByYear W20871499482020 @default.
• W2087149948 countsByYear W20871499482021 @default.
• W2087149948 countsByYear W20871499482022 @default.
• W2087149948 countsByYear W20871499482023 @default.
• W2087149948 crossrefType "journal-article" @default.
• W2087149948 hasAuthorship W2087149948A5034800344 @default.
• W2087149948 hasAuthorship W2087149948A5046566413 @default.
• W2087149948 hasAuthorship W2087149948A5055178906 @default.
• W2087149948 hasAuthorship W2087149948A5081944506 @default.
• W2087149948 hasAuthorship W2087149948A5089695784 @default.
• W2087149948 hasBestOaLocation W20871499481 @default.
• W2087149948 hasConcept C178790620 @default.
• W2087149948 hasConcept C180577832 @default.
• W2087149948 hasConcept C181199279 @default.
• W2087149948 hasConcept C185592680 @default.
• W2087149948 hasConcept C197957613 @default.
• W2087149948 hasConcept C2780116568 @default.
• W2087149948 hasConcept C55493867 @default.
• W2087149948 hasConcept C71240020 @default.
• W2087149948 hasConcept C71995715 @default.
• W2087149948 hasConceptScore W2087149948C178790620 @default.
• W2087149948 hasConceptScore W2087149948C180577832 @default.
• W2087149948 hasConceptScore W2087149948C181199279 @default.
• W2087149948 hasConceptScore W2087149948C185592680 @default.
• W2087149948 hasConceptScore W2087149948C197957613 @default.
• W2087149948 hasConceptScore W2087149948C2780116568 @default.
• W2087149948 hasConceptScore W2087149948C55493867 @default.
• W2087149948 hasConceptScore W2087149948C71240020 @default.
• W2087149948 hasConceptScore W2087149948C71995715 @default.
• W2087149948 hasIssue "30" @default.
• W2087149948 hasLocation W20871499481 @default.
• W2087149948 hasLocation W20871499482 @default.
• W2087149948 hasOpenAccess W2087149948 @default.
• W2087149948 hasPrimaryLocation W20871499481 @default.
• W2087149948 hasRelatedWork W1882140875 @default.
• W2087149948 hasRelatedWork W1989114974 @default.
• W2087149948 hasRelatedWork W2009712104 @default.
• W2087149948 hasRelatedWork W2015885110 @default.
• W2087149948 hasRelatedWork W2083575530 @default.
• W2087149948 hasRelatedWork W2086424699 @default.
• W2087149948 hasRelatedWork W2161214077 @default.
• W2087149948 hasRelatedWork W2191822893 @default.
• W2087149948 hasRelatedWork W3157651451 @default.
• W2087149948 hasRelatedWork W4237075499 @default.
• W2087149948 hasVolume "281" @default.

• next