FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2087231154> ?p ?o ?g. }

• W2087231154 endingPage "453" @default.
• W2087231154 startingPage "448" @default.
• W2087231154 abstract "IgA nephropathy (IgAN) is a polygenic disorder and the precise role of genetic factors remains elusive. Increasing evidences have implicated the aberrant galactosylation of IgA1 molecules in the pathogenesis of IgAN. The galactosyltransferase, core 1 β3-Gal-T, and its chaperone, Cosmc, play important roles in β1,3 glycosylation of IgA1 molecule. A case–control association study was performed to investigate the association between single-nucleotide polymorphisms (SNPs) of C1GALT1 and C1GALT1C1 genes and the susceptibility to IgAN. A total of 1164 subjects were enrolled, including 670 IgAN patients and 494 geographically matched healthy controls. Five SNPs, -734C/T, -465A/G, -330G/T, -292C/-, and 1365G/A in C1GALT1 were selected as tagging SNPs. The D allele and DD genotype of -292C/- in IgAN patients were significantly lower than in the controls (P<0.01). The frequency of haplotype YATIG (Y=C or T) was significantly lower in patients than in controls (0.0719 vs 0.1168, P=2.775 × 10−4, odds ratio (OR)=0.70). The haplotype YAGDA (0.1236 vs 0.0791, P=3.815 × 10−3, OR=1.77) and YATDG (0.0840 vs 0.0298, P=1.258 × 10−5, OR=3.03) were significantly higher in patients than in controls. The present study suggested that the polymorphisms of C1GALT1 gene were associated with the genetic susceptibility to IgAN in Chinese population. IgA nephropathy (IgAN) is a polygenic disorder and the precise role of genetic factors remains elusive. Increasing evidences have implicated the aberrant galactosylation of IgA1 molecules in the pathogenesis of IgAN. The galactosyltransferase, core 1 β3-Gal-T, and its chaperone, Cosmc, play important roles in β1,3 glycosylation of IgA1 molecule. A case–control association study was performed to investigate the association between single-nucleotide polymorphisms (SNPs) of C1GALT1 and C1GALT1C1 genes and the susceptibility to IgAN. A total of 1164 subjects were enrolled, including 670 IgAN patients and 494 geographically matched healthy controls. Five SNPs, -734C/T, -465A/G, -330G/T, -292C/-, and 1365G/A in C1GALT1 were selected as tagging SNPs. The D allele and DD genotype of -292C/- in IgAN patients were significantly lower than in the controls (P<0.01). The frequency of haplotype YATIG (Y=C or T) was significantly lower in patients than in controls (0.0719 vs 0.1168, P=2.775 × 10−4, odds ratio (OR)=0.70). The haplotype YAGDA (0.1236 vs 0.0791, P=3.815 × 10−3, OR=1.77) and YATDG (0.0840 vs 0.0298, P=1.258 × 10−5, OR=3.03) were significantly higher in patients than in controls. The present study suggested that the polymorphisms of C1GALT1 gene were associated with the genetic susceptibility to IgAN in Chinese population. IgA nephropathy (IgAN), the most common primary glomerulonephritis,1.Levy M. Berger J. Worldwide perspective of IgA nephropathy.Am J Kidney Dis. 1988; 12: 340-347Abstract Full Text PDF PubMed Scopus (200) Google Scholar is a complex-trait disease. The growing evidence indicates that genetic components are involved in its pathogenesis and variation of its clinical manifestation. Evidence for this lies in the ethnic and geographic variations in prevalence, familial clustering,2.Hsu S.I. Ramirez S.B. Winn M.P. et al.Evidence for genetic factors in the development and progression of IgA nephropathy.Kidney Int. 2000; 57: 1818-1835Abstract Full Text Full Text PDF PubMed Scopus (149) Google Scholar,3.Scolari F. Inherited forms of IgA nephropathy.J Nephrol. 2003; 16: 317-320PubMed Google Scholar and even linkage to a specific locus on 6q22–23 (IGAN1).4.Gharavi A.G. Yan Y. Scolari F. et al.IgA nephropathy, the most common cause of glomerulonephritis, is linked to 6q22–23.Nat Genet. 2000; 26: 354-357Crossref PubMed Scopus (257) Google Scholar Most association studies, which accounted for a large number of genetic studies in past two decades, mainly focused on candidate genes related to the progression of IgAN.2.Hsu S.I. Ramirez S.B. Winn M.P. et al.Evidence for genetic factors in the development and progression of IgA nephropathy.Kidney Int. 2000; 57: 1818-1835Abstract Full Text Full Text PDF PubMed Scopus (149) Google Scholar,5.Chow K.M. Wong T.Y. Li P.K. Genetics of common progressive renal disease.Kidney Int. 2005; 67: S41-S45Abstract Full Text Full Text PDF Google Scholar Therefore, more novel candidate genes based on the pathogenic mechanisms of IgAN are needed for elucidating the topic. In recent years, aberrant glycosylation of IgA1 molecules has been reported6.Allen A.C. Abnormal glycosylation of IgA: is it related to the pathogenesis of IgA nephropathy?.Nephrol Dial Transplant. 1995; 10: 1121-1124PubMed Google Scholar, 7.Hiki Y. Tanaka A. Kokubo T. et al.Analyses of IgA1 hinge glycopeptides in IgA nephropathy by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry.J Am Soc Nephrol. 1998; 9: 577-582Crossref PubMed Google Scholar, 8.Tomana M. Matousovic K. Julian B.A. et al.Galactose-deficient IgA1 in sera of IgA nephropathy patients is present in complexes with IgG.Kidney Int. 1997; 52: 509-516Abstract Full Text PDF PubMed Scopus (261) Google Scholar in IgAN patients and considered the most important pathogenic mechanism of the disease.9.Amore A. Cirina P. Conti G. et al.Glycosylation of circulating IgA in patients with IgA nephropathy modulates proliferation and apoptosis of mesangial cells.J Am Soc Nephrol. 2001; 12: 1862-1871PubMed Google Scholar, 10.Barratt J. Feehally J. IgA nephropathy.J Am Soc Nephrol. 2005; 16: 2088-2097Crossref PubMed Scopus (380) Google Scholar, 11.Coppo R. Amore A. Aberrant glycosylation in IgA nephropathy (IgAN).Kidney Int. 2004; 65: 1544-1547Abstract Full Text Full Text PDF PubMed Scopus (146) Google Scholar, 12.Smith A.C. Feehally J. New insights into the pathogenesis of IgA nephropathy. Pathogenesis of IgA nephropathy.Springer Semin Immunopathol. 2003; 24: 477-493Crossref PubMed Scopus (28) Google Scholar It is well known that IgA1 contained a hinge region with 3–5 O-linked glycan chains. It consisted of a core 1 structure, Galβ1 → 3GalNAcα1-R (where R is Ser/Thr), in which the galactose may be sialylated. Sialic acid can also be attached to N-acetylgalactosamine. It was demonstrated in IgAN patient that the O-glycosylation pattern of IgA1 hinge region was abnormal, with reduced content of galactose and/or sialic acid, leading to an increase is the exposure of internal GalNac.6.Allen A.C. Abnormal glycosylation of IgA: is it related to the pathogenesis of IgA nephropathy?.Nephrol Dial Transplant. 1995; 10: 1121-1124PubMed Google Scholar, 7.Hiki Y. Tanaka A. Kokubo T. et al.Analyses of IgA1 hinge glycopeptides in IgA nephropathy by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry.J Am Soc Nephrol. 1998; 9: 577-582Crossref PubMed Google Scholar, 8.Tomana M. Matousovic K. Julian B.A. et al.Galactose-deficient IgA1 in sera of IgA nephropathy patients is present in complexes with IgG.Kidney Int. 1997; 52: 509-516Abstract Full Text PDF PubMed Scopus (261) Google Scholar, 11.Coppo R. Amore A. Aberrant glycosylation in IgA nephropathy (IgAN).Kidney Int. 2004; 65: 1544-1547Abstract Full Text Full Text PDF PubMed Scopus (146) Google Scholar This aberrant galactosylation of serum IgA1 could favor the self-aggregation and/or the increased binding to circulating glycoproteins, as well as macromolecules formation with specific IgG antibodies directed against IgA1 hinge O-glycans.11.Coppo R. Amore A. Aberrant glycosylation in IgA nephropathy (IgAN).Kidney Int. 2004; 65: 1544-1547Abstract Full Text Full Text PDF PubMed Scopus (146) Google Scholar, 13.Coppo R. Amore A. Roccatello D. et al.IgA antibodies to dietary antigens and lectin-binding IgA in sera from Italian, Australian, and Japanese IgA nephropathy patients.Am J Kidney Dis. 1991; 17: 480-487Abstract Full Text PDF PubMed Scopus (36) Google Scholar, 14.Iwase H. Tanaka A. Hiki Y. et al.Aggregated human serum immunoglobulin A1 induced by neuraminidase treatment had a lower number of O-linked sugar chains on the hinge portion.J Chromatogr B Biomed Sci Appl. 1999; 724: 1-7Crossref PubMed Scopus (32) Google Scholar, 15.Kokubo T. Hashizume K. Iwase H. et al.Humoral immunity against the proline-rich peptide epitope of the IgA1 hinge region in IgA nephropathy.Nephrol Dial Transplant. 2000; 15: 28-33Crossref PubMed Scopus (38) Google Scholar They also could escape the clearance by hepatic receptors for asialoglycoproteins.16.Basset C. Devauchelle V. Durand V. et al.Glycosylation of immunoglobulin A influences its receptor binding.Scand J Immunol. 1999; 50: 572-579Crossref PubMed Scopus (43) Google Scholar The evidences from other published works and our previous studies demonstrated that IgA1 with aberrant O-glycosylation had a higher binding capacity and stronger biologic effects on cultured human mesangial cells, and that could lead to accumulation and/or prolonged deposition of IgA within the mesangium region.17.Kokubo T. Hiki Y. Iwase H. et al.Protective role of IgA1 glycans against IgA1 self-aggregation and adhesion to extracellular matrix proteins.J Am Soc Nephrol. 1998; 9: 2048-2054PubMed Google Scholar,18.Wang Y. Zhao M.H. Zhang Y.K. et al.Binding capacity and pathophysiological effects of IgA1 from patients with IgA nephropathy on human glomerular mesangial cells.Clin Exp Immunol. 2004; 136: 168-175Crossref PubMed Scopus (51) Google Scholar Therefore, we speculated that altered hinge-region O-glycosylation of IgA1 molecule might play a pivotal role in the pathogenesis of IgAN. The core 1 structure, Galβ1 → 3GalNAcα1-R, is synthesized from GalNAcα1-R by the action of core 1 uridine diphosphate-galactose: Gal-NAc-α-R β1,3-galactosyltransferase (core 1 β3-Gal-T). The gene encoding the enzyme is C1GALT1 (GeneID: 56913).19.Ju T. Brewer K. D’Souza A. et al.Cloning and expression of human core 1 beta1,3-galactosyltransferase.J Biol Chem. 2002; 277: 178-186Crossref PubMed Scopus (217) Google Scholar It is mapped to chromosome 7p14–p13, and is composed of three exons spanning 10 kb.19.Ju T. Brewer K. D’Souza A. et al.Cloning and expression of human core 1 beta1,3-galactosyltransferase.J Biol Chem. 2002; 277: 178-186Crossref PubMed Scopus (217) Google Scholar Further studies revealed that the core 1 β3-Gal-T activity required expression of a molecular chaperone designated Cosmc (core 1 β3-Gal-T-specific molecular chaperone).20.Ju T. Cummings R.D. A unique molecular chaperone Cosmc required for activity of the mammalian core 1 beta 3-galactosyltransferase.Proc Natl Acad Sci USA. 2002; 99: 16613-16618Crossref PubMed Scopus (344) Google Scholar,21.Kudo T. Iwai T. Kubota T. et al.Molecular cloning and characterization of a novel UDP-Gal:GalNAc(alpha) peptide beta 1,3-galactosyltransferase (C1Gal-T2), an enzyme synthesizing a core 1 structure of O-glycan.J Biol Chem. 2002; 277: 47724-47731Crossref PubMed Scopus (55) Google Scholar Its coding gene was C1GALT1C1 (GeneID: 29071), which was mapped to chromosome Xq24. This gene included one encoding exon and spanned about 1 kb.20.Ju T. Cummings R.D. A unique molecular chaperone Cosmc required for activity of the mammalian core 1 beta 3-galactosyltransferase.Proc Natl Acad Sci USA. 2002; 99: 16613-16618Crossref PubMed Scopus (344) Google Scholar,21.Kudo T. Iwai T. Kubota T. et al.Molecular cloning and characterization of a novel UDP-Gal:GalNAc(alpha) peptide beta 1,3-galactosyltransferase (C1Gal-T2), an enzyme synthesizing a core 1 structure of O-glycan.J Biol Chem. 2002; 277: 47724-47731Crossref PubMed Scopus (55) Google Scholar Mutations of C1GALT1C1 gene could impressively change the enzyme activity of C1β3Gal-T.20.Ju T. Cummings R.D. A unique molecular chaperone Cosmc required for activity of the mammalian core 1 beta 3-galactosyltransferase.Proc Natl Acad Sci USA. 2002; 99: 16613-16618Crossref PubMed Scopus (344) Google Scholar,22.Ju T. Cummings R.D. Protein glycosylation: chaperone mutation in Tn syndrome.Nature. 2005; 437: 1252Crossref PubMed Scopus (203) Google Scholar To investigate the polymorphisms of C1GALT1 and C1GALT1C1 genes to the susceptibility of IgAN, a case–control association study was performed on a large Han Chinese population. Firstly, we scanned the two genes to identify all polymorphisms within a sub-sample. Then haplotype tagging single-nucleotide polymorphisms (htSNPs) were selected. Secondly, the htSNPs were further genotyped in the IgAN patients and the controls; and then haplotype-based association analysis was used to test the possible effect of its polymorphism on IgAN. Nine SNPs within the C1GALT1 gene were identified in 24 individuals. Seven SNPs (SNP1–SNP7) were localized to the 5′ flanking region, at positions -734, -722, -552, -465, -449, -330, and -292 upstream the first transcription site, respectively, and two SNPs (SNP8, SNP9) were localized, respectively, in the 3′ untranslation region, at positions 1365 and 1484. An insertion/deletion SNP (-292C/-) was detected in the promoter region of C1GALT1 gene. Three SNPs, -722G/T, -552A/G, -465A/G, were novel SNPs for the dbSNP database (http://www.ncbi.nlm.nih.gov/projects/SNP/). Detailed information of all SNPs, along with the minor allele frequencies, is presented in Table 1.Table 1Polymorphisms of C1GALT1 gene were detected in 24 subjectsMarker namedbSNP nameRegionPositionaThe base immediately preceding the start of transcription numbered as -1.AllelesbWith major allele given first and minor allele given second.Minor allele frequencySNP1rs96390315′ Flankingc5′ Flanking means the upstream from the first transcribed nucleotide.−734C/T0.250SNP2Novel5′ Flanking−722G/T0.145SNP3Novel5′ Flanking−552A/G0.043SNP4Novel5′ Flanking−465A/G0.167SNP5rs10088975′ Flanking−449A/G0.021SNP6rs10088985′ Flanking−330G/T0.479SNP7rs58821155′ Flanking−292C/−0.125SNP8rs10477633′ UTR1365G/A0.438SNP9rs38078593′ UTR1484T/A0.043a The base immediately preceding the start of transcription numbered as -1.b With major allele given first and minor allele given second.c 5′ Flanking means the upstream from the first transcribed nucleotide. Open table in a new tab Pairwise linkage disequilibrium coefficients (D′) of the nine SNPs in the C1GALT1 gene and corresponding P-values are displayed in Table 2. The P-values were adjusted by the number of SNPs in the gene by Bonferroni correction (P<0.05/36=0.0014). Shaded areas indicate that significant linkage disequilibrium exists within the C1GALT1 gene. Five polymorphic loci, SNP1 (-734C/T), SNP4 (-465A/G), SNP6 (-330G/T), SNP7 (-292C/-), and SNP8 (1365G/A), were selected by htSNPer 1.0 software as tagging SNPs for further investigation in the association study.Table 2Pair-wise linkage disequilibrium coefficients in nine polymorphisms of C1GALT1 gene in 24 individualsSNP1SNP2SNP3SNP4SNP5SNP6SNP7SNP8SNP9SNP1—0.61950.27750.05350.22840.00021.00000.00001.0000SNP20.1930—0.42180.09540.10730.31170.00000.00270.0192SNP31.00001.0000—0.60700.76930.19880.45980.12380.6766SNP41.00001.00000.2610—0.54360.13750.12500.03790.3876SNP51.00001.00001.00001.0000—0.24980.08700.19480.0184SNP61.00000.50001.00001.00001.0000—0.32020.00270.1010SNP70.00001.00001.00001.00001.00000.4870—0.00870.0127SNP81.00001.00001.00000.71401.00000.50301.0000—0.1540SNP90.00001.00001.00001.00001.00001.00001.00001.0000—∣D′∣ below diagonal and P-value above diagonal.Shaded numbers indicate statistical significance (P<0.0014) after adjusting for 36 multiple tests. Open table in a new tab ∣D′∣ below diagonal and P-value above diagonal. Shaded numbers indicate statistical significance (P<0.0014) after adjusting for 36 multiple tests. Only one SNP, T393A (rs17261572), was identified within the exon of C1GALT1C1 gene from 46 individuals (including 12 female individuals and total 58 X chromosomes). The A allele was identified in one patient with IgAN and one healthy control, and the AA genotype was identified in one female patient. Therefore, the A allele frequency of the SNP was 0.069 (4/58). Because minor allele frequency of the tagging SNP should be more than 0.10, the T393A SNP in C1GALT1C1 gene was not included in further analysis in association study. Association analyses were performed separately for each SNP and then haplotype-based analysis. Firstly, we compared the frequency of allele and genotype between patients with IgAN and normal controls for each SNP. The genotype and allele distributions of the five SNPs are listed in Table 3. Single SNP analysis indicated that the frequency of I allele in SNP7 was significantly lower in patients with IgAN than in controls (0.091 vs 0.129, P=0.007). Moreover, SNP7 II/ID genotype was significantly less in patients (0.179 vs 0.243, P=0.004). Neither alleles nor genotypes of other four SNPs differed significantly between the two groups.Table 3Allele and genotype distribution in IgAN patients and controlsVariantsControlsIgAN patientsP-valueSNP1GenotypeCC255332CT207280TT32580.370AllelesC717944T2713960.263SNP4GenotypeAA362499AG124160GG8110.891AllelesA8481158G1401820.685SNP6GenotypeTT124156TG267338GG1031760.101AllelesT515650G4736900.084SNP7GenotypeDD374550DI113118II720.007AllelesD8611218I1271220.004SNP8GenotypeAA159209AG235326GG951340.895AllelesA553744G4255940.653IgAN, IgA nephropathy. Open table in a new tab IgAN, IgA nephropathy. By the haplo.cc (implemented in the haplo.stats program) analysis, we have calculated the different significance of association between the susceptibility to IgAN and the haplotypes consisted of different numbers of the five SNPs (range from two to five SNPs). The other four SNPs except the first SNP got the largest adjusted global score statistic (50.122) and the least global P-value (P=5.950 × 10−7). Global differences in haplotype frequency profiles between the IgAN patients and the control group were tested by permutation testing (20 000 permutations). We found significant omnibus differences in haplotype frequencies between the two groups (P=0). The frequency of haplotypes YATIG (Y=C or T) was significantly lower in the patients than in controls (0.0719 vs 0.1168, P=2.775 × 10−4). Its odds ratio (OR) was 0.70 (95% confidence interval: 0.51–0.97) (Table 4). The frequencies of other two haplotypes, YAGDA (0.1236 vs 0.0791, P=3.815 × 10−3) and YATDG (0.0840 vs 0.0298, P=1.258 × 10−5), were significantly higher in patients than in controls. Their ORs were 1.77 (95% confidence interval: 1.28–2.46) and 3.03 (95% confidence interval: 1.87–4.90), respectively (Table 4).Table 4Haplotypes of C1GALT1 gene and the association with IgANHaplotypeFrequencyP-valueOR (95% CI)ControlCaseYATDAaY=C or T.0.35210.30264.972 × 10−2ReferenceYATIG0.11680.07192.775 × 10−40.70 (0.51–0.97)YGGDA0.11630.10513.850 × 10−11.08 (0.80–1.47)YAGDG0.26880.26297.956 × 10−11.12 (0.90–1.40YAGDA0.07910.12363.815 × 10−31.77 (1.28–2.46)YATDG0.02980.08401.258 × 10−53.03 (1.87–4.90)RarebRare includes other seven types of haplotypes (individual frequency<0.02).0.03710.0498——#Omnibus P-value assessed empirically by permutation testing (20000 permutations).P=0IgAN, IgA nephropathy.Bold values signifies P-values.a Y=C or T.b Rare includes other seven types of haplotypes (individual frequency<0.02).# Omnibus P-value assessed empirically by permutation testing (20 000 permutations). Open table in a new tab IgAN, IgA nephropathy. Bold values signifies P-values. We performed a case–control association study to investigate the association between the polymorphisms of C1GALT1 gene and the susceptibility to IgAN. The result revealed that variations of C1GALT1 gene, especially haplotypes YATIG, YAGDA, and YATDG, were associated with the susceptibility to IgAN. IgAN was considered to be a polygenic and multifactorial disorder. Extensive evidences implied that the genetic components were involved in the susceptibility and progression of IgAN.2.Hsu S.I. Ramirez S.B. Winn M.P. et al.Evidence for genetic factors in the development and progression of IgA nephropathy.Kidney Int. 2000; 57: 1818-1835Abstract Full Text Full Text PDF PubMed Scopus (149) Google Scholar, 3.Scolari F. Inherited forms of IgA nephropathy.J Nephrol. 2003; 16: 317-320PubMed Google Scholar, 4.Gharavi A.G. Yan Y. Scolari F. et al.IgA nephropathy, the most common cause of glomerulonephritis, is linked to 6q22–23.Nat Genet. 2000; 26: 354-357Crossref PubMed Scopus (257) Google Scholar, 5.Chow K.M. Wong T.Y. Li P.K. Genetics of common progressive renal disease.Kidney Int. 2005; 67: S41-S45Abstract Full Text Full Text PDF Google Scholar, 12.Smith A.C. Feehally J. New insights into the pathogenesis of IgA nephropathy. Pathogenesis of IgA nephropathy.Springer Semin Immunopathol. 2003; 24: 477-493Crossref PubMed Scopus (28) Google Scholar Linkage analysis based on familial data of IgAN revealed that familial IgAN could be transmitted under a dominant model with incomplete penetrance.3.Scolari F. Inherited forms of IgA nephropathy.J Nephrol. 2003; 16: 317-320PubMed Google Scholar,4.Gharavi A.G. Yan Y. Scolari F. et al.IgA nephropathy, the most common cause of glomerulonephritis, is linked to 6q22–23.Nat Genet. 2000; 26: 354-357Crossref PubMed Scopus (257) Google Scholar However, no candidate gene for IgAN was identified within these linked intervals. Therefore, SNP analysis in the sporadic IgAN patients would aid in identifying other genes that may be originally implicated in this polygenic disease. In past two decades, genetic association studies were performed in many studies and they revealed that many candidate genes were related to the predisposition and progression of IgAN.2.Hsu S.I. Ramirez S.B. Winn M.P. et al.Evidence for genetic factors in the development and progression of IgA nephropathy.Kidney Int. 2000; 57: 1818-1835Abstract Full Text Full Text PDF PubMed Scopus (149) Google Scholar,5.Chow K.M. Wong T.Y. Li P.K. Genetics of common progressive renal disease.Kidney Int. 2005; 67: S41-S45Abstract Full Text Full Text PDF Google Scholar Those genes included HLA (human leukocyte antigen) gene family, T-cell receptor α or β chain genes, renin–angiotensin system-related genes, as well as several inflammatory factor or cytokine genes. Most of these genes were focused on the progression rather than the pathogenesis of IgAN.2.Hsu S.I. Ramirez S.B. Winn M.P. et al.Evidence for genetic factors in the development and progression of IgA nephropathy.Kidney Int. 2000; 57: 1818-1835Abstract Full Text Full Text PDF PubMed Scopus (149) Google Scholar,10.Barratt J. Feehally J. IgA nephropathy.J Am Soc Nephrol. 2005; 16: 2088-2097Crossref PubMed Scopus (380) Google Scholar On the other hand, most association studies about IgAN have been performed within relatively small case–control population and analyzed with a single SNP.2.Hsu S.I. Ramirez S.B. Winn M.P. et al.Evidence for genetic factors in the development and progression of IgA nephropathy.Kidney Int. 2000; 57: 1818-1835Abstract Full Text Full Text PDF PubMed Scopus (149) Google Scholar,10.Barratt J. Feehally J. IgA nephropathy.J Am Soc Nephrol. 2005; 16: 2088-2097Crossref PubMed Scopus (380) Google Scholar That might lead to that most of genetic association studies of IgAN be lack of reproducibility. While population-based genetic association study was performed, the analysis in a large sample (more than 1000 individuals) tended to produce more replicable association than in a small one.23.Ioannidis J.P. Trikalinos T.A. Ntzani E.E. Contopoulos-Ioannidis D.G. Genetic associations in large versus small studies: an empirical assessment.Lancet. 2003; 361: 567-571Abstract Full Text Full Text PDF PubMed Scopus (496) Google Scholar Otherwise, the recent developments of htSNPs selection and haplotype-based analysis offered more powerful genetic association studies. Based on the above considerations, we designed the present genetic association study based on haplotype analysis in a large population sample of IgAN patients and geography-matched healthy controls. We firstly screened the polymorphisms of C1GALT1 and C1GALT1C1 genes in a sub-sample and detected nine SNPs and one SNP, respectively. Then five htSNPs within C1GALT1 gene were selected for further association analysis. The frequency of -292C/- D allele or DD genotype in IgAN patients was significantly higher than in controls. The frequency of haplotype YATIG was significantly lower in patients than in controls, but the frequency of haplotype YAGDA or YATDG was significantly higher in patients than that in controls. These results suggest that the variants of C1GALT1 gene would influence the susceptibility of IgAN. As we mentioned at the beginning, the core 1 β3-Gal-T activity required expression of a molecular chaperone, Cosmc. However, we only detected one SNP (T393A) within the encoding region of C1GALT1C1 gene. The frequency of its minor allele was only 0.069. It could not match the criteria for further association analysis. On the other hand, although the SNP, T393A (rs17261572), was reported with the amino-acid substitution from aspartic acid to glutamic acid (Asp131 → Glu), it revealed normal core 1 β3-Gal-T activity in a previous study.22.Ju T. Cummings R.D. Protein glycosylation: chaperone mutation in Tn syndrome.Nature. 2005; 437: 1252Crossref PubMed Scopus (203) Google Scholar It suggested that the variations within the encoding region of C1GALT1C1 gene would not be essential for the abnormal galactosylation of IgA1. It had been reported that the variations of C1GALT1 gene were associated with the susceptibility to IgAN in Italian IgAN patients (Pirulli D, Ulivi S, Zadro C, et al. Polymorphisms in the gene coding for the corel B 1,3-galactosyltransferase T1 contribute to the genetic susceptibility to IgA nephropathy. 10th International Symposium of IgA Nephropathy: abstract, vol. 308, 2004). In their study, the genotype 1365G/G of C1GALT1 gene was identified, and it was reported to associate with the susceptibility to IgAN. Additionally, the promoter CGATW haplotype was significantly less frequent in IgAN patients than in healthy controls. Although the association between 1365G/A polymorphism and susceptibility to IgAN could not be replicated in our larger population, we found that the frequency of haplotype YATIG was significantly lower, and the frequency of YAGDA and YATDG was significantly higher in patients than that in controls. Our results suggested that the 1365G/A polymorphism might influence the susceptibility to IgAN in combination with other SNPs in C1GALT1 gene. In present study, we identified seven SNPs in the promoter region of C1GALT1 gene; there were two SNPs not found in Italian population (five SNPs). It demonstrated that it is important to screen the polymorphisms in distinct populations, especially when from different races. Besides the sample size, other factors such as ethnic variation, unknown environmental factors, as well as genetic heterogeneity of IgAN, might bring on the different results in two populations. How did the polymorphisms of C1GALT1 gene influence the susceptibility to IgAN? All of five SNPs that we selected as tagging SNPs for association analysis were located in the regulatory region of the C1GALT1 gene. The variation might influence the core 1 β3-Gal-T activity by regulating the expression of C1GALT1 gene. In the previous Italian study, they demonstrate the reduced expression of C1GALT1 in the homozygous 1365G/G individuals, compared to those with G/A or A/A genotypes. More studies are needed to validate the function of identified polymorphisms. The present genetic association study based on haplotyped case–control analysis in a large Chinese population demonstrated that polymorphisms of C1GALT1 gene were associated with the susceptibility to IgA nephropathy. A total of unrelated 1164 Northern Chinese were enrolled in this study, including 670 patients with renal biopsy verified IgAN and 494 geographically matched healthy controls with normal urine analysis and blood pressure. Diagnoses of IgAN were confirmed by the observation of granular deposition of IgA in the glomerular mesangium by immunofluorescence detection, as well as by the deposition of electron dense material in mesangial ultrastructural examination. Patients with Henoch-Schonlein purpura, systemic lupus erythematosus, and chronic hepatic diseases were excluded by detailed clinical and laboratory examinations. The average age of patients at the time of renal biopsy was 31.2±11.4 years (ranging from 9 to 77 years), and the gender ratio (male to female) was 1.33:1. The glomerular filtration rate of IgAN patients was estimated by the Modification of Diet in Renal Disease (MDRD) abbreviated equation.24.Levey A. Greene T. Kusek J. et al.A simplified equation to predict glomerular filtration rate from serum creatinine.J Am Soc Nephrol. 2000; 11: 828APubMed Google Scholar The protocol for this genetic study was approved by the medical ethics committee of Peking University, and informed written consent for the genetic studies was obtained from all participants. Genomic DNA of patients was extracted from ethylenediaminetetraacetic acid-anticoagulated whole blood samples by the salting out procedure.25.Miller S.A. Dykes D.D. Polesky H.F. A simple salting out procedure for extracting DNA from human nucleated cells.Nucleic Acids Res. 1988; 16: 1215Crossref PubMed Scopus (17178) Google Scholar Reference sequences of C1GALT1 gene and C1GALT1C1 gene were obtained from National Center for Biotechnology Information (NCBI) Gene database (http://www.ncbi.nlm.nih.gov/entrez). For C1GALT1 gene, genomic DNA from 24 samples, including 12 unrelated IgAN patients and 12 unrelated healthy controls, were amplified by polymerase chain reaction (PCR) and directly sequenced for screening of SNPs. The PCR amplification regions included each exon with 50–100 bp of flanking intronic sequence, 5′ and 3′ untranslated regions, as well as the 1 kb upstream from transcriptional initiation site. For screening the variations within the C1GALT1C1 gene, 46 individuals, including 27 patients with IgAN (six female patients) and 19 normal controls (six female controls), were enrolled. The exon of C1GALT1C1 gene was amplified from total 58 × chromosomes in 46 individuals. PCR primers were designed by Primer3 program.26.Rozen S. Skaletsky H. Primer 3 on the WWW for general users and for biologist programmers.Methods Mol Biol. 2000; 132: 365-386Crossref PubMed Google Scholar Target sequences were amplified by PCR from 50 ng genomic DNA in 20 μl of final reaction volume. Products were sequenced, on an ABI PRISM 3700 automated sequencer and analyzed by the Phred/Phrap/Consed software suite.27.Ewing B. Hillier L. Wendl M.C. Green P. Base-calling of automated sequencer traces using phred. I. Accuracy assessment.Genome Res. 1998; 8: 175-185Crossref PubMed Scopus (4736) Google Scholar,28.Gordon D. Abajian C. Green P. Consed: a graphical tool for sequence finishing.Genome Res. 1998; 8: 195-202Crossref PubMed Scopus (2794) Google Scholar Polymorphism loci were detected using Polyphred29.Nickerson D.A. Tobe V.O. Taylor S.L. PolyPhred: automating the detection and genotyping of single nucleotide substitutions using fluorescence-based resequencing.Nucleic Acids Res. 1997; 25: 2745-2751Crossref PubMed Scopus (814) Google Scholar and were manually confirmed. Common SNPs (an SNP with a minor allele frequency>10%) were selected as htSNP by the htSNPer1.0. software application according to the haplotype diversity.30.Ding K. Zhang J. Zhou K. et al.htSNPer1.0: software for haplotype block partition and htSNPs selection.BMC Bioinformatics. 2005; 6: 38Crossref PubMed Scopus (28) Google Scholar,31.Carlson C.S. Eberle M.A. Rieder M.J. et al.Selecting a maximally informative set of single-nucleotide polymorphisms for association analyses using linkage disequilibrium.Am J Hum Genet. 2004; 74: 106-120Abstract Full Text Full Text PDF PubMed Scopus (1297) Google Scholar Within a block, this definition requires that htSNPs should explain the diversity no less than a threshold of 0.8.31.Carlson C.S. Eberle M.A. Rieder M.J. et al.Selecting a maximally informative set of single-nucleotide polymorphisms for association analyses using linkage disequilibrium.Am J Hum Genet. 2004; 74: 106-120Abstract Full Text Full Text PDF PubMed Scopus (1297) Google Scholar,32.Johnson G.C. Esposito L. Barratt B.J. et al.Haplotype tagging for the identification of common disease genes.Nat Genet. 2001; 29: 233-237Crossref PubMed Scopus (998) Google Scholar In the C1AGLT1 gene, five tagging SNPs, designated SNP1 (-734C/T), SNP4 (-465A/G), SNP6 (-330G/T), SNP7 (-292C/-), and SNP8 (1365G/A) were fallen into for further analysis. The SNP8 was genotyped by directed sequencing, and the other four SNPs were genotyped by the standard PCR-restriction fragment length polymorphism procedures in all 1164 subjects. The primers and the restricted endonucleases were listed in Table 5. Forty PCR products for each SNP locus were resequenced for accuracy confirmation of PCR-restriction fragment length polymorphism analysis.Table 5Primers and restriction endonucleases for genotyping SNPs of C1GALT1 geneSNPForward primer (5′–3′)Reverse primer (5′–3′)Restricted endonucleaseSNP1CCTGACTTCAAGTGATCCACCCGACaUnderline: mismatch locus.GAACACACCCATGCCCATTCATTTATHinfI(Ferm)bSuppliers: NEB, New England Biolabs, Ipswich, USA; Ferm, Fermentas International Inc., Hanover, USA.SNP4GGCTAGGTACGGTTTTGTGATTGGGTCTCATGTGGTTTCTBbvI (NEB)SNP6GGTTTGCTAACTTTTGGGTTGGAGGACTTCCCACCAGGATCCTTTGTGGATBseGI (Ferm)SNP7AGAAGAAGATGCAACAGAAACCACACTTTCTTTGCTGTTAACTCTGAGGACPshAI(NEB)SNP8cSNP8 was genotyped by direct sequencing.GGAATCCCAGTGAGGAATTCTACAGAATGCTATGAACGGTTTGASNP, single-nucleotide polymorphism.a Underline: mismatch locus.b Suppliers: NEB, New England Biolabs, Ipswich, USA; Ferm, Fermentas International Inc., Hanover, USA.c SNP8 was genotyped by direct sequencing. Open table in a new tab SNP, single-nucleotide polymorphism. The Fisher exact test was used to determine whether the distribution of genotypes was consistent with Hardy–Weinberg equilibrium. Pairwise linkage disequilibrium between each SNP was quantified as D′ and Δ2, which were measured by the GLOD software package.33.Abecasis G.R. Cookson W.O. GOLD – graphical overview of linkage disequilibrium.Bioinformatics. 2000; 16: 182-183Crossref PubMed Scopus (673) Google Scholar Haplo.Stats1.2.0 software34.Schaid D.J. Rowland C.M. Tines D.E. et al.Score tests for association between traits and haplotypes when linkage phase is ambiguous.Am J Hum Genet. 2002; 70: 425-434Abstract Full Text Full Text PDF PubMed Scopus (1539) Google Scholar was used to test the association of statistically inferred haplotypes with IgAN. The levels of the P-value were adjusted by Bonferroni correction. Because the haplotypes in this study were constructed by estimation, the omnibus P-value was assessed empirically by permutation testing with the software.35.Nyholt D.R. A simple correction for multiple testing for single-nucleotide polymorphisms in linkage disequilibrium with each other.Am J Hum Genet. 2004; 74: 765-769Abstract Full Text Full Text PDF PubMed Scopus (1314) Google Scholar,36.Kankova K. Stejskalova A. Hertlova M. Znojil V. Haplotype analysis of the RAGE gene: identification of a haplotype marker for diabetic nephropathy in type 2 diabetes mellitus.Nephrol Dial Transplant. 2005; 20: 1093-1102Crossref PubMed Scopus (46) Google Scholar Descriptive statistical analyses were performed with SPSS10.0 software (SPSS Inc., Chicago, IL USA). A P-value of less than 0.05 was considered statistically significant. This work was supported by the grant of ‘985’ program (stage II) of Peking University, the Capital Medical Science Foundation (2003–2001), the National Natural Science Foundation (30670981), and the Foundation of Ministry of Education, People's Republic of China (985-2-007-113) to HZ." @default.
• W2087231154 created "2016-06-24" @default.
• W2087231154 creator A5016316057 @default.
• W2087231154 creator A5042988351 @default.
• W2087231154 creator A5054700164 @default.
• W2087231154 creator A5068093752 @default.
• W2087231154 creator A5074414128 @default.
• W2087231154 date "2007-03-01" @default.
• W2087231154 modified "2023-10-18" @default.
• W2087231154 title "Variants of C1GALT1 gene are associated with the genetic susceptibility to IgA nephropathy" @default.
• W2087231154 cites W1500261682 @default.
• W2087231154 cites W1583476286 @default.
• W2087231154 cites W1600084468 @default.
• W2087231154 cites W1965019591 @default.
• W2087231154 cites W1965998306 @default.
• W2087231154 cites W1971307410 @default.
• W2087231154 cites W1993857686 @default.
• W2087231154 cites W2007058211 @default.
• W2087231154 cites W2007731313 @default.
• W2087231154 cites W2015408724 @default.
• W2087231154 cites W2017233461 @default.
• W2087231154 cites W2030705868 @default.
• W2087231154 cites W2036550192 @default.
• W2087231154 cites W2062553666 @default.
• W2087231154 cites W2070286548 @default.
• W2087231154 cites W2073865076 @default.
• W2087231154 cites W2079344868 @default.
• W2087231154 cites W2085114555 @default.
• W2087231154 cites W2090430326 @default.
• W2087231154 cites W2099377647 @default.
• W2087231154 cites W2118094114 @default.
• W2087231154 cites W2121016876 @default.
• W2087231154 cites W2141986806 @default.
• W2087231154 cites W2143014918 @default.
• W2087231154 cites W2144911879 @default.
• W2087231154 cites W2156552129 @default.
• W2087231154 cites W2161024158 @default.
• W2087231154 cites W2161221103 @default.
• W2087231154 cites W2162235775 @default.
• W2087231154 cites W2164075646 @default.
• W2087231154 cites W2411533418 @default.
• W2087231154 cites W4239867451 @default.
• W2087231154 cites W836197848 @default.
• W2087231154 doi "https://doi.org/10.1038/sj.ki.5002088" @default.
• W2087231154 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/17228361" @default.
• W2087231154 hasPublicationYear "2007" @default.
• W2087231154 type Work @default.
• W2087231154 sameAs 2087231154 @default.
• W2087231154 citedByCount "86" @default.
• W2087231154 countsByYear W20872311542012 @default.
• W2087231154 countsByYear W20872311542013 @default.
• W2087231154 countsByYear W20872311542014 @default.
• W2087231154 countsByYear W20872311542015 @default.
• W2087231154 countsByYear W20872311542016 @default.
• W2087231154 countsByYear W20872311542017 @default.
• W2087231154 countsByYear W20872311542019 @default.
• W2087231154 countsByYear W20872311542020 @default.
• W2087231154 countsByYear W20872311542021 @default.
• W2087231154 countsByYear W20872311542022 @default.
• W2087231154 countsByYear W20872311542023 @default.
• W2087231154 crossrefType "journal-article" @default.
• W2087231154 hasAuthorship W2087231154A5016316057 @default.
• W2087231154 hasAuthorship W2087231154A5042988351 @default.
• W2087231154 hasAuthorship W2087231154A5054700164 @default.
• W2087231154 hasAuthorship W2087231154A5068093752 @default.
• W2087231154 hasAuthorship W2087231154A5074414128 @default.
• W2087231154 hasBestOaLocation W20872311541 @default.
• W2087231154 hasConcept C104317684 @default.
• W2087231154 hasConcept C134018914 @default.
• W2087231154 hasConcept C203014093 @default.
• W2087231154 hasConcept C2781184683 @default.
• W2087231154 hasConcept C54355233 @default.
• W2087231154 hasConcept C555293320 @default.
• W2087231154 hasConcept C67636389 @default.
• W2087231154 hasConcept C71924100 @default.
• W2087231154 hasConcept C86803240 @default.
• W2087231154 hasConceptScore W2087231154C104317684 @default.
• W2087231154 hasConceptScore W2087231154C134018914 @default.
• W2087231154 hasConceptScore W2087231154C203014093 @default.
• W2087231154 hasConceptScore W2087231154C2781184683 @default.
• W2087231154 hasConceptScore W2087231154C54355233 @default.
• W2087231154 hasConceptScore W2087231154C555293320 @default.
• W2087231154 hasConceptScore W2087231154C67636389 @default.
• W2087231154 hasConceptScore W2087231154C71924100 @default.
• W2087231154 hasConceptScore W2087231154C86803240 @default.
• W2087231154 hasIssue "5" @default.
• W2087231154 hasLocation W20872311541 @default.
• W2087231154 hasLocation W20872311542 @default.
• W2087231154 hasOpenAccess W2087231154 @default.
• W2087231154 hasPrimaryLocation W20872311541 @default.
• W2087231154 hasRelatedWork W1885065830 @default.
• W2087231154 hasRelatedWork W2028411731 @default.
• W2087231154 hasRelatedWork W2034625591 @default.
• W2087231154 hasRelatedWork W2040273900 @default.
• W2087231154 hasRelatedWork W2061684609 @default.
• W2087231154 hasRelatedWork W2358805136 @default.
• W2087231154 hasRelatedWork W2375924963 @default.
• W2087231154 hasRelatedWork W2402601575 @default.

• next