FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2087367624> ?p ?o ?g. }

• W2087367624 endingPage "601" @default.
• W2087367624 startingPage "595" @default.
• W2087367624 abstract "Embryonic stem cells (ESCs) are capable of indefinite self-renewal while retaining the ability to differentiate to any of the three germ layers that give rise to all somatic cell types. An emerging view is that a core set of transcription factors, including Oct4, Sox2, and Nanog, form a robust autoregulatory circuit that maintains ESCs in a self-renewing state. To accommodate the capacity of such cells to undergo germ layer-specific differentiation, we predicted a posttranslational mechanism that could negatively regulate these core self-renewal factors. Here we report caspase-induced cleavage of Nanog in differentiating ESCs. Stem cells lacking the Casp3 gene showed marked defects in differentiation, while forced expression of a caspase cleavage-resistant Nanog mutant in ESCs strongly promoted self-renewal. These results link a major component of the programmed cell-death pathway to the regulation of ESC development. Embryonic stem cells (ESCs) are capable of indefinite self-renewal while retaining the ability to differentiate to any of the three germ layers that give rise to all somatic cell types. An emerging view is that a core set of transcription factors, including Oct4, Sox2, and Nanog, form a robust autoregulatory circuit that maintains ESCs in a self-renewing state. To accommodate the capacity of such cells to undergo germ layer-specific differentiation, we predicted a posttranslational mechanism that could negatively regulate these core self-renewal factors. Here we report caspase-induced cleavage of Nanog in differentiating ESCs. Stem cells lacking the Casp3 gene showed marked defects in differentiation, while forced expression of a caspase cleavage-resistant Nanog mutant in ESCs strongly promoted self-renewal. These results link a major component of the programmed cell-death pathway to the regulation of ESC development. Embryonic stem cell (ESC) research holds remarkable promise, yet the mechanisms by which these cells transition from pluripotency to differentiation have been elusive. It now appears that a small core set of transcription factors work together to maintain the pluripotent state of ESCs (Bernstein et al., 2006Bernstein B.E. Mikkelsen T.S. Xie X. Kamal M. Huebert D.J. Cuff J. Fry B. Meissner A. Wernig M. Plath K. et al.A bivalent chromatin structure marks key developmental genes in embryonic stem cells.Cell. 2006; 125: 315-326Abstract Full Text Full Text PDF PubMed Scopus (3738) Google Scholar, Boyer et al., 2005Boyer L.A. Lee T.I. Cole M.F. Johnstone S.E. Levine S.S. Zucker J.P. Guenther M.G. Kumar R.M. Murray H.L. Jenner R.G. et al.Core transcriptional regulatory circuitry in human embryonic stem cells.Cell. 2005; 122: 947-956Abstract Full Text Full Text PDF PubMed Scopus (3289) Google Scholar, Boyer et al., 2006Boyer L.A. Plath K. Zeitlinger J. Brambrink T. Medeiros L.A. Lee T.I. Levine S.S. Wernig M. Tajonar A. Ray M.K. et al.Polycomb complexes repress developmental regulators in murine embryonic stem cells.Nature. 2006; 441: 349-353Crossref PubMed Scopus (1930) Google Scholar, Lee et al., 2006Lee T.I. Jenner R.G. Boyer L.A. Guenther M.G. Levine S.S. Kumar R.M. Chevalier B. Johnstone S.E. Cole M.F. Isono K. et al.Control of developmental regulators by Polycomb in human embryonic stem cells.Cell. 2006; 125: 301-313Abstract Full Text Full Text PDF PubMed Scopus (1791) Google Scholar). These transcriptional regulators, including Oct4, Sox2, and Nanog, stimulate the expression of genes controlling self-renewal while repressing genes that drive differentiation. An emerging concept is that Nanog and other core transcription factors form a tight autoregulatory circuit that enables ESCs to remain stable in culture and ensures extreme autonomy in proliferative decisions (Boyer et al., 2005Boyer L.A. Lee T.I. Cole M.F. Johnstone S.E. Levine S.S. Zucker J.P. Guenther M.G. Kumar R.M. Murray H.L. Jenner R.G. et al.Core transcriptional regulatory circuitry in human embryonic stem cells.Cell. 2005; 122: 947-956Abstract Full Text Full Text PDF PubMed Scopus (3289) Google Scholar, Chickarmane et al., 2006Chickarmane V. Troein C. Nuber U.A. Sauro H.M. Peterson C. Transcriptional dynamics of the embryonic stem cell switch.PLoS Comput. Biol. 2006; 2: e123https://doi.org/10.1371/journal.pcbi.0020123Crossref PubMed Scopus (199) Google Scholar). Thus, ESCs depend only marginally on mitogenic stimuli typically required for somatic cells to proliferate but stimulate their own growth through endogenous factors. This autonomy is best shown by the unique ability of ESCs, injected into virtually any anatomical site in adult animals, to form rapidly growing tumors called teratocarcinomas (Damjanov and Solter, 1974Damjanov I. Solter D. Experimental teratoma.Curr. Top. Pathol. 1974; 59: 69-130Crossref PubMed Scopus (126) Google Scholar). How, then, do ESCs retain the capacity for rapid differentiation? The most plausible mechanism, in our view, would modify one or more core transcription factors posttranslationally, allowing the ESCs to rapidly escape the constraints of their self-renewal machinery. Attractive candidates for the role of posttranslational modifier of ESC function are the site-specific proteases of the programmed cell death system (Earnshaw et al., 1999Earnshaw W.C. Martins L.M. Kaufmann S.H. Mammalian caspases: Structure, activation, substrates, and functions during apoptosis.Annu. Rev. Biochem. 1999; 68: 383-424Crossref PubMed Scopus (2370) Google Scholar, Thornberry and Lazebnik, 1998Thornberry N.A. Lazebnik Y. Caspases: Enemies within.Science. 1998; 281: 1312-1316Crossref PubMed Scopus (6018) Google Scholar). The cysteine protease Caspase-3 is especially notable because it not only cleaves vital proteins, but also activates other caspases, such as Caspase-9, that have their own targets. These proteases are very specific for particular amino acid sequences, are highly regulated in their activities, and, in some contexts, appear to influence the decision of cells to differentiate (Arama et al., 2003Arama E. Agapite J. Steller H. Caspase activity and a specific cytochrome C are required for sperm differentiation in Drosophila.Dev. Cell. 2003; 4: 687-697Abstract Full Text Full Text PDF PubMed Scopus (315) Google Scholar, De Botton et al., 2002De Botton S. Sabri S. Daugas E. Zermati Y. Guidotti J.E. Hermine O. Kroemer G. Vainchenker W. Debili N. Platelet formation is the consequence of caspase activation within megakaryocytes.Blood. 2002; 100: 1310-1317Crossref PubMed Scopus (284) Google Scholar, De Maria et al., 1999aDe Maria R. Testa U. Luchetti L. Zeuner A. Stassi G. Pelosi E. Riccioni R. Felli N. Samoggia P. Peschle C. Apoptotic role of Fas/Fas ligand system in the regulation of erythropoiesis.Blood. 1999; 93: 796-803Crossref PubMed Google Scholar, De Maria et al., 1999bDe Maria R. Zeuner A. Eramo A. Domenichelli C. Bonci D. Grignani F. Srinivasula S.M. Alnemri E.S. Testa U. Peschle C. Negative regulation of erythropoiesis by caspase-mediated cleavage of GATA-1.Nature. 1999; 401: 489-493Crossref PubMed Scopus (331) Google Scholar, Ishizaki et al., 1998Ishizaki Y. Jacobson M.D. Raff M.C. A role for caspases in lens fiber differentiation.J. Cell Biol. 1998; 140: 153-158Crossref PubMed Scopus (251) Google Scholar), implying functions other than the execution of cell-death programs. Here we report that caspases play a critical role in ESC differentiation by negatively regulating the self-renewal machinery of these stem cells. We first tested differentiating mouse ESC cultures for the presence of caspase activity. As shown in Figure 1A and Figure S1 available online, such activity began to increase very shortly after the ESCs were stimulated with retinoic acid (RA) or plated in differentiation medium. To exclude an effect from increased apoptosis, we assayed the cultures for the percentage of cells undergoing apoptosis, demonstrating essentially no increases in this end point over 72 hr poststimulation with RA (Figure 1B). To substantiate that the caspase activity peaks were associated with cell differentiation and not programmed cell death, we generated a caspase activity reporter cell line (Caspsensor; Figure S2A) in which enhanced yellow fluorescent protein (EYFP) could be seen in the cytoplasm as long as caspase activity was low or absent but appeared in the nucleus when caspases were active (Figure 1C). In their undifferentiated state, the ESCs showed mainly cytoplasmic EYFP staining, but upon induction of differentiation, the EYFP signal shifted to the nucleus in most or an increased percentage of the ESCs (Figures 1C–1D), indicating the presence of caspase activity. Importantly, none of the caspase-positive cells appeared to be undergoing programmed cell death, as they lacked the classical features of nuclear condensation, nuclear fragmentation, and membrane blebbing (data not shown). Western blot analysis revealed marked differences in the sizes of the EYFPs, indicating that the reporter protein had indeed been cleaved by caspases (Figure S2B). We attribute the slight discrepancy in the kinetics of caspase activity shown in Figures 1A and 1D to the different cell densities required for the respective assays. Finally, we asked if PARP-1, a recognized caspase target during the execution of apoptosis (Lazebnik et al., 1994Lazebnik Y.A. Kaufmann S.H. Desnoyers S. Poirier G.G. Earnshaw W.C. Cleavage of poly(ADP-ribose) polymerase by a proteinase with properties like ICE.Nature. 1994; 371: 346-347Crossref PubMed Scopus (2287) Google Scholar), might also be cleaved after induction of differentiation. Western blot analysis and immunofluorescence microscopy with PARP-1 antibodies revealed what appeared to be cleaved PARP-1 (the p85 fragment) at 48 hr poststimulation of ESCs (Figures 1E and 1F), suggesting that, as in cells undergoing apoptosis, PARP-1 was also cleaved by caspases during differentiation. Thus, differentiating ESCs show increased caspase activity that is not associated with programmed cell death. Because many different caspases could have accounted for the increases in caspase activity seen in our differentiating ESC cultures, we performed a western blot analysis for active caspases in protein lysates from these cultures. Using antibodies against five major caspases, we identified active Caspase-3 in the lysates (Figure 2A) but failed to detect other effector cysteine proteases (data not shown). To demonstrate the functional relevance of Caspase-3 to ESC differentiation, we first exposed the cells to the caspase-blocking peptide VAD and induced differentiation with RA. This treatment clearly inhibited ESC differentiation, although the block was not complete (Figures 2B and 2D, left). Thus, while important for differentiation, Caspase-3 activity may not have been the sole factor contributing to this process. Alternatively, the VAD peptide may not have fully inactivated the protease. To substantiate a requirement for Caspase-3 activity in ESC differentiation, we generated both homozygous and heterozygous lines of Casp3 knockout ESCs (Figure S3A). Deletion of the Casp3 locus lacked any discernible effect in undifferentiated ESCs; however, when exposed to RA, the Casp3−/− ESCs showed an obvious delay in differentiation compared with Casp3+/− cells (Figures 2C and 2D, right). Similar results were obtained when the ESCs were induced to differentiate as embryoid bodies (Figure S3B). As in the caspase blocking experiment, more than 25% of the Casp3−/− ESC colonies showed appreciable signs of differentiation after 5 days, while a substantial proportion of the colonies remained either completely undifferentiated (42%) or only partially differentiated (31%). Quantification of Oct4 expression in Casp3−/− ESCs by PCR (Figure S3C and S3D) showed a reduction in this transcription factor with time after differentiation, reinforcing the idea that a differentiation delay is associated with the absence of this protease in ESCs. We also injected Casp3+/− and Casp3−/− ESCs into immunocompromised mice, observing tumor formation at the injection sites 10–14 days later in both experimental groups. Histological examination of the tumors revealed differentiated cells from all germ layers in mice injected with the Casp3+/− ESCs, in contrast to the mainly undifferentiated or immature cells in Casp3−/− ESCs (Figure 2E; Figure S4). Taken together, the caspase-blocking and Casp3 knockout data support direct involvement of Caspase-3 in ESC differentiation. If Caspase-3 indeed promotes the differentiation of ESCs, it should be possible to demonstrate this effect by modulating levels of the active protease. We therefore made targeted insertions of cDNAs encoding a constitutively active (Casp3rev) or mutated (mCasp3rev) form of Caspase-3 upstream of the HPRT locus of A2lox ESCs; these cDNAs were under the control of a tetracycline-inducible promoter (Figure S5A). Doxycycline induction of higher levels of inducible Caspase-3 in ESCs stimulated differentiation, coinciding with a reduction of Nanog and Oct4 levels, an increase in the expression of miscellaneous differentiation factors, and an obvious change in cell morphology associated with differentiation (Figures 3A–3C). Whether such stimulation favors differentiation to a particular cell type (e.g., endoderm) or simply releases ESCs from the self-renewal machinery to be stimulated by other extrinsic or intrinsic signals required for cell-fate commitment is unclear. To identify the differentiation-specific molecular targets of Caspase-3 in mouse ESCs, we developed an in vitro Caspase-3 cleavage assay and used it to determine the cleavage of Sox2, Oct4, and Nanog transcription factors, all of which maintain ESCs in a self-renewing state. Caspase-3 cleaved human (h) Nanog in vitro (Figure 4A), while Sox2 and Oct4 remained uncleaved (data not shown). Examination of the hNanog amino acid sequence revealed conserved residues at position 69 and at position 70 between the N-terminal transcriptional transactivator (Pan and Pei, 2003Pan G.J. Pei D.Q. Identification of two distinct transactivation domains in the pluripotency sustaining factor nanog.Cell Res. 2003; 13: 499-502Crossref PubMed Scopus (44) Google Scholar) and the homeodomain (Figure 4A) that likely serve as the Caspase-3 cleavage site. Indeed, when a single amino acid in this putative recognition sequence was mutated (yielding D69E hNanog), Caspase-3 was no longer able to cleave the protein in vitro (Figure 4A). We also noted that mouse (m) Nanog has a single amino acid substitution (D > G) at position 64 that is three bases upstream of the Caspase-3 cleavage site, a modification that could decrease the ability of Caspase-3 to cleave mNanog. An in vitro Caspase-3 substrate affinity assay revealed that the cleavage site in mNanog (GSPD) was still targeted by Caspase-3 (Figure S6B). However, after performing the same in vitro cleavage assays as used with hNanog, we observed very little or no cleavage of recombinant mNanog by Caspase-3 (Figure S6A). To determine whether both hNanog and mNanog and their corresponding mutants are cleaved in differentiating ESCs in vivo, we studied all four constructs in ESCs treated with RA (Figure 4B). Western blot analysis revealed cleavage of both wild-type hNanog and wild-type mNanog, but not their mutant forms harboring modified caspase cleavage sites (aa 67 to 68 in mNanog and aa 69 to 70 in hNanog) (Figure 4B). In addition, western blot analysis with antibodies against endogenous Nanog detected a smaller band at 24 and 36 hr postinduction that corresponded to the cleaved form of Nanog (Figure 4C). Thus, given the apparently reduced activity of Caspase-3 toward mNanog in vitro compared with its effective cleavage of this transcription factor in vivo, we hypothesized that another, Caspase-3-dependent protease may function with Caspase-3 to modify the regulatory activity of mNanog. By screening a panel of caspases for their ability to cleave mNanog in vitro (Figure 4D, left), we identified Caspase-9 as the most likely candidate for this role (Figure 4D; Figure S6C). Indeed, others have shown that the activity of Caspase-9 can be drastically enhanced either by active Caspase-3 (Zou et al., 2003Zou H. Yang R. Hao J. Wang J. Sun C. Fesik S.W. Wu J.C. Tomaselli K.K. Armstrong R.C. Regulation of the Apaf-1/Caspase-9 Apoptosome by Caspase-3 and XIAP.J. Biol. Chem. 2003; 278: 8092-8098Google Scholar) or by Procaspase-3 (Yin et al., 2006Yin Q. Park H.O. Chung J.Y. Lin S.-C. Lo Y.-C. da Graca L.S. Jiang X. Wu H. Caspase-9 Holoenzyme Is a Specific and Optimal Procaspase-3 processing Machine.Mol. Cell. 2006; 22: 259-268Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar), supporting an important contribution of Caspase-9 to Nanog cleavage in ESCs. If Nanog is indeed one of the principal targets of Caspases in ESCs, its cleavage should have profound effects on whether the cells remain in a state of pluripotency or differentiate. To test this prediction, we again generated ESCs harboring cDNA coding for hNanog or D69E, the caspase cleavage-resistant form of hNanog targeted upstream of the HPRT locus under the control of a tetracycline-inducible element (Figures S7A and S7B). Importantly, the expression of induced hNanog reached levels comparable to those of endogenous Nanog (Figure S7C). ESCs expressing the D69E form of hNanog had a clear proliferative advantage over cells with the wild-type allele when cultured under conditions that promote differentiation (Figures 4E and 4F). They also lacked evidence of morphological changes, in contrast to ESCs carrying the wild-type form of Nanog (Figure S7D). To assess the antidifferentiation effects of caspase cleavage mNanog, we plated ESCs transfected with wild-type and D67G (cleavage-resistant) mNanog at clonal densities and analyzed colony formation 3 days later. The vast majority of colonies expressing the cleavage-resistant form of mNanog appeared morphologically unaffected and were positive for alkaline phosphatase, whereas a significantly lower number of colonies expressing wild-type mNanog consisted of undifferentiated, alkaline phosphatase-positive cells (Figure 4G). These observations support the hypothesis that caspase-mediated cleavage of Nanog promotes ESC differentiation. Our findings suggest that ESCs exploit caspases for rapid and specific deactivation of Nanog, thus disrupting the autoregulatory circuit that otherwise preserves pluripotency in these cells. They indicate further that Caspase-3 plays a dominant role in this negative regulation by acting directly on Nanog or interacting as a cofactor with Caspase-9, which then deactivates the transcription factor. The action of caspases on Nanog appears to separate the N-terminal domain from the homeodomain, leading to the destabilization and subsequent degradation of the protein. From our experiments, it is clear that both human and mouse Nanog are cleaved by caspases, and therefore, it is likely that both of them are completely interchangeable with regard to caspase-mediated cleavage during the differentiation of ESCs. That the caspase cleavage-resistant forms of Nanog have a significantly stronger antidifferentiation effect in ESCs than does wild-type Nanog firmly suggests that caspase-mediated cleavage of endogenous Nanog plays a critical role in ESC differentiation. The link we have identified between ESC differentiation and programmed cell death helps to explain several poorly understood observations on these ostensibly distinct processes, both in vitro and in the early embryo. For instance, some components of the cell-death system, such as Bcl-2, protect ESCs not only from apoptosis but also from differentiation (Yamane et al., 2005Yamane T. Dylla S.J. Muijtjens M. Weissman I.L. Enforced Bcl-2 expression overrides serum and feeder cell requirements for mouse embryonic stem cell self-renewal.Proc. Natl. Acad. Sci. USA. 2005; 102: 3312-3317Crossref PubMed Scopus (49) Google Scholar), while p53 has been shown to be directly involved in both the control of cell proliferation and apoptosis and the differentiation of ESCs (Lin et al., 2005Lin T. Chao C. Saito S. Mazur S.J. Murphy M.E. Appella E. Xu Y. p53 induces differentiation of mouse embryonic stem cells by suppressing Nanog expression.Nat. Cell Biol. 2005; 7: 165-171Crossref PubMed Scopus (652) Google Scholar). Moreover, other proteolytic components of ESCs, such as the proteasome, appear to have direct roles in the control of stem cell self-renewal (Szutorisz et al., 2006Szutorisz H. Georgiou A. Tora L. Dillon N. The proteasome restricts permissive transcription at tissue-specific gene loci in embryonic stem cells.Cell. 2006; 127: 1375-1388Abstract Full Text Full Text PDF PubMed Scopus (98) Google Scholar). Future studies will need to address the question of whether caspase activity indeed actively promotes differentiation, as our data suggest, or perhaps functions as part of a mechanism for the selective elimination of undifferentiated cells. In either case, the net outcome—cell differentiation—would be the same. Selective targeting of Nanog by caspases is consistent with evidence implicating this transcription factor as a “master” regulator of the pluripotent state (Chambers et al., 2003Chambers I. Colby D. Robertson M. Nichols J. Lee S. Tweedie S. Smith A. Functional expression cloning of Nanog, a pluripotency sustaining factor in embryonic stem cells.Cell. 2003; 113: 643-655Abstract Full Text Full Text PDF PubMed Scopus (2537) Google Scholar, Ivanova et al., 2006Ivanova N. Dobrin R. Lu R. Kotenko I. Levorse J. DeCoste C. Schafer X. Lun Y. Lemischka I.R. Dissecting self-renewal in stem cells with RNA interference.Nature. 2006; 442: 533-538Crossref PubMed Scopus (764) Google Scholar, Mitsui et al., 2003Mitsui K. Tokuzawa Y. Itoh H. Segawa K. Murakami M. Takahashi K. Maruyama M. Maeda M. Yamanaka S. The homeoprotein Nanog is required for maintenance of pluripotency in mouse epiblast and ES cells.Cell. 2003; 113: 631-642Abstract Full Text Full Text PDF PubMed Scopus (2453) Google Scholar). However, given the remarkable complexity of the pathways controlling cell death and differentiation, we find it difficult to imagine how Caspase-3, acting alone or in collaboration with Caspase-9, could be solely responsible for the mediation of proliferation versus differentiation choices in ESCs. We predict, instead, that other mediators of cell death participate in this critical developmental transition, possibly by targeting pluripotency factors other than Nanog. This hypothesis is supported by the absence of any overt phenotype in the preimplantation embryos of Casp3 knockout mice (Kuida et al., 1996Kuida K. Zheng T.S. Na S. Kuan C. Yang D. Karasuyama H. Rakic P. Flavell R.A. Decreased apoptosis in the brain and premature lethality in CPP32-deficient mice.Nature. 1996; 384: 368-372Crossref PubMed Scopus (1655) Google Scholar, Woo et al., 1998Woo M. Hakem R. Soengas M.S. Duncan G.S. Shahinian A. Kagi D. Hakem A. McCurrach M. Khoo W. Kaufman S.A. et al.Essential contribution of caspase-3/CPP32 to apoptosis and iys associated nuclear changes.Genes Dev. 1998; 12: 806-819Crossref PubMed Scopus (743) Google Scholar). Our results leave unanswered the major question of why Caspase-3 activation during differentiation is limited and does not self-amplify as seen during apoptosis. Potential mechanisms for such control of caspase activity include subcellular localization of the enzyme, the caspase activity level itself, phosphorylation or other forms of structural modification, as well as direct or indirect interaction with protein inhibitors, such as IAPs. Given that ESCs carrying the cleavage-resistant form of Nanog proliferate better than those with the wild-type allele, it seems reasonable to suggest that the cleaved form of Nanog might exert a dominant-negative effect on some of the normal functions of Nanog. A more comprehensive understanding of the molecular pathways controlling ESC self-renewal and differentiation, in particular the apparent molecular link between programmed cell death and cell differentiation, would not only accelerate efforts to generate clinically relevant cell types from ESCs but may also facilitate the reprogramming of differentiated cells to enter a pluripotent state (Okita et al., 2007Okita K. Ichisaka T. Yamanaka S. Generation of germline-competent induced pluripotent stem cells.Nature. 2007; 448: 313-317Crossref PubMed Scopus (3359) Google Scholar), (Silva et al., 2006Silva J. Chambers I. Pollard S. Smith A. Nanog promotes transfer of pluripotency after cell fusion.Nature. 2006; 441: 997-1001Crossref PubMed Scopus (285) Google Scholar), for example, by blocking caspase activity. We consider the affinity of Caspase-3 and Caspase-9 for the transcription factor Nanog to be a paradigm for other potential caspase targets in ESCs; hence, it should be possible to exploit the caspases in experimental screens to identify other factors that regulate stem cell pluripotency. Finally, the involvement of caspases in nonapoptotic pathways, as demonstrated here and elsewhere (Arama et al., 2003Arama E. Agapite J. Steller H. Caspase activity and a specific cytochrome C are required for sperm differentiation in Drosophila.Dev. Cell. 2003; 4: 687-697Abstract Full Text Full Text PDF PubMed Scopus (315) Google Scholar, De Botton et al., 2002De Botton S. Sabri S. Daugas E. Zermati Y. Guidotti J.E. Hermine O. Kroemer G. Vainchenker W. Debili N. Platelet formation is the consequence of caspase activation within megakaryocytes.Blood. 2002; 100: 1310-1317Crossref PubMed Scopus (284) Google Scholar, De Maria et al., 1999aDe Maria R. Testa U. Luchetti L. Zeuner A. Stassi G. Pelosi E. Riccioni R. Felli N. Samoggia P. Peschle C. Apoptotic role of Fas/Fas ligand system in the regulation of erythropoiesis.Blood. 1999; 93: 796-803Crossref PubMed Google Scholar, De Maria et al., 1999bDe Maria R. Zeuner A. Eramo A. Domenichelli C. Bonci D. Grignani F. Srinivasula S.M. Alnemri E.S. Testa U. Peschle C. Negative regulation of erythropoiesis by caspase-mediated cleavage of GATA-1.Nature. 1999; 401: 489-493Crossref PubMed Scopus (331) Google Scholar, Ishizaki et al., 1998Ishizaki Y. Jacobson M.D. Raff M.C. A role for caspases in lens fiber differentiation.J. Cell Biol. 1998; 140: 153-158Crossref PubMed Scopus (251) Google Scholar), suggests that efforts to block apoptosis via caspase inhibition for therapeutic purposes may have much broader implications than initially thought, especially for stem cells. The mouse ESC lines used were as follows: D3 (from ATCC, no. CRL11632), R1 (from Andras Nagy, Toronto), and E14Tg2a-derived A2lox (from Michael Kyba, UT Southwestern Medical Center) Cells were typically used between passages 10 and 20. A2lox ESCs express the reverse tetracycline transactivator from the endogenous Rosa26 locus and carry an insertion containing a tetracycline response element, loxP-lox2272 sites and the neomycinΔATG-resistance gene upstream of HPRT on the X chromosome. To generate inducible derivatives, we subcloned cDNAs into the p2Lox targeting vector. Cre/Lox recombination was used to insert p2Lox into the inducible locus as described previously (Kyba et al., 2003Kyba M. Perlingeiro R.C. Hoover R.R. Lu C.W. Pierce J. Daley G.Q. Enhanced hematopoietic differentiation of embryonic stem cells conditionally expressing Stat5.Proc. Natl. Acad. Sci. USA. 2003; 100: 11904-11910Crossref PubMed Scopus (54) Google Scholar). The medium contained 10% FBS (Innovative Research, cat. no. IFBF-H) tested for toxicity to ESCs in a colony-forming assay (Evans, 2004Evans M. Isolation and Maintenance of Murine Embryonic Stem Cells.in: Lanza R. Handbook of Stem Cells. Elsevier Academic Press, Burlington2004: 413-417Crossref Scopus (3) Google Scholar) that included Knockout DMEM (Invitrogen, cat. no. 10829-018), 1x nonessential amino acids (Invitrogen, cat. no. 111140-050), L-glutamine 1% v/v (Invitrogen, cat. no. 25030-081), 2-mercaptoethanol (3.5 μl per 250 ml medium; Sigma, cat. no. M7522), LIF 1000 per ml (Esgro, cat. no. ESG1107). Cells were routinely maintained on irradiated (8400 rad) mouse embryonic fibroblasts (MEFs) derived from E14.5-old embryos (mouse strain CF1, Charles River timed pregnant mice). For some experiments, ESCs were placed onto 0.1% gelatin type A (Sigma, cat. no. G1890)-coated dishes and passaged 2 to 4 times before the experiment was carried out. For differentiation studies, standard medium was replaced with medium containing 1 μM retinoic acid (RA, Sigma, cat. no. R2625) without LIF or N2B27 medium (Ying et al., 2003Ying Q.L. Stavridis M. Griffiths D. Li M. Smith A. Conversion of embryonic stem cells into neuroectodermal precursors in adherent monoculture.Nat. Biotechnol. 2003; 21: 183-186Crossref PubMed Scopus (1105) Google Scholar). Trypsinized ESCs (R1, 200,000; D3, 250,000) were plated into 6 wells containing normal ESC medium, and on the next day, the medium was changed to 1 μM RA differentiation medium. Cells were harvested with trypsin-EDTA (Invitrogen, cat. no. 25300-054), and protein extracts were made in 0.1% CHAPS buffer, pH 7.2 (50 mM HEPES; 150 mM KCl; 1x protease inhibitors [Roche, cat. no. 1697498001]); 2 mM Na fluoride, and orthovanadate, respectively, at specified time points. The CaspGlo (Promega, cat. no. G8091) kit was used to directly measure caspase activity. Before determining caspase activity, we tested the system for variability within the dynamic range using recombinant caspase-3 (BD Bioscience, cat. no. 556471). The signal was measured with the Wallac 1429 VictorII instrument (Perkin-Elmer, Wellesley, MA). ESCs were derived from E3.5-old mouse embryos. Briefly on day 1, caspase-3 homozygous (Kuida et al., 1996Kuida K. Zheng T.S. Na S. Kuan C. Yang D. Karasuyama H. Rakic P. Flavell R.A. Decreased apoptosis in the brain and premature lethality in CPP32-deficient mice.Nature. 1996; 384: 368-372Crossref PubMed Scopus (1655) Google Scholar) and control C57/BL6 female mice were injected i.p. with 5 IU of PMS (Calbiochem, cat. no. 367222). Forty-six hours later, the female mice received an i.p. injection of 5 IU human chorionic gonadotropin (HCG; Calbiochem, cat. no. 230734). Stimulated females were placed into a cage with 8-week-old caspase-3-homozygous stud males. Blastocysts were collected on day 3 postcoitum in the afternoon. The blastocysts were placed onto irradiated mouse embryonic feeder cells and incubated for 3 days in ESC medium, trypsinized, and replated. Colonies apparent on day 7 were picked, expanded, and genotyped with use of the following primers: mCasp3-S, TGTCATCTCGCTCTGGTACG; mCasp3-AS, CCCTTTCTGCCTGTCTTCTG (PCR product SIZE 310 bp); Neomycin-S, AGACAATCGGCTGCTCTGAT; Neomycin-AS, ATACTTTCTCGGCAGGAGCA (PCR product size 260 bp); mOct4-S, GGCGTTCTCTTTGGAAAGGTGTTC; mOct4-AS, CTCGAACCACATCCTTCTCT (PCR product size 312 bp); Actin-S, GGCCCAGAGCAAGAGAGGTATCC, Actin-AS, ACGCACGATTTCCCTCTCAGC (PCR product size 460 bp). For PCR, we used GoTaq green master mix (Promega, cat. no. M7112) with the following program: 1 cycle at 95°C for 3 min followed by 40 cycles with 95°C for 30 s, 58°C for 30, and 72°C for 30 sec for 30 s followed by one extension of 10 min at 72°C. We generated two caspase-3 knockout cell lines (34A and 34B) and two control caspase-3 heterozygote cell line (22A and 22B). All experiments were carried out with these four cell lines and yielded essentially the same results. We used a constitutively active caspase-3 gene (Casp3rev) as described in Srinivasula et al., 1998Srinivasula S.M. Ahmad M. MacFarlane M. Luo Z. Huang Z. Fernandes-Alnemri T. Alnemri E.S. Generation of constitutively active recombinant caspases-3 and -6 by rearrangement of their subunits.J. Biol. Chem. 1998; 273: 10107-10111Crossref PubMed Scopus (136) Google Scholar and a mutated version of Casp3rev (C1635) as described in Kamada et al., 1998Kamada S. Kusano H. Fujita H. Ohtsu M. Koya R.C. Kuzumaki N. Tsujimoto Y. A cloning method for caspase substrates that uses the yeast two-hybrid system: Cloning of the antiapoptotic gene gelsolin.Proc. Natl. Acad. Sci. USA. 1998; 95: 8532-8537Crossref PubMed Scopus (92) Google Scholar. These active and inactive forms of caspase-3 were derived from the plasmids pGEMCasp3rev (6730 bp) and pGEM MutCas3rev (3867 bp). The caspase-3 inserts were cut out of their backbone vectors with EcoRI, and the insert (874 bp) was cloned by blunt end ligation into the pLoxP2 vector and digested with XhoI-SmaI (3549 bp). The vector was coelectroporated with pSalk-Cre into 30 × 106 A172 cells (960 μF, 25 millisec pulse). After electroporation, the cells were selected with G418 (400 μg/ml), and individual clones were picked and subsequently expanded. For the differentiation experiment, cells were plated into 6-well plates (1 × 105/well) and stimulated with 1 μg/ml doxycycline (Sigma, cat. no. D9891) for 36 hr. They were then harvested, and western blots for Oct4 (H-134 Santa Cruz, cat. no. SC9081), Nanog (Abcam, cat. no. AB14959; Chemicon 1/1000), and beta-tubulin (D10; Santa Cruz, cat. no. SC5274) were performed. Secondary antibodies (dilutions 1/5000 and 1/10000) consist of Alexa-680 antirabbit (Molecular Probes, cat. no. A21077) or IRday 800 antirabbit (Rockland, cat. no. 611-131-121). The signal was detected with the Odyssey system. Human Nanog was obtained from ATCC (cDNA clone cat. no. 10806397; Image Clone IDm no. 40004923; Gene Bank ID no. BC09827) and subcloned into pCR-BlendII-TOPO (Invitrogen). The mutation D69E was introduced into human hNanog with a site-directed mutagenesis kit (Quickchange II, Stratagene). Sequencing of both clones confirmed the identity of the human Nanog cDNA wild-type (TOPOT-Nanog) and D69E mutation (TOPO-mut -Nanog). In vitro transcription and translation were performed according to the manufacturer's protocol (Promega, cat. no. L520A). TOPO-Nanog and TOPO-D69E-Nanog plasmid 1 μg was incubated at 30°C with T7 quick master mix and 1 mM methionine plus biotin-tRNA (Promega, cat. no. L506A) in a total volume of 50 μl. The reaction was stopped after 90 min, and aliquots frozen at −80 C°. Biotin-labeled human hNanog and D69E-Nanog were detected after transfer to nitrocellulose membranes with streptavidin Alexa fluor 680− (Molecular Probes, cat. no. S21378, dilution 1/10000). Protein was digested with 40 ng recombinant active caspase-3 (BD Bioscience, cat. no. 51-66281V) in a total volume of 15 μl at pH 7.5 (6 mM Tris-Cl, 1.2 mM CaCl2, 1 mM KCl, 5 mM DTT, and 1.5 mM MgCl2) (Laugwitz et al., 2001Laugwitz K.L. Moretti A. Weig H.J. Gillitzer A. Pinkernell K. Ott T. Pragst I. Stadele C. Seyfarth M. Schomig A. Ungerer M. Blocking caspase-activated apoptosis improves contractility in failing myocardium.Hum. Gene Ther. 2001; 12: 2051-2063Crossref PubMed Scopus (85) Google Scholar). The reaction product was run on 4%–20% gradient PAGE gels (Bio-Rad), and protein was detected as previously described (streptavidin, Alexa Fluor 680 Odyssey system, LI-COR). Nanog and D69E-Nanog clones were plated at a density of 5000 cells into 96-well plates, incubated overnight, and then stimulated with RA for specified times. Cells were then pulsed with methyl-3H thymidine (Perkin Elmer, NET027) for 3 hr and harvested (Packard Filtermate harvester), and scintillation counts were measured with the Packard Topocount-NXT Microplate Scintillation and Luminescence Counter. The inducible cell lines Nanog, D69E mutated Nanog, EGFP, and control A172 were plated and incubated over night with 1 μM doxycycline. The Nanog inducible, D69E Nanog and A172 ESC lines were mixed with the EGFP inducible cell line in a ratio of 20:80 and plated on the next day. Cells were maintained in ESC medium without LIF. The percentage of EGFP-positive cells was determined with a FACScan instrument (Becton Dickinson) on days 0, 4, 8, 12, and 16 after plating. We thank Dr. David Spencer (Baylor College of Medicine) for providing us with the EF1a-Luc-IRES-NEO vector and Kimberly Smuga-Otto and Kristopher Murphy for technical assistance. This work was supported by the Lance Armstrong Foundation (T.P.Z.), the Gillson Longenbaugh Foundation (T.P.Z.), the Tilker Medical Research Foundatiom (T.P.Z.), the Diana Helis Henry Medical Research Foundation (T.P.Z.), the Huffington Foundation (T.P.Z.), the Uehara Memorial Foundation (J.F.), and by the NIH (grants R01 EB005173-01, P20 EB007076, and P01 GM81627). R.A.F. is an investigator of the Howard Hughes Medical Institute. Download .pdf (1.42 MB) Help with pdf files Document S1. Seven Supplemental Figures and Supplemental Experimental Procedures" @default.
• W2087367624 created "2016-06-24" @default.
• W2087367624 creator A5025062503 @default.
• W2087367624 creator A5032780614 @default.
• W2087367624 creator A5045541762 @default.
• W2087367624 creator A5058149977 @default.
• W2087367624 creator A5066264652 @default.
• W2087367624 creator A5079458533 @default.
• W2087367624 creator A5081234985 @default.
• W2087367624 creator A5088249209 @default.
• W2087367624 date "2008-06-01" @default.
• W2087367624 modified "2023-10-16" @default.
• W2087367624 title "Caspase Activity Mediates the Differentiation of Embryonic Stem Cells" @default.
• W2087367624 cites W1547637047 @default.
• W2087367624 cites W1555869617 @default.
• W2087367624 cites W1967359216 @default.
• W2087367624 cites W1967912613 @default.
• W2087367624 cites W1968931043 @default.
• W2087367624 cites W1975200987 @default.
• W2087367624 cites W1976878409 @default.
• W2087367624 cites W1980331623 @default.
• W2087367624 cites W1987785848 @default.
• W2087367624 cites W1987983547 @default.
• W2087367624 cites W2000407232 @default.
• W2087367624 cites W2002929796 @default.
• W2087367624 cites W2010298858 @default.
• W2087367624 cites W2053911973 @default.
• W2087367624 cites W2061497413 @default.
• W2087367624 cites W2062118486 @default.
• W2087367624 cites W2088877376 @default.
• W2087367624 cites W2107575419 @default.
• W2087367624 cites W2111440980 @default.
• W2087367624 cites W2111650534 @default.
• W2087367624 cites W2126851387 @default.
• W2087367624 cites W2134427620 @default.
• W2087367624 cites W2140559522 @default.
• W2087367624 cites W2145340234 @default.
• W2087367624 cites W2146974608 @default.
• W2087367624 cites W2148379964 @default.
• W2087367624 cites W2150163104 @default.
• W2087367624 cites W2152826290 @default.
• W2087367624 cites W2153424791 @default.
• W2087367624 cites W2157196545 @default.
• W2087367624 cites W2158610627 @default.
• W2087367624 cites W4211118035 @default.
• W2087367624 doi "https://doi.org/10.1016/j.stem.2008.04.001" @default.
• W2087367624 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/2494585" @default.
• W2087367624 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/18522852" @default.
• W2087367624 hasPublicationYear "2008" @default.
• W2087367624 type Work @default.
• W2087367624 sameAs 2087367624 @default.
• W2087367624 citedByCount "253" @default.
• W2087367624 countsByYear W20873676242012 @default.
• W2087367624 countsByYear W20873676242013 @default.
• W2087367624 countsByYear W20873676242014 @default.
• W2087367624 countsByYear W20873676242015 @default.
• W2087367624 countsByYear W20873676242016 @default.
• W2087367624 countsByYear W20873676242017 @default.
• W2087367624 countsByYear W20873676242018 @default.
• W2087367624 countsByYear W20873676242019 @default.
• W2087367624 countsByYear W20873676242020 @default.
• W2087367624 countsByYear W20873676242021 @default.
• W2087367624 countsByYear W20873676242022 @default.
• W2087367624 countsByYear W20873676242023 @default.
• W2087367624 crossrefType "journal-article" @default.
• W2087367624 hasAuthorship W2087367624A5025062503 @default.
• W2087367624 hasAuthorship W2087367624A5032780614 @default.
• W2087367624 hasAuthorship W2087367624A5045541762 @default.
• W2087367624 hasAuthorship W2087367624A5058149977 @default.
• W2087367624 hasAuthorship W2087367624A5066264652 @default.
• W2087367624 hasAuthorship W2087367624A5079458533 @default.
• W2087367624 hasAuthorship W2087367624A5081234985 @default.
• W2087367624 hasAuthorship W2087367624A5088249209 @default.
• W2087367624 hasBestOaLocation W20873676241 @default.
• W2087367624 hasConcept C104317684 @default.
• W2087367624 hasConcept C145103041 @default.
• W2087367624 hasConcept C148738053 @default.
• W2087367624 hasConcept C190283241 @default.
• W2087367624 hasConcept C28328180 @default.
• W2087367624 hasConcept C31573885 @default.
• W2087367624 hasConcept C54355233 @default.
• W2087367624 hasConcept C86803240 @default.
• W2087367624 hasConcept C95444343 @default.
• W2087367624 hasConcept C98424977 @default.
• W2087367624 hasConceptScore W2087367624C104317684 @default.
• W2087367624 hasConceptScore W2087367624C145103041 @default.
• W2087367624 hasConceptScore W2087367624C148738053 @default.
• W2087367624 hasConceptScore W2087367624C190283241 @default.
• W2087367624 hasConceptScore W2087367624C28328180 @default.
• W2087367624 hasConceptScore W2087367624C31573885 @default.
• W2087367624 hasConceptScore W2087367624C54355233 @default.
• W2087367624 hasConceptScore W2087367624C86803240 @default.
• W2087367624 hasConceptScore W2087367624C95444343 @default.
• W2087367624 hasConceptScore W2087367624C98424977 @default.
• W2087367624 hasIssue "6" @default.
• W2087367624 hasLocation W20873676241 @default.
• W2087367624 hasLocation W20873676242 @default.
• W2087367624 hasLocation W20873676243 @default.

• next