FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2087555143> ?p ?o ?g. }

• W2087555143 endingPage "35022" @default.
• W2087555143 startingPage "35010" @default.
• W2087555143 abstract "The yeast Pdr5 multidrug transporter is an important member of the ATP-binding cassette superfamily of proteins. We describe a novel mutation (S558Y) in transmembrane helix 2 of Pdr5 identified in a screen for suppressors that eliminated Pdr5-mediated cycloheximide hyper-resistance. Nucleotides as well as transport substrates bind to the mutant Pdr5 with an affinity comparable with that for wild-type Pdr5. Wild-type and mutant Pdr5s show ATPase activity with comparable Km(ATP) values. Nonetheless, drug sensitivity is equivalent in the mutant pdr5 and the pdr5 deletion. Finally, the transport substrate clotrimazole, which is a noncompetitive inhibitor of Pdr5 ATPase activity, has a minimal effect on ATP hydrolysis by the S558Y mutant. These results suggest that the drug sensitivity of the mutant Pdr5 is attributable to the uncoupling of NTPase activity and transport. We screened for amino acid alterations in the nucleotide-binding domains that would reverse the phenotypic effect of the S558Y mutation. A second-site mutation, N242K, located between the Walker A and signature motifs of the N-terminal nucleotide-binding domain, restores significant function. This region of the nucleotide-binding domain interacts with the transmembrane domains via the intracellular loop-1 (which connects transmembrane helices 2 and 3) in the crystal structure of Sav1866, a bacterial ATP-binding cassette drug transporter. These structural studies are supported by biochemical and genetic evidence presented here that interactions between transmembrane helix 2 and the nucleotide-binding domain, via the intracellular loop-1, may define at least part of the translocation pathway for coupling ATP hydrolysis to drug transport. The yeast Pdr5 multidrug transporter is an important member of the ATP-binding cassette superfamily of proteins. We describe a novel mutation (S558Y) in transmembrane helix 2 of Pdr5 identified in a screen for suppressors that eliminated Pdr5-mediated cycloheximide hyper-resistance. Nucleotides as well as transport substrates bind to the mutant Pdr5 with an affinity comparable with that for wild-type Pdr5. Wild-type and mutant Pdr5s show ATPase activity with comparable Km(ATP) values. Nonetheless, drug sensitivity is equivalent in the mutant pdr5 and the pdr5 deletion. Finally, the transport substrate clotrimazole, which is a noncompetitive inhibitor of Pdr5 ATPase activity, has a minimal effect on ATP hydrolysis by the S558Y mutant. These results suggest that the drug sensitivity of the mutant Pdr5 is attributable to the uncoupling of NTPase activity and transport. We screened for amino acid alterations in the nucleotide-binding domains that would reverse the phenotypic effect of the S558Y mutation. A second-site mutation, N242K, located between the Walker A and signature motifs of the N-terminal nucleotide-binding domain, restores significant function. This region of the nucleotide-binding domain interacts with the transmembrane domains via the intracellular loop-1 (which connects transmembrane helices 2 and 3) in the crystal structure of Sav1866, a bacterial ATP-binding cassette drug transporter. These structural studies are supported by biochemical and genetic evidence presented here that interactions between transmembrane helix 2 and the nucleotide-binding domain, via the intracellular loop-1, may define at least part of the translocation pathway for coupling ATP hydrolysis to drug transport. Multidrug transporters, including members of the ATP-binding cassette (ABC) 2The abbreviations used are: ABC, ATP-binding cassette; cyh, cycloheximide; 5-FOA, 5-fluoroorotic acid; ICL, intracellular loop; NBD, nucleotide-binding domain; P-gp, P-glycoprotein; PM, plasma membrane; R6G, rhodamine 6G; TMD, transmembrane domain; TMH, transmembrane helix; WT, wild type; IAAP, iodoarylazidoprazosin; clo, clotrimazole; Vi, vanadate.2The abbreviations used are: ABC, ATP-binding cassette; cyh, cycloheximide; 5-FOA, 5-fluoroorotic acid; ICL, intracellular loop; NBD, nucleotide-binding domain; P-gp, P-glycoprotein; PM, plasma membrane; R6G, rhodamine 6G; TMD, transmembrane domain; TMH, transmembrane helix; WT, wild type; IAAP, iodoarylazidoprazosin; clo, clotrimazole; Vi, vanadate. family, show unusual flexibility toward their substrate cargo. They efflux structurally diverse xenobiotic compounds and confer broad-spectrum hyperresistance when they are overexpressed, a property that impedes chemotherapeutic treatment of pathogens and cancer.Several fungi, including the clinically relevant human pathogenic species Candida albicans and Cryptococcus neoformans, contain major multidrug transporters that are close homologues to the Saccharomyces cerevisiae transporter Pdr5 (1.Posteraro B. Sanguinetti M. Sanglard D. La Sorda M. Boccia S. Romano L. Morace G. Fadda G. Mol. Microbiol. 2003; 47: 357-371Crossref PubMed Scopus (99) Google Scholar). It is well established that many clinical isolates of C. albicans overproduce the Pdr5 homologue Cdr1 (2.White T.C. Marr K.A. Bowden R.A. Clin. Microbiol. Rev. 1998; 11: 382-396Crossref PubMed Google Scholar). Multidrug-resistant fungi are an increasing problem in the treatment of immunocompromised patients with AIDS and cancer (3.Monk B.C. Goffeau A. Science. 2008; 321: 367-369Crossref PubMed Scopus (108) Google Scholar).The Pdr5 subfamily of multidrug transporters shows significant differences in molecular architecture from their mammalian counterparts such as P-glycoprotein (P-gp) or Mrp1. The nucleotide-binding domains (NBDs) of these important fungal transporters precede the transmembrane domains (TMDs) and thus their orientation is the reverse of P-gps and Mrp1s. Furthermore, the Walker A, B, and signature motifs are degenerate when compared with nonfungal ABC counterparts. For example, a cysteine replaces a lysine in Walker A (Cys-199) of the N-terminal NBD (NBD1) that is essential in other ABC transporters (1.Posteraro B. Sanguinetti M. Sanglard D. La Sorda M. Boccia S. Romano L. Morace G. Fadda G. Mol. Microbiol. 2003; 47: 357-371Crossref PubMed Scopus (99) Google Scholar).Not surprisingly, the ATPase activities of Pdr5 and C. albicans Cdr1p appear to be similar (4.Decottignies A. Kolaczkowski M. Balzi E. Goffeau A. J. Biol. Chem. 1994; 269: 12797-12803Abstract Full Text PDF PubMed Google Scholar, 5.Golin J. Kon Z.N. Wu C.P. Martello J. Hanson L. Supernavage S. Ambudkar S.V. Sauna Z.E. Biochemistry. 2007; 46: 13109-13119Crossref PubMed Scopus (44) Google Scholar, 6.Nakamura K. Niimi M. Niimi K. Holmes A.R. Yates J.E. Decottignies A. Monk B.C. Goffeau A. Cannon R.D. Antimicrob. Agents Chemother. 2001; 45: 3366-3374Crossref PubMed Scopus (165) Google Scholar, 7.Shukla S. Rai V. Banerjee D. Prasad R. Biochemistry. 2006; 45: 2425-2435Crossref PubMed Scopus (37) Google Scholar). For example, both have high basal (unstimulated) levels. Recently, we demonstrated that Pdr5 also hydrolyzes GTP at physiological concentrations and that this activity is considerably more resistant to some substrates, such as clotrimazole (clo), than is its ATPase activity. Furthermore, GTP fuels Pdr5-mediated chloramphenicol efflux in purified vesicles (5.Golin J. Kon Z.N. Wu C.P. Martello J. Hanson L. Supernavage S. Ambudkar S.V. Sauna Z.E. Biochemistry. 2007; 46: 13109-13119Crossref PubMed Scopus (44) Google Scholar). These results suggest that Pdr5 has great flexibility not only in the drug cargo that it transports but also in its efflux energy source.Considerable progress has been made in recent decades in understanding the domain organization of ABC transporters and the mechanism of the transport cycle (8.Sauna Z.E. Ambudkar S.V. Mol. Cancer Ther. 2007; 6: 13-23Crossref PubMed Scopus (121) Google Scholar). A typical ABC protein consists of four domains, two TMDs and two NBDs. The TMDs contain the drug-binding sites, which show little sequence similarity in different ABC transporters. By contrast, the NBDs exhibit very high sequence similarity.The activity of an ABC transporter hinges on the effective coupling of the ATP catalytic cycle, which occurs at the NBDs, and the drug-transport cycle, which occurs at the TMDs. Mutational analyses, labeling with the photoaffinity drug or nucleotide analogues, and cross-linking with the thiol-reactive substrate derivatives have yielded a wealth of information about interactions at the drug-binding domains as well as about the role of conserved residues in the NBDs. Biochemical and genetic studies suggested the existence of a transmission interface that couples the energy of ATP binding and/or hydrolysis to conformational changes at the TMDs (9.Jones P.M. George A.M. Cell. Mol. Life Sci. 2004; 61: 682-699Crossref PubMed Scopus (441) Google Scholar). These studies have taken indirect approaches, however, such as the determining the effect of drugs on ATP hydrolysis.The recent elucidation of the x-ray structure of Sav1866, a bacterial ABC transporter (10.Dawson R.J.P. Locher K.P. Nature. 2006; 443: 180-185Crossref PubMed Scopus (1066) Google Scholar), has permitted the delineation of such a transmission interface in more precise detail. A novel feature of this structure is that both NBDs contact the TMDs. These contacts occur via intracellular loops (ICLs) that link the transmembrane helices. The organization of the structure of this domain suggests a plausible explanation for the mechanical coupling between the NBDs and TMDs of ABC transporters. In addition, recent studies with P-gp and Yor1 used site-directed mutagenesis and cross-linking agents to demonstrate the proximity of ICL2 and the Q-loop (11.Pagant S. Brovman E.Y. Halliday J.J. Miller E.A. J. Biol. Chem. 2008; 283: 26444-26451Abstract Full Text Full Text PDF PubMed Scopus (22) Google Scholar, 12.Zolnerciks J.K. Wooding C. Linton K.J. FASEB J. 2007; 21: 3937-3948Crossref PubMed Scopus (110) Google Scholar). These studies show or imply a physical interaction, but none establish that these regions are involved in communication between the TMDs and NBDs. Demonstrating the functional relevance of such interactions remains a challenge.Here we describe the behavior of an S558Y mutation in transmembrane helix 2 (TMH2) that retains significant ATPase activity and drug-binding capability but nevertheless tests as phenotypically null for drug resistance and transport. Furthermore, an allosteric inhibitory signal mediated by the Pdr5-specific transport substrate clotrimazole is greatly diminished. These deficiencies are significantly alleviated by a suppressor mutation that lies near the Q-loop of NBD1. This is a particularly important observation because recent work suggests that the noncanonical NBD1 of Pdr5 may not play a catalytic role in ATP hydrolysis (13.Ernst R. Kueppers P. Klein C.M. Schwarzmueller T. Kuchler K. Schmitt L. Proc. Natl. Acad. Sci. U. S. A. 2008; 105: 5069-5074Crossref PubMed Scopus (112) Google Scholar).Our results are thus consistent with the x-ray crystallographic structure of Sav1866 and suggest that even evolutionarily distant ABC transporters have a similar coupling interface. Moreover, our strategy of using suppressor mutations to identify the interacting residues in the TMDs and NBDs has obvious advantages over the use of site-directed mutagenesis. This powerful approach can also be applied to any mammalian transporter that is expressed in yeast and has a readily observable phenotype.EXPERIMENTAL PROCEDURESStrains and Genetic Transformation—The strains used in this study are listed in Table 1. All are isogenic to each other and derived from AD1–7, which lacks all PM ABC transporters but contains a PDR1–3 allele that results in overexpression of PDR5 when a plasmid containing this gene is integrated into its chromosomal location. The construction of JG2000 and JG2001 was described previously (5.Golin J. Kon Z.N. Wu C.P. Martello J. Hanson L. Supernavage S. Ambudkar S.V. Sauna Z.E. Biochemistry. 2007; 46: 13109-13119Crossref PubMed Scopus (44) Google Scholar).TABLE 1Yeast strains used in this study All the strains are isogenic derivatives of AD1–7, with the exception of JG365-3B.StrainRelevant genotypeSource or Ref.JG365-3BMat a PDR5 PDR1-3 ura3 leu235.Meyers S. Schauer W. Balzi E. Wagner M. Goffeau A. Golin J. Curr. Genet. 1992; 21: 431-436Crossref PubMed Scopus (124) Google ScholarAD1–7MATα PDR1-3 ura3 his1 yor1 pdr5 snq2 pdr10 ycf1 pdr11 pdr336.Rogers B. Decottignies A. Kolaczkowski M. Carvajal E. Balzi E. Goffeau A. J. Mol. Microbiol. Biotechnol. 2001; 3: 207-214PubMed Google Scholar; ura3 derivative made by J. GolinJG2000AD1–7 + pSS6075.Golin J. Kon Z.N. Wu C.P. Martello J. Hanson L. Supernavage S. Ambudkar S.V. Sauna Z.E. Biochemistry. 2007; 46: 13109-13119Crossref PubMed Scopus (44) Google ScholarJG2001ura3, PDR5 5-FOA derivative of JG20005.Golin J. Kon Z.N. Wu C.P. Martello J. Hanson L. Supernavage S. Ambudkar S.V. Sauna Z.E. Biochemistry. 2007; 46: 13109-13119Crossref PubMed Scopus (44) Google ScholarJG2003JG2001 + pS558YThis studyJG2004JG2001 + pSS607This studyJG2005AD1–7 + pS558YThis studyJG2009ura3, S558Y derivative of JG2003This studyJG2010JG2009 + pS558YThis studyR-1Δpdr5::KANMX4 replaces PDR5 in JG2001This studyJG2011R-1 + pS558YThis studyJG2012R-1 + pS558AThis studyJG2015R-1 + pSS607 (wild-type control)This studyJG2016R-1 + pN242KThis studyJG2020clo-3-0 + pS558Y, N242KThis studyJG2021R-1 + pS558Y, N242KThis study Open table in a new tab We also constructed several new AD1–7 derivatives. The first series of strains carry two copies of PDR5 either as wild type (WT; JG2004) or mutant (JG2010). These strains produce significantly more Pdr5 than does the popular single-copy strain AD124567 and are thus invaluable for biochemical studies. JG2004 was created by transforming JG2001 with pSS607, the plasmid containing the WT gene PDR5.The JG2009 strain contains a single copy of the S558Y allele and was used to create JG2010. A PDR5-bearing strain (JG2001) was transformed with S558Y to create JG2003. Treatment with 5-fluoorotic acid (5-FOA) (14.Boeke J.D. Trueheart J. Natsoulis G. Fink G.R. Methods Enzymol. 1987; 154: 164-175Crossref PubMed Scopus (1067) Google Scholar) yielded Ura- segregants (9/22) that were multidrug-sensitive and thus contained S558Y. We retained one of these and designated it JG2009. Transformation of this strain with an S558Y plasmid resulted in JG2010, which contains a tandem duplication of the mutant allele and is the mutant equivalent of JG2004.We designed another strain, R-1, to obviate a basic problem found in AD1–7. This strain carries only a partial deletion of PDR5 (from -187 to 1437 (15.Katzmann D.J. Hallstrom T.C. Voet M. Wysock W. Golin J. Volckaert G. Moylerowley W.S. Mol. Cell. Biol. 1995; 15: 6875-6883Crossref PubMed Scopus (199) Google Scholar)). When we introduce into AD1–7 a pdr5 mutation located in the coding sequence beyond approximately the first 445 residues, a WT gene is sometimes reconstituted by homologous recombination. By contrast, the entire coding region of PDR5 is replaced in R-1 by a KANMX4 (geneticin-resistant) cassette that we PCR-amplified from BY2909 as described previously (16.Rutledge R.M. Ghislain M. Mullins J.M. de Thozee C.P. Golin J. Mol. Genet. Genomics. 2008; 279: 573-583Crossref PubMed Scopus (4) Google Scholar). This strain is otherwise phenotypically indistinguishable from AD1–7.All of these new isogenic strains are available from the corresponding author. We used a Gietz transformation kit (Medicorp, Montreal, Quebec, Canada) to introduce plasmids and PCR-generated products into yeast.Plasmids and Site-directed Mutagenesis—We created all site-directed mutants from the plasmid pSS607, which was described previously (5.Golin J. Kon Z.N. Wu C.P. Martello J. Hanson L. Supernavage S. Ambudkar S.V. Sauna Z.E. Biochemistry. 2007; 46: 13109-13119Crossref PubMed Scopus (44) Google Scholar). To obtain pS558Y, pS558A, and pN242K, we carried out PCR-based site-directed mutagenesis with the Quick Change kit (Stratagene, La Jolla, CA). PCR primers carrying the desired base pair substitution were prepared, and PAGE was purified by Operon Biotechnologies (Huntsville, AL). The resulting mutants were confirmed by DNA sequencing the entire PDR5 insert. Sequencing was performed by Retrogen (San Diego, CA). We constructed the 14 sequencing primers so that the resulting sequencing data would contain substantial overlapping segments, thus ensuring accuracy.Chemicals and Media—All chemicals were purchased from Sigma. We dissolved cycloheximide (cyh) in sterile water and all other compounds in dimethyl sulfoxide. We purchased 8-azido-[α-32P]ATP (15–20 Ci/mmol) from Affinity Labeling Technologies, Inc. (Lexington, KY). We obtained [125I]iodoarylazidoprazosin ([125I]IAAP), 2,200 Ci/mmol, from PerkinElmer Life Sciences.We cultured cells in yeast extract, peptone, glucose (YPD) medium. Cyh, tritylimidazole, and clo were added to YPD after autoclaving. Tetrabutyltin was added to yeast extract, peptone, glycerol (YPG) medium. After sterilization, 5-FOA (1 g/liter) was added to synthetic dextrose complete medium.Determining IC50 Values in Liquid Culture—We grew cultures of yeast strains to be tested for drug hypersensitivity overnight in 5 ml of YPD broth in 15-ml clinical centrifuge tubes at 30 °C in a shaking water bath. Then cells were pelleted in a clinical centrifuge at high speed for 5 min. We decanted the growth medium and washed the pellets with 10 ml of sterile water before resuspension. We determined cellular concentration by spectroscopy (absorbance at 600 nm). We removed 0.5 × 105 cells, added this to 2 ml of YPD broth containing cyh (0.18–43.2 μm) or tritylimidazole (2–20 μm), and incubated the cultures at 30 °C with shaking. After 48 h, we monitored relative inhibition by determining the absorbance at 600 nm and comparing measurements to cells grown in YPD alone.Qualitative Analysis of Relative Drug Resistance—We tested mutant and control strains qualitatively for drug resistance by spotting 2-fold dilutions of cells in 5 μl of water on plates with a fixed concentration of a xenobiotic compound. Cultures to be tested were grown overnight in 10 ml of YPD broth. The cultures were washed and concentrated by centrifugation and resuspended in sterile water at 1/10th the original culture volume. We diluted a small sample 100-fold and determined the absorbance at 600 nm to check cell concentration. We made 2-fold dilutions in sterile water before plating in a 5-μl sample.UV Mutagenesis of JG365-3B—The first S558Y allele was created by UV mutagenesis as described previously (17.de Thozee C.P. Cronin S. Goj A. Golin J. Ghislain M. Mol. Microbiol. 2007; 63: 811-825Crossref PubMed Scopus (14) Google Scholar).Estimating the Frequency of Reversion—To estimate the rate of reversion of S558Y, 10 1-ml YPD cultures were seeded with 100 cells and grown to saturation. We plated 106 cells in 4-ml sterile agar on plates containing 7.5 μm clotrimazole and incubated them for 5 days at 30 °C. We counted the suppressors and picked them for further testing.Preparation of Purified Membrane Vesicles—We prepared plasma membrane (PM) vesicles as described previously (18.Shukla S. Saini P. Smriti, Jha S. Ambudkar S.V. Prasad R. Eukaryot. Cell. 2003; 2: 1361-1375Crossref PubMed Scopus (120) Google Scholar), with further modification (5.Golin J. Kon Z.N. Wu C.P. Martello J. Hanson L. Supernavage S. Ambudkar S.V. Sauna Z.E. Biochemistry. 2007; 46: 13109-13119Crossref PubMed Scopus (44) Google Scholar). We determined protein concentration in the vesicles with a bicinchonic acid kit (Perbio, Rockland, IL).Immunoblots of Pdr5 in PM Vesicles—Proteins in the purified PM vesicles were separated by gel electrophoresis and transferred to nitrocellulose membrane at constant current (400 mA, 1 h). The nitrocellulose membranes were blocked for 30 min with 20% nonfat milk in PBS containing Triton X-100 (PBST); incubated with a 1:200 dilution of polyclonal goat, anti-Pdr5 antibody, and yC-18 (Santa Cruz Biotechnology, Santa Cruz, CA); washed with PBST (three times for 15 min); incubated with a 1:5,000 dilution of secondary antibody (donkey anti-goat IgG-horseradish peroxidase in 5% nonfat milk) for 2 h; and washed with PBST (three times for 15 min). The chemiluminescence signal was developed by adding 10 ml of ECL reagent for 10 min and then exposing to x-ray film for 0.5–1 min.Assay of ATPase Activity—ATPase activity of purified PM vesicles was measured by the end point Pi assay as described previously for P-gp (19.Ambudkar S.V. Methods Enzymol. 1998; 292: 504-514Crossref PubMed Scopus (169) Google Scholar, 20.Ambudkar S.V. Lelong I.H. Zhang J. Cardarelli C.O. Gottesman M.M. Pastan I. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 8472-8476Crossref PubMed Scopus (378) Google Scholar), with minor modifications for Pdr5 (5.Golin J. Kon Z.N. Wu C.P. Martello J. Hanson L. Supernavage S. Ambudkar S.V. Sauna Z.E. Biochemistry. 2007; 46: 13109-13119Crossref PubMed Scopus (44) Google Scholar).One concern about ATPase measurements made with PM preparations is that these contain Pma1p [H+], which exhibits vanadate (Vi)-sensitive ATPase activity. We described our resolution of this issue in detail in a previous study (5.Golin J. Kon Z.N. Wu C.P. Martello J. Hanson L. Supernavage S. Ambudkar S.V. Sauna Z.E. Biochemistry. 2007; 46: 13109-13119Crossref PubMed Scopus (44) Google Scholar). Briefly, the optimal pH for Pma1p [H+]is ∼5.5–6.0, and the enzyme is only minimally active at pH 7.5. We therefore characterized ATPase activity in PMs from the Pdr5 at pH 7.5. In addition, measurements were made with purified PM vesicles from both Pdr5+ strains and the Δpdr5 strains, and the small amount of residual ATPase activity (<5%) observed in Δpdr5 strains was subtracted.Rhodamine 6G (R6G) Transport Assay—We measured R6G transport at 30 °C as described previously (21.Hanson L. May L. Tuma P. Keeven J. Mehl P. Ferenz M. Ambudkar S.V. Golin J. Biochemistry. 2005; 44: 9703-9713Crossref PubMed Scopus (20) Google Scholar). The concentration of R6G used in this study was 2.5 μm.Cross-linking of 8-Azido-[α-32P]ATP to Pdr5—We carried out binding studies in purified PM vesicles at 4 °C. Membrane proteins (18 μg/assay) were suspended in MOPS ATPase assay buffer containing 10 μm 8-azido-[α-32P]ATP (2.5 μCi/nmol). Samples were incubated in the dark for 5 min at 4 °C before cross-linking with 365 nm UV light on ice for 10 min. Reactions were stopped by adding 12.5 μl of 5× SDS-PAGE sample-loading buffer. After electrophoresis on a Tris acetate gel at constant voltage, gels were dried. We quantified the radioactivity incorporated into the Pdr5 band with a STORM 860 Phosphor-Imager system (GE Healthcare) and ImageQuant software.Cross-linking of [125I]IAAP to Pdr5—Purified membranes prepared from yeast cells overexpressing Pdr5 were incubated at room temperature in the ATPase buffer with [125I]IAAP (7 nm) for 5 min under subdued light. The samples were photocross-linked for 10 min with 365 nm UV light at room temperature followed by electrophoresis with 7% NuPAGE gels and quantified as described previously (21.Hanson L. May L. Tuma P. Keeven J. Mehl P. Ferenz M. Ambudkar S.V. Golin J. Biochemistry. 2005; 44: 9703-9713Crossref PubMed Scopus (20) Google Scholar). Modifications to this procedure in specific experiments are described in the figure legends.DNA Extraction and PCR Recovery of Suppressor Mutant Sequences—We amplified PDR5 from suppressor mutants with a PureLink Genomic DNA kit from Invitrogen. The DNA was extracted as described in the accompanying handbook from Invitrogen, with several modifications. We lysed 4 × 107 cells for each extraction. We purchased zymolyase made up in buffer from Sigma. We used 1 ml (∼60 units of activity) for each sample. We also doubled the volume of proteinase K and RNase A.We carried out PCR amplification with Platinum PCR Supermix High Fidelity from Invitrogen, with the following protocol: 1 cycle at 95 °C for 5 min, 35 cycles of denaturation at 95 °C for 1 min, annealing at 55 °C for 1 min, and extension at 68 °C for 7 min. Reactions were then placed on hold at 4 °C until they were processed further. The primers used to amplify PDR5 were left, TAAGACTCCGGTGAGTGTGG (Tm of 59 °C), and right, GCACGTTCGTTGTACTTCCA (Tm of 60 °C).RESULTSS558Y Mutation—The S558Y allele was identified in the course of a large mutant search designed to uncover suppressors that eliminated the cyh resistance of a strain overproducing Pdr5 (JG365-3B), the major yeast multidrug transporter. Following UV mutagenesis, we screened ∼70,000 survivors and isolated 17 cyh-sensitive colonies that failed to complement a known pdr5 deletion. Of these, 16 were severely impaired and phenotypically similar to the deletion; a single very leaky allele was also recovered.Immunoblotting of purified PM vesicles indicated that in 15 of these 17 mutants, Pdr5 was significantly reduced or missing (data not shown). One such mutant, pdr5-107 was the subject of recent study (17.de Thozee C.P. Cronin S. Goj A. Golin J. Ghislain M. Mol. Microbiol. 2007; 63: 811-825Crossref PubMed Scopus (14) Google Scholar). Another mutant, although severely drug-sensitive, had unaltered levels of Pdr5 in its PM. Complete nucleotide sequencing of the PDR5 gene indicated that it contained an S558Y missense mutation. The reported TMHs of Pdr5 suggested that this residue lie just outside TMH2. The original TMH assignments, however, were slightly different from those that we have established from seven topology modeling programs that allow us to predict core consensus sequences. Results from all these programs place Ser-558 in TMH2. 3R. Rutledge and D. Xia, manuscript in preparation.Drug Phenotypes of S558Y and S558A—The S558Y mutation was recreated in pSS607, a yeast integrative vector that we recently described (5.Golin J. Kon Z.N. Wu C.P. Martello J. Hanson L. Supernavage S. Ambudkar S.V. Sauna Z.E. Biochemistry. 2007; 46: 13109-13119Crossref PubMed Scopus (44) Google Scholar). We also made an S558A mutation. The mutant plasmids were completely sequenced to verify that each had only the desired alteration. From these plasmids we created several strains used in this study; all are isogenic to each other. Fig. 1A shows the relative clo sensitivity of four strains as follows: R-1 (pdr5::KANMX4); R-1 + pSS607, referred to as WT; R-1 + pS558Y or S558Y; and R-1 + pS558A or S558A.These data indicate that the S558Y mutation is drug hypersensitive as we predicted. By contrast, the S558A allele is phenotypically similar to the WT PDR5. This result suggests that it is the size of the tyrosine residue rather than the hydrophobicity of its aromatic ring that is primarily responsible for the observed mutant phenotype. A similar phenotype is observed with tritylimidazole and tetrabutyltin. These substrates were used to define different transport sites in Pdr5 that may or may not overlap (22.Golin J. Ambudkar S.V. Gottesman M.M. Habib A.D. Sczepanski J. Ziccardi W. May L. J. Biol. Chem. 2003; 278: 5963-5969Abstract Full Text Full Text PDF PubMed Scopus (71) Google Scholar, 23.Golin J. Ambudkar S.V. May L. Biochem. Biophys. Res. Commun. 2007; 356: 1-5Crossref PubMed Scopus (43) Google Scholar). In each case, S558Y is considerably more sensitive than the WT control to all of these xenobiotic agents and is qualitatively the same as the Δpdr5::KANMX4 isogenic negative control.Several studies have indicated that the drug-binding sites of ABC transporters consist of a large pocket, and individual transport substrates show specific interactions with different amino acid side chains (24.Schumacher M.A. Miller M.C. Brennan R.G. EMBO J. 2004; 23: 2923-2930Crossref PubMed Scopus (105) Google Scholar, 25.Schumacher M.A. Brennan R.G. Res. Microbiol. 2003; 154: 69-77Crossref PubMed Scopus (37) Google Scholar, 26.Schumacher M.A. Miller M.C. Grkovic S. Brown M.H. Skurray R.A. Brennan R.G. EMBO J. 2002; 21: 1210-1218Crossref PubMed Scopus (193) Google Scholar). The fact that the S558Y mutant is not substrate-specific (Fig. 1A) suggests that the reversal of drug resistance is a consequence of general steric hindrance and that the Ser-588 residue may not be involved in specific interactions with the drugs. This is consistent with the finding that the mutation S558A does not affect Pdr5 function.We carried out a quantitative analysis of relative cyh resistance in liquid culture. The data in Fig. 1B show that the S558Y mutant has an IC50 value that is ∼30-fold lower (0.5 μm) than the WT and is similar to the Δpdr5 control.Fig. 1C illustrates the behavior of double- and single-copy strains at low cyh concentrations. Strains containing 1 (JG2009) or 2 copies of S558Y show similar drug hypersensitivity. Therefore, doubling the amount of mutant protein does not increase cyh resistance. This is significant because the increased levels of Pdr5 in the double-copy strains are useful in biochemical assays, where they provide more robust measurements.S558Y Mutant Strain Is Transport-deficient—We analyzed the transport capability of S558Y with a well established, wholecell R6G efflux assay that uses flow cytometry (21.Hanson L. May L. Tuma P. Keeven J. Mehl P. Ferenz M. Ambudkar S.V. Golin J. Biochemistry. 2005; 44: 9703-9713Crossref PubMed Scopus (20) Google Scholar, 27.Kolaczkowski M. van der Rest M. Cybularz Kolaczkowska A. Soumillion J.P. Konings W.N. Goffeau A. J. Biol. Chem. 1996; 271: 31543-31548Abstract Full Text Full Text PDF PubMed Scopus (263) Google Scholar). We compared the transport capability of the WT (JG2000), Δpdr5 (AD1–7), and S558Y (JG2009) isogenic strains. These data are found in Table 2, and representative histogram plots are shown in Fig. 2. These data clearly demonstrate that the S558Y mutation creates an R6G transport deficiency that is as severe as that observed in the Δpdr5 strain. Both of these strains retain ∼60–70-fold more R6G than does the W" @default.
• W2087555143 created "2016-06-24" @default.
• W2087555143 creator A5002229441 @default.
• W2087555143 creator A5006815035 @default.
• W2087555143 creator A5018734218 @default.
• W2087555143 creator A5071465222 @default.
• W2087555143 creator A5073411793 @default.
• W2087555143 creator A5077286867 @default.
• W2087555143 creator A5080066949 @default.
• W2087555143 creator A5081938413 @default.
• W2087555143 creator A5091041425 @default.
• W2087555143 date "2008-12-01" @default.
• W2087555143 modified "2023-10-14" @default.
• W2087555143 title "Mutations Define Cross-talk between the N-terminal Nucleotide-binding Domain and Transmembrane Helix-2 of the Yeast Multidrug Transporter Pdr5" @default.
• W2087555143 cites W1559808711 @default.
• W2087555143 cites W1595790960 @default.
• W2087555143 cites W1760498288 @default.
• W2087555143 cites W1803435936 @default.
• W2087555143 cites W1964767165 @default.
• W2087555143 cites W1964828092 @default.
• W2087555143 cites W1970229280 @default.
• W2087555143 cites W1974844002 @default.
• W2087555143 cites W1981388811 @default.
• W2087555143 cites W1987474726 @default.
• W2087555143 cites W2020122212 @default.
• W2087555143 cites W2021769301 @default.
• W2087555143 cites W2040430892 @default.
• W2087555143 cites W2042974328 @default.
• W2087555143 cites W2064676619 @default.
• W2087555143 cites W2067400127 @default.
• W2087555143 cites W2080271815 @default.
• W2087555143 cites W2087396021 @default.
• W2087555143 cites W2090529688 @default.
• W2087555143 cites W2092006899 @default.
• W2087555143 cites W2094328836 @default.
• W2087555143 cites W2102743211 @default.
• W2087555143 cites W2106007818 @default.
• W2087555143 cites W2107013040 @default.
• W2087555143 cites W2108047993 @default.
• W2087555143 cites W2131299583 @default.
• W2087555143 cites W2138956992 @default.
• W2087555143 cites W2141752092 @default.
• W2087555143 cites W2145842435 @default.
• W2087555143 cites W2146056365 @default.
• W2087555143 cites W2146560076 @default.
• W2087555143 cites W2150624078 @default.
• W2087555143 cites W2152302945 @default.
• W2087555143 cites W2161983628 @default.
• W2087555143 cites W43589343 @default.
• W2087555143 doi "https://doi.org/10.1074/jbc.m806446200" @default.
• W2087555143 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/2596398" @default.
• W2087555143 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/18842589" @default.
• W2087555143 hasPublicationYear "2008" @default.
• W2087555143 type Work @default.
• W2087555143 sameAs 2087555143 @default.
• W2087555143 citedByCount "61" @default.
• W2087555143 countsByYear W20875551432012 @default.
• W2087555143 countsByYear W20875551432013 @default.
• W2087555143 countsByYear W20875551432014 @default.
• W2087555143 countsByYear W20875551432015 @default.
• W2087555143 countsByYear W20875551432016 @default.
• W2087555143 countsByYear W20875551432017 @default.
• W2087555143 countsByYear W20875551432018 @default.
• W2087555143 countsByYear W20875551432019 @default.
• W2087555143 countsByYear W20875551432020 @default.
• W2087555143 countsByYear W20875551432021 @default.
• W2087555143 countsByYear W20875551432022 @default.
• W2087555143 countsByYear W20875551432023 @default.
• W2087555143 crossrefType "journal-article" @default.
• W2087555143 hasAuthorship W2087555143A5002229441 @default.
• W2087555143 hasAuthorship W2087555143A5006815035 @default.
• W2087555143 hasAuthorship W2087555143A5018734218 @default.
• W2087555143 hasAuthorship W2087555143A5071465222 @default.
• W2087555143 hasAuthorship W2087555143A5073411793 @default.
• W2087555143 hasAuthorship W2087555143A5077286867 @default.
• W2087555143 hasAuthorship W2087555143A5080066949 @default.
• W2087555143 hasAuthorship W2087555143A5081938413 @default.
• W2087555143 hasAuthorship W2087555143A5091041425 @default.
• W2087555143 hasBestOaLocation W20875551431 @default.
• W2087555143 hasConcept C104317684 @default.
• W2087555143 hasConcept C113027372 @default.
• W2087555143 hasConcept C118892022 @default.
• W2087555143 hasConcept C149011108 @default.
• W2087555143 hasConcept C170493617 @default.
• W2087555143 hasConcept C24530287 @default.
• W2087555143 hasConcept C2779222958 @default.
• W2087555143 hasConcept C44312359 @default.
• W2087555143 hasConcept C512185932 @default.
• W2087555143 hasConcept C54355233 @default.
• W2087555143 hasConcept C55493867 @default.
• W2087555143 hasConcept C86803240 @default.
• W2087555143 hasConcept C95444343 @default.
• W2087555143 hasConceptScore W2087555143C104317684 @default.
• W2087555143 hasConceptScore W2087555143C113027372 @default.
• W2087555143 hasConceptScore W2087555143C118892022 @default.
• W2087555143 hasConceptScore W2087555143C149011108 @default.
• W2087555143 hasConceptScore W2087555143C170493617 @default.
• W2087555143 hasConceptScore W2087555143C24530287 @default.

• next