FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2087560896> ?p ?o ?g. }

• W2087560896 endingPage "25339" @default.
• W2087560896 startingPage "25332" @default.
• W2087560896 abstract "In Gram-positive bacteria, a large subfamily of dual ATP-binding cassette proteins confers acquired or intrinsic resistance to macrolide, lincosamide, and streptogramin antibiotics by a far from well understood mechanism. Here, we report the first biochemical characterization of one such protein, Vga(A), which is involved in streptogramin A (SgA) resistance among staphylococci. Vga(A) is composed of two nucleotide-binding domains (NBDs), separated by a charged linker, with a C-terminal extension and without identified transmembrane domains. Highly purified Vga(A) displays a strong ATPase activity (Km = 78 μm, Vm = 6.8 min-1) that was hardly inhibited by orthovanadate. Using mutants of the conserved catalytic glutamate residues, the two NBDs of Vga(A) were shown to contribute unequally to the total ATPase activity, the mutation at NBD2 being more detrimental than the other. ATPase activity of both catalytic sites was essential for Vga(A) biological function because each single Glu mutant was unable to confer SgA resistance in the staphylococcal host. Of great interest, Vga(A) ATPase was specifically inhibited in a non-competitive manner by the SgA substrate, pristinamycin IIA (PIIA). A deletion of the last 18 amino acids of Vga(A) slightly affected the ATPase activity without modifying the PIIA inhibition values. In contrast, this deletion reduced 4-fold the levels of SgA resistance. Altogether, our results suggest a role for the C terminus in regulation of the SgA antibiotic resistance mechanism conferred by Vga(A) and demonstrate that this dual ATP-binding cassette protein interacts directly and specifically with PIIA, its cognate substrate. In Gram-positive bacteria, a large subfamily of dual ATP-binding cassette proteins confers acquired or intrinsic resistance to macrolide, lincosamide, and streptogramin antibiotics by a far from well understood mechanism. Here, we report the first biochemical characterization of one such protein, Vga(A), which is involved in streptogramin A (SgA) resistance among staphylococci. Vga(A) is composed of two nucleotide-binding domains (NBDs), separated by a charged linker, with a C-terminal extension and without identified transmembrane domains. Highly purified Vga(A) displays a strong ATPase activity (Km = 78 μm, Vm = 6.8 min-1) that was hardly inhibited by orthovanadate. Using mutants of the conserved catalytic glutamate residues, the two NBDs of Vga(A) were shown to contribute unequally to the total ATPase activity, the mutation at NBD2 being more detrimental than the other. ATPase activity of both catalytic sites was essential for Vga(A) biological function because each single Glu mutant was unable to confer SgA resistance in the staphylococcal host. Of great interest, Vga(A) ATPase was specifically inhibited in a non-competitive manner by the SgA substrate, pristinamycin IIA (PIIA). A deletion of the last 18 amino acids of Vga(A) slightly affected the ATPase activity without modifying the PIIA inhibition values. In contrast, this deletion reduced 4-fold the levels of SgA resistance. Altogether, our results suggest a role for the C terminus in regulation of the SgA antibiotic resistance mechanism conferred by Vga(A) and demonstrate that this dual ATP-binding cassette protein interacts directly and specifically with PIIA, its cognate substrate. Staphylococcus aureus is a common cause of infection in hospitals and the community with a unique ability to become resistant to antibiotics by a broad range of mechanisms (1Casey A.L. Lambert P.A. Elliott T.S. Int. J. Antimicrob. Agents. 2007; 29: S23-S32Crossref PubMed Scopus (95) Google Scholar). Among these, the mechanism underlying resistance to macrolide, lincosamide, and streptogramin (MLS) 6The abbreviations used are: MLSmacrolide, lincosamide, and streptogramin antibioticsABCATP-binding cassetteNBDnucleotide-binding domainNBD1N-terminal NBDNBD2C-terminal NBDTMDtransmembrane domainAREantibiotic resistance subfamilyPIIApristinamycin IIAPIApristinamycin IASgAstreptogramin ASgBstreptogramin B. 6The abbreviations used are: MLSmacrolide, lincosamide, and streptogramin antibioticsABCATP-binding cassetteNBDnucleotide-binding domainNBD1N-terminal NBDNBD2C-terminal NBDTMDtransmembrane domainAREantibiotic resistance subfamilyPIIApristinamycin IIAPIApristinamycin IASgAstreptogramin ASgBstreptogramin B. antibiotics and mediated by dual ATP-binding cassette (ABC) proteins, such as Vga(A) involved in resistance to streptogramin A (SgA) antibiotics (2Allignet J. Loncle V. El Sohl N. Gene (Amst.). 1992; 117: 45-51Crossref PubMed Scopus (128) Google Scholar), remains so far elusive. macrolide, lincosamide, and streptogramin antibiotics ATP-binding cassette nucleotide-binding domain N-terminal NBD C-terminal NBD transmembrane domain antibiotic resistance subfamily pristinamycin IIA pristinamycin IA streptogramin A streptogramin B. macrolide, lincosamide, and streptogramin antibiotics ATP-binding cassette nucleotide-binding domain N-terminal NBD C-terminal NBD transmembrane domain antibiotic resistance subfamily pristinamycin IIA pristinamycin IA streptogramin A streptogramin B. Like other MLS antibiotics, streptogramins inhibit protein translation (3Mukhtar T.A. Wright G.D. Chem. Rev. 2005; 105: 529-542Crossref PubMed Scopus (289) Google Scholar). They consist of two components, produced simultaneously by several strains of streptomycetes. The SgA components are cyclic polyunsaturated macrolactones such as pristinamycin IIA (PIIA). The SgB components are cyclic depsipeptides such as pristinamycin IA (PIA). Both components target the ribosomal peptidyl transferase cavity as observed from the crystal structure of the streptogramin-bound 50 S subunit (4Harms J.M. Schlunzen F. Fucini P. Bartels H. Yonath A. BMC Biol. 2004; 2: 4Crossref PubMed Scopus (123) Google Scholar). The two components are separately bacteriostatic, but they act synergistically when combined, becoming bactericidal. The synergism between SgA and SgB is related to the ability of SgA to enhance the affinity of SgB for the ribosome (5Vannuffel P. Cocito C. Drugs. 1996; 51: 20-30Crossref PubMed Scopus (100) Google Scholar), inducing a conformational rearrangement of the U2585 nucleotide of the 23 S rRNA (4Harms J.M. Schlunzen F. Fucini P. Bartels H. Yonath A. BMC Biol. 2004; 2: 4Crossref PubMed Scopus (123) Google Scholar). This synergism was exploited for manufacturing mixtures usable in human medicine, such as Pyostacine® or Synercid® (6Barriere J.C. Berthaud N. Beyer D. Dutka-Malen S. Paris J.M. Desnottes J.F. Curr. Pharm. Des. 1998; 4: 155-180PubMed Google Scholar, 7Gurk-Turner C. Proc. (Bayl. Univ. Med. Cent.). 2000; 13: 83-86Crossref PubMed Google Scholar, 8Ng J. Gosbell I.B. J. Antimicrob. Chemother. 2005; 55: 1008-1012Crossref PubMed Scopus (37) Google Scholar). A high level of resistance to the synergic mixtures is observed in Gram-positive bacteria when both SgA and SgB resistance determinants are combined (9Leclercq R. Courvalin P. Lancet. 1998; 352: 591-592Abstract Full Text Full Text PDF PubMed Scopus (35) Google Scholar). Resistance to SgB is due to erm (MLSgB resistance phenotype) (10Jin H.J. Yang Y.D. Protein Expr. Purif. 2002; 25: 149-159Crossref PubMed Scopus (12) Google Scholar) or vgb (SgB resistance phenotype) (11Korczynska M. Mukhtar T.A. Wright G.D. Berghuis A.M. Proc. Natl. Acad. Sci. U. S. A. 2007; 104: 10388-10393Crossref PubMed Scopus (29) Google Scholar) genes. Resistance to SgA is achieved by ribosome modification as described for Cfr (12Long K.S. Poehlsgaard J. Kehrenberg C. Schwarz S. Vester B. Antimicrob. Agents Chemother. 2006; 50: 2500-2505Crossref PubMed Scopus (484) Google Scholar), or by drug acetylation as described for Vat(D) (13Kehoe L.E. Snidwongse J. Courvalin P. Rafferty J.B. Murray I.A. J. Biol. Chem. 2003; 278: 29963-29970Abstract Full Text Full Text PDF PubMed Scopus (31) Google Scholar), or by a putative efflux mechanism, as recently suggested for the ABC protein Vga(A) (14Chesneau O. Ligeret H. Hosan-Aghaie N. Morvan A. Dassa E. Antimicrob. Agents Chemother. 2005; 49: 973-980Crossref PubMed Scopus (44) Google Scholar). ABC proteins constitute one of the most abundant family of proteins in living organisms. They are mainly involved in transport processes, but very few of them have been characterized as antibiotic exporters (15Bouige P. Laurent D. Piloyan L. Dassa E. Curr. Protein Pept. Sci. 2002; 3: 541-559Crossref PubMed Scopus (88) Google Scholar, 16Lubelski J. Konings W.N. Driessen A.J. Microbiol. Mol. Biol. Rev. 2007; 71: 463-476Crossref PubMed Scopus (200) Google Scholar). Typical ABC transporters consist of two transmembrane domains (TMDs), which determine substrate specificity, and two highly conserved nucleotide-binding domains (NBDs), which couple ATP hydrolysis to substrate transport. The four domains may be expressed as separated polypeptides or fused in a variety of configurations (17Holland I.B. Blight M.A. J. Mol. Biol. 1999; 293: 381-399Crossref PubMed Scopus (485) Google Scholar). Among ABC antibiotic exporters, substrate specificity can be wide, as illustrated by LmrA or VcaM that can extrude a plethora of antibiotics (18Huda N. Lee E.W. Chen J. Morita Y. Kuroda T. Mizushima T. Tsuchiya T. Antimicrob. Agents Chemother. 2003; 47: 2413-2417Crossref PubMed Scopus (56) Google Scholar, 19Poelarends G.J. Mazurkiewicz P. Putman M. Cool R.H. Veen H.W. Konings W.N. Drug. Resist. Updat. 2000; 3: 330-334Crossref PubMed Scopus (29) Google Scholar). On the contrary, substrate specificity can be restricted to a subclass of antibiotics, exemplified by MacB that confers resistance only to 14- and 15-membered ring macrolides (20Kobayashi N. Nishino K. Yamaguchi A. J. Bacteriol. 2001; 183: 5639-5644Crossref PubMed Scopus (258) Google Scholar, 21Tikhonova E.B. Devroy V.K. Lau S.Y. Zgurskaya H.I. Mol. Microbiol. 2007; 63: 895-910Crossref PubMed Scopus (85) Google Scholar). Vga(A) belongs to the antibiotic resistance (ARE) subfamily of ABC proteins. ARE proteins comprise two NBDs fused into the same polypeptide chain with no identified TMD partner to constitute a canonical transporter (15Bouige P. Laurent D. Piloyan L. Dassa E. Curr. Protein Pept. Sci. 2002; 3: 541-559Crossref PubMed Scopus (88) Google Scholar, 22Ross J.I. Eady E.A. Cove J.H. Baumberg S. Gene (Amst.). 1996; 183: 143-148Crossref PubMed Scopus (41) Google Scholar). Many ARE subfamily proteins were found in MLS antibiotic-producing actinomycetes (23Mendez C. Salas J.A. Res. Microbiol. 2001; 152: 341-350Crossref PubMed Scopus (100) Google Scholar). The most studied ARE proteins are Ole(B), from the oleandomycin producer Streptomyces antibioticus (24Buche A. Mendez C. Salas J.A. Biochem. J. 1997; 321: 139-144Crossref PubMed Scopus (23) Google Scholar), and two proteins of distinct specificities: Msr(A) and Vga(A), both of which are coded by mobile genetic elements in staphylococci. Msr(A) confers a high level resistance to 14- and 15-membered ring macrolides and to SgB components (25Ross J.I. Eady E.A. Cove J.H. Cunliffe W.J. Baumberg S. Wootton J.C. Mol. Microbiol. 1990; 4: 1207-1214Crossref PubMed Scopus (300) Google Scholar), whereas Vga(A) confers a low level resistance to lincosamides and a high level resistance to SgA components (14Chesneau O. Ligeret H. Hosan-Aghaie N. Morvan A. Dassa E. Antimicrob. Agents Chemother. 2005; 49: 973-980Crossref PubMed Scopus (44) Google Scholar). In this work, we report the first biochemical characterization of an ARE protein. We have produced full-length Vga(A) in Escherichia coli and purified it as a soluble protein under native conditions. We have characterized its ATPase activity and investigated the effect of different antibiotics targeting the 50 S ribosomal subunit on this activity. We demonstrate the specific interaction between Vga(A), a dual ABC protein devoid of TMDs, and PIIA, its cognate MLS substrate. Bacterial Strains, Plasmids, and Antibiotics—Plasmid pIP1845 (14Chesneau O. Ligeret H. Hosan-Aghaie N. Morvan A. Dassa E. Antimicrob. Agents Chemother. 2005; 49: 973-980Crossref PubMed Scopus (44) Google Scholar), a derivative of the pRB474 shuttle vector carrying the wild-type vga(A) gene, allowing expression of this gene in both E. coli and staphylococci, was used as a DNA template in PCR experiments. E. coli strain TOP10 and plasmid pCR4 (Invitrogen) were both used for cloning the blunt-ended PCR products. Screening for plasmid DNA mutagenesis was achieved by using E. coli XL1-Blue supercompetent cells (Stratagene). E. coli strain AG100A, susceptible to SgA by disruption of the AcrAB pump (26Okusu H. Ma D. Nikaido H. J. Bacteriol. 1996; 178: 306-308Crossref PubMed Scopus (613) Google Scholar), and Staphylococcus epidermidis strain BM3302 (27El Solh N. Allignet J. Bismuth R. Buret B. Fouace J.M. Antimicrob. Agents Chemother. 1986; 30: 161-169Crossref PubMed Scopus (31) Google Scholar) were used as recipients for testing the functionality of the genes cloned into pIP1840, as described previously (14Chesneau O. Ligeret H. Hosan-Aghaie N. Morvan A. Dassa E. Antimicrob. Agents Chemother. 2005; 49: 973-980Crossref PubMed Scopus (44) Google Scholar). Overexpression and purification of the recombinant proteins were carried out using BL21(λDE3) pDIA17 (28Rogé J. Betton J.M. Microb. Cell Fact. 2005; 4: 18Crossref PubMed Scopus (17) Google Scholar) transformed with vga(A) constructs cloned into the pIVEX2.3 vector (Roche Applied Science). Antibiotics (ampicillin, lincomycin, and chloramphenicol) were purchased from Sigma or were gifts from Aventis (pristinamycin IA and IIA) and Abbott (erythromycin). Antibiotics were dissolved in water, except for the pristinamycin compounds and chloramphenicol, which were dissolved in methanol and ethanol, respectively. PIIA was qualitatively controlled before and after the enzymatic tests by mass spectrometry. Antibiotic Susceptibility—The minimal inhibitory concentrations of SgA were determined using Mueller-Hinton agar plates (Bio-Rad) in the presence or absence of orthovanadate (Sigma) with a 2-fold increase in antibiotic concentration from 0.125 μg.ml-1 to 128 μg.ml-1. Overnight cultures of E. coli AG100A or S. epidermidis BM3302 harboring pIP1840 and its derivatives contained 100 μg.ml-1 ampicillin or 10 μg.ml-1 chloramphenicol, added to Luria-Bertani or brain-heart infusion media, respectively. 10 μl of a 1000-fold dilution of these cultures was spotted onto Mueller-Hinton agar plates. Incubation was done for 24 h at 37 °C. Plasmid Constructions—Full-length and 3′-truncated versions of the vga(A) gene were obtained by PCR from plasmid pIP1845 using NcoI sense primers VGA5 and VGA8, in combination with antisense primers VGA3-SmaI, and VGA2-EcoRV, respectively (Table 1). Amplification was done in both cases with Pfx DNA polymerase (Invitrogen). PCR products were cloned into pCR4 with Zero Blunt TOPO kit (Invitrogen). Inserts of expected sizes were completely sequenced to check the correctness of the genes: the longest one encoded a full-length version of the wild-type Vga(A) protein modified only by the insertion at +2 of an alanine (called thereafter Vga(A)), whereas the shortest one contained an insertion at +2 of a glycine coupled with a deletion at the C terminus of the last 18 amino acids (called thereafter Vga(A)ΔCter). Subcloning of the recombinant vga(A) genes into pIVEX2.3 vector cut with NcoI and SmaI enzymes yielded the pIVEX-derived expression plasmids: pIP1884 carried the NcoI-SmaI fragment that codes for Vga(A), whereas pIP1834 carried the NcoI-EcoRV fragment that codes for Vga(A)ΔCter. Both recombinant Vga(A) proteins contain a C-terminal 6× histidine tag provided by the vector. Functional in vivo testing of the recombinant proteins, i.e. the capacity to confer bacterial resistance against SgA, was achieved by cloning the full-length and the truncated his-tagged versions of Vga(A) into the E. coli-S. aureus expression plasmid pIP1840 as previously described (14Chesneau O. Ligeret H. Hosan-Aghaie N. Morvan A. Dassa E. Antimicrob. Agents Chemother. 2005; 49: 973-980Crossref PubMed Scopus (44) Google Scholar). Two single mutations downstream of the Walker B motifs, E105Q and E410Q (Fig. 1), were obtained by site-directed mutagenesis using oligodeoxyribonucleotides listed in Table 1 and the QuikChange kit (Stratagene) as recommended by the manufacturer. Sequencing reactions and synthesis of the oligodeoxyribonucleotides were provided by Genome Express.TABLE 1List of oligodeoxyribonucleotides Restriction sites are underlined, and mutagenized bases are in boldface.Oligonucleotide nameUsed forSequenceVGA5Cloning of a full-length version of Vga(A)CTCCATGGCAAAAATAATGTTAGAGGGACVGA3-SmaICloning of a full-length version of Vga(A)CTGGGCCCTTTATCCAAATTTCTTTTTTCVGA8Cloning of a ΔCter version of Vga(A)CTCCATGGGAAAAATAATGTTAGAGGGACVGA2-EcoRVCloning of a ΔCter version of Vga(A)CTGATATCTTCCGAAGGTTCAATACTCE105QForwardGlu replaced by Gln at position 105CTGCTATTAGCAGATCAACCAACAACTAACTE105QReverseGlu replaced by Gln at position 105AGTTAGTTGTTGGTTGATCTGCTAATAGCAGE410QForwardGlu replaced by Gln at position 410ACGTTGGTACTAGATCAACCAACAAACTTTCE410QReverseGlu replaced by Gln at position 410GAAAGTTTGTTGGTTGATCTAGTACCAACGT Open table in a new tab Production of the Recombinant Vga(A) Proteins—Strain BL21(λDE3) pDIA17 was transformed with the pIVEX-derived expression plasmids and grown at 37 °C in yeast extract Tryptone (2YT) medium (Difco) containing ampicillin (50 μg.ml-1) and chloramphenicol (34 μg.ml-1) until the absorbance at 600 nm reached a value of 0.4 unit. Production of the Vga(A) recombinant proteins was induced with 1 mm isopropyl-1-thio-β-d-galactopyranoside (Promega, Madison, WI) for 16 h at 16–18 °C (final cell density of 3–4 units at 600 nm). Then, cells were harvested by centrifugation (10,000 × g for 15 min) at 4 °C, frozen in liquid nitrogen, and stored at -80 °C until use. Mutated proteins were expressed and overproduced in the same culture conditions as the wild type. Protein overexpression was controlled by 10% SDS-PAGE analysis of total cell extracts. Protein Purification—The same protocol was followed for all recombinant Vga(A) proteins. All purification steps were performed at 4 °C. The cell pellet from a 2-liter culture was resuspended in 40 ml of buffer A (50 mm sodium/potassium phosphate, pH 7.0, 20 mm NaCl, 1 mm MgCl2, 1 mm imidazole, and 0.5% Triton X-100) with 1 mm Pefabloc-SC (Roche Applied Science). Cells were lysed by sonication (5 s on/5 s off, 36 cycles) in a Vibro-cell sonicator (Fisher Bioblock Scientific, Illkirch Cedex, France). The cell lysate was incubated for 30 min at room temperature under mild shaking with 1500 units of benzonase (Sigma). Four milligrams of protamine sulfate (Sigma) were then added, and the cell lysate was incubated for further 30 min under the same conditions. The cell extract was centrifuged at 200,000 × g for 1 h, and imidazole was added to the supernatant to a final concentration of 25 mm. The extract was applied onto a 1-ml HisTrap nickel-affinity column (GE Healthcare Life Sciences) connected to an AKTA-Explorer system (GE Healthcare Life Sciences) at a flow rate of 1 ml·min-1. The resin was washed with buffer B (50 mm sodium/potassium phosphate, pH 7.0, 400 mm NaCl) and 50 mm imidazole until the baseline (A280) was reached. Proteins were eluted from the column with a 50–250 mm imidazole gradient in buffer B. Vga(A)-containing fractions were controlled by SDS-PAGE analysis, pooled, and concentrated to a final volume of 10 ml. This pool was loaded onto a 50-ml HiPrep 26/10 desalting column (GE Healthcare Life Sciences) equilibrated with buffer C (50 mm sodium/potassium phosphate, pH 7.0, 1 mm EDTA, 10% glycerol, 7 mm β-mercaptoethanol) with 20 mm NaCl, at a flow rate of 3 ml·min-1. Vga(A)-containing fractions were applied onto a 1-ml Resource S cationic exchanger resin (GE Healthcare Life Sciences) and eluted with a linear gradient of 20–500 mm NaCl in buffer C. Vga(A) fractions were collected and concentrated on Amicon Ultra 10K membranes (Millipore) to a final volume of 400 μl. The last purification step was performed on a Superdex 200 HR10/30 column (GE Healthcare Life Sciences) equilibrated with buffer D (25 mm Tris-HCl, pH 7.0, 150 mm NaCl, 7 mm β-mercaptoethanol). The Vga(A) protein was finally stored at -80 °C at 30–100 μm. Protein concentration was determined with the Bio-Rad protein assay using bovine serum albumin as a standard. SDS-PAGE was carried out using a 10:25 acrylamide/bisacrylamide gel and stained with Coomassie Blue. Molecular mass standards for SDS-PAGE and for gel filtration chromatography were purchased from GE Healthcare Life Sciences. Immune detection of Vga(A) proteins was carried out as previously described (14Chesneau O. Ligeret H. Hosan-Aghaie N. Morvan A. Dassa E. Antimicrob. Agents Chemother. 2005; 49: 973-980Crossref PubMed Scopus (44) Google Scholar). ATPase Activity—The ATPase activity of Vga(A) proteins was determined at 30 °C by following the amount of radiolabeled inorganic phosphate released during [γ-33P]ATP hydrolysis. The [33P]Pi produced was isolated from [γ-33P]ATP (GE Healthcare Life Sciences) using the charcoal method (29Crane R.K. Lipmann F. J. Biol. Chem. 1953; 201: 235-243Abstract Full Text PDF PubMed Google Scholar). Standard reaction mixtures (100 μl) contained, unless otherwise indicated, 25 mm Tris-HCl, pH 8.0, 100 mm NaCl, 5 mm MgCl2, and 0.2–1 μm of purified Vga(A). The reaction was started by adding [γ-33P]ATP (200 μm, 4 Bq.pmol-1) and stopped at the indicated time at 4 °C by withdrawing 10-μl aliquots of the reaction mixture and adding them to 400 μl of a 4% activated charcoal suspension in 20 mm H3PO4. After centrifugation (10,000 × g for 5 min), 200 μl of supernatant was mixed with 3 ml of OptiPhase HiSafe3 (PerkinElmer Life Sciences) and counted in a Wallac 1414 liquid-scintillation counter. When antibiotics were used, the amount of methanol never exceeded 2% of the final reaction mix and was kept constant for all the experimental conditions that were tested. To probe inhibition by PIIA, kinetic assays were performed as previously described with 1 μm purified Vga(A), ATP concentrations ranging from 50 to 800 μm, and PIIA from 100 to 800 μm. To test reversibility of PIIA inhibition, 10 μm Vga(A) was preincubated for at least 10 min at 30 °C in the reaction buffers with or without 1 mm PIIA, and then diluted 10 times in the same buffers with or without 1 mm PIIA. When buffers without PIIA were used for the sample dilution, the final PIIA concentration dropped down to 0.1 mm.[γ-33P]ATP was added to start the reaction kinetics. Freshly boiled orthovanadate solutions were prepared as described (30Payen L.F. Gao M. Westlake C.J. Cole S.P. Deeley R.G. J. Biol. Chem. 2003; 278: 38537-38547Abstract Full Text Full Text PDF PubMed Scopus (65) Google Scholar). Expression and Antibiotic Resistance Properties of Vga(A) in Staphylococci and in E. coli—To analyze the biochemical properties of Vga(A) and to simplify its purification, a tag consisting of 11 residues, including 6 histidines, was added to the carboxyl end of the full-length protein (Fig. 1). The histidine tag did not modify the minimal inhibitory concentration values of PIIA in S. epidermidis (Table 2), demonstrating that it does not alter the biological function of Vga(A). By contrast, Vga(A) was unable to confer SgA resistance in E. coli AG100A, a strain rendered susceptible to SgA compounds by disruption of the AcrAB pump. On Western blots probed with a specific antiserum, a band of ∼66 kDa, corresponding to Vga(A), was present in the soluble extracts of E. coli cells (not shown). This band was not detected in membrane fractions, contrary to what occurred within the original hosts, S. aureus or S. epidermidis (14Chesneau O. Ligeret H. Hosan-Aghaie N. Morvan A. Dassa E. Antimicrob. Agents Chemother. 2005; 49: 973-980Crossref PubMed Scopus (44) Google Scholar). This result suggests that the absence of resistance of E. coli toward SgA is not due to defective expression of the protein in the heterologous host. Obviously at least one protein partner targeting Vga(A) to the membranes and/or other factor that contribute to the functionality of Vga(A) in staphylococci is not present in E. coli.TABLE 2Values of minimal inhibitory concentration of PIIAPlasmidMinimal inhibitory concentration of PIIA againstE. coli AG100AS. epidermidis BM3302μg.ml–1pIP1840161pIP1845 = pIP1840[vga(A)]1632pIP1872 = pIP1840[vga(A)-His]1632pIP1841 = pIP1840[vga(A)ΔCter-His]168pIP1890 = pIP1840[vga(A)E105Q-His]161pIP1891 = pIP1840[vga(A)E410Q-His]161 Open table in a new tab Purification of Vga(A) and Its Mutated Derivatives—Because the tag did not affect Vga(A) functionality in the native host, we expressed and purified recombinant Vga(A) from E. coli. Using pIVEX vector, Vga(A) was significantly overproduced at 16–20 °C and extracted mainly in a soluble form. Elution of Vga(A) from an immobilized metal ion affinity chromatography column yielded several peaks containing the protein with high amounts of nucleic acids that prevented binding to the subsequent cationic exchanger column. Removal of contaminating nucleic acids, by using benzonase and protamine sulfate precipitation, highly increased the efficiency of the second purification step (Resource S). The third and final purification step, performed on a size-exclusion chromatography column (Superdex 200), allowed us to obtain Vga(A) purified to homogeneity (supplemental Fig. S1A). The purification yields ranged from one to two mg.liter-1 culture. The three mutated derivatives, Vga(A)ΔCter, Vga(A)-E105Q, and Vga(A)-E410Q (Fig. 1), were overproduced and purified following the same protocol. However, we were unable to obtain significant soluble amounts of the Vga(A)-E105Q-E410Q double mutant. All Vga(A) recombinant proteins behave as monomers with the expected molecular weight (supplemental Fig. S1B), and no dimer formation could be evidenced by gel filtration experiments, even in the presence of Mg2+ and/or ATP in all buffers (not shown). All proteins were stored at -80 °C for months, without loss of catalytic activity, which remained homogeneous among various preparations. Intrinsic ATPase Activities of Vga(A) and Its Mutants—The ATPase activity of Vga(A) was linear during the time of kinetics (Fig. 2A). The high catalytic activity of Vga(A) allowed us to work with final protein concentrations that ranged from 0.1 to 1 μm. Similarly to all other ABC proteins, the catalytic activity of Vga(A) was strictly dependent on the presence of Mg2+ ions. Because the initial velocity of hydrolysis decreased only by ∼50% at 500 mm NaCl, we concluded that Vga(A) is not salt-sensitive at physiological concentrations. This stands in sharp contrast to HlyB ATPase domains, whose ATPase activity drops to <25% in the presence of 100 mm NaCl (31Benabdelhak H. Schmitt L. Horn C. Jumel K. Blight M.A. Holland I.B. Biochem. J. 2005; 386: 489-495Crossref PubMed Scopus (28) Google Scholar). Vga(A) exhibited a weak sensitivity to orthovanadate, because 50% inhibition of the catalytic activity was achieved with 2 mm of this compound and 90% inhibition with 10 mm (not shown). At the latter concentration, there is no effect of this compound on the minimal inhibitory concentration values of SgA in S. epidermidis, indicating that both ATPase activity and biological function of Vga(A) are quite resistant to orthovanadate. The two NBDs of Vga(A) have distinct sizes, the N-terminal one (NBD1) being smaller than the C-terminal (NBD2), with a large deletion between the Q-loop and the signature motif (Fig. 1). To evaluate the contribution of each NBD to the ATPase activity of Vga(A), the catalytic glutamate residues downstream of the Walker B motifs were mutated, and the ATPase activities of the mutants were measured. Compared with Vga(A), the catalytic activities of Vga(A)-E105Q and Vga(A)-E410Q represent 70 and 25% of the total ATPase activity, respectively, when measured in the standard reaction mixture (200 μm ATP) (Fig. 2B). The summed ATPase activities of the two mutants nearly account for the entire activity of the wild type. We conclude that ATP hydrolysis can take place at one site independently of the hydrolytic capability of the other site of the Vga(A) NBD1·NBD2 pseudo-heterodimer, as already described for the HlyB-NBD homodimer (32Zaitseva J. Jenewein S. Wiedenmann A. Benabdelhak H. Holland I.B. Schmitt L. Biochemistry. 2005; 44: 9680-9690Crossref PubMed Scopus (83) Google Scholar). Both NBDs contribute to the total catalytic activity of Vga(A), but their contributions appear to be asymmetric. It is worth mentioning that none of the two glutamate mutants conferred SgA resistance in S. epidermidis (Table 2), whereas both were membrane-associated and expressed as efficiently as the wild type. Therefore, two fully functional catalytic sites are essential for the biological activity of Vga(A). The kinetics of ATP hydrolysis activity of Vga(A) follow the Michaelis-Menten equation (Fig. 3). Vm and Km values were determined for Vga(A) (6.8 min-1 and 78 μm) and compared with those of Vga(A)-E105Q and Vga(A)-E410Q (Table 3). Vm value of Vga(A)-E410Q is strongly reduced, indicating the prevalent role of the NBD2 catalytic site in total ATPase activity of the protein. At the opposite, a mutant affected in the first catalytic site displayed a Vm value similar to that of Vga(A), despite a lower apparent affinity for ATP. These results confirm that, at least for the NBD2 catalytic site, fully functional ATPase at one site is not strictly dependent on the turnover at the other site. The catalytic activity of Vga(A) was also measured with various protein concentrations ranging from 0.05 to 5 μm. In these conditions, the ATPase activity of Vga(A) was st" @default.
• W2087560896 created "2016-06-24" @default.
• W2087560896 creator A5004185009 @default.
• W2087560896 creator A5013638005 @default.
• W2087560896 creator A5015544930 @default.
• W2087560896 creator A5017583915 @default.
• W2087560896 creator A5045752196 @default.
• W2087560896 creator A5056741959 @default.
• W2087560896 creator A5076172595 @default.
• W2087560896 creator A5086071913 @default.
• W2087560896 date "2008-09-01" @default.
• W2087560896 modified "2023-10-18" @default.
• W2087560896 title "ATP Hydrolysis and Pristinamycin IIA Inhibition of the Staphylococcus aureus Vga(A), a Dual ABC Protein Involved in Streptogramin A Resistance" @default.
• W2087560896 cites W1535875407 @default.
• W2087560896 cites W1719045946 @default.
• W2087560896 cites W184247063 @default.
• W2087560896 cites W1965364320 @default.
• W2087560896 cites W1972368087 @default.
• W2087560896 cites W1973160059 @default.
• W2087560896 cites W1981871034 @default.
• W2087560896 cites W1982662224 @default.
• W2087560896 cites W2002836562 @default.
• W2087560896 cites W2006178873 @default.
• W2087560896 cites W2022000951 @default.
• W2087560896 cites W2022440354 @default.
• W2087560896 cites W2030284106 @default.
• W2087560896 cites W2031900580 @default.
• W2087560896 cites W2053726952 @default.
• W2087560896 cites W2056367481 @default.
• W2087560896 cites W2057123728 @default.
• W2087560896 cites W2065956146 @default.
• W2087560896 cites W2072135452 @default.
• W2087560896 cites W2074955119 @default.
• W2087560896 cites W2077417526 @default.
• W2087560896 cites W2080223187 @default.
• W2087560896 cites W2086013110 @default.
• W2087560896 cites W2088505188 @default.
• W2087560896 cites W2094537302 @default.
• W2087560896 cites W2099241947 @default.
• W2087560896 cites W2099628002 @default.
• W2087560896 cites W2100502864 @default.
• W2087560896 cites W2103784912 @default.
• W2087560896 cites W2108717129 @default.
• W2087560896 cites W2116764760 @default.
• W2087560896 cites W2119509323 @default.
• W2087560896 cites W2120965701 @default.
• W2087560896 cites W2128460987 @default.
• W2087560896 cites W2133848190 @default.
• W2087560896 cites W2139319648 @default.
• W2087560896 cites W2142785321 @default.
• W2087560896 cites W2147655656 @default.
• W2087560896 cites W2157664391 @default.
• W2087560896 cites W2161766511 @default.
• W2087560896 cites W2165156478 @default.
• W2087560896 cites W2171128058 @default.
• W2087560896 cites W2230180699 @default.
• W2087560896 cites W347798046 @default.
• W2087560896 cites W4211168112 @default.
• W2087560896 cites W4244847115 @default.
• W2087560896 doi "https://doi.org/10.1074/jbc.m800418200" @default.
• W2087560896 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/18562322" @default.
• W2087560896 hasPublicationYear "2008" @default.
• W2087560896 type Work @default.
• W2087560896 sameAs 2087560896 @default.
• W2087560896 citedByCount "34" @default.
• W2087560896 countsByYear W20875608962013 @default.
• W2087560896 countsByYear W20875608962014 @default.
• W2087560896 countsByYear W20875608962015 @default.
• W2087560896 countsByYear W20875608962016 @default.
• W2087560896 countsByYear W20875608962018 @default.
• W2087560896 countsByYear W20875608962019 @default.
• W2087560896 countsByYear W20875608962020 @default.
• W2087560896 countsByYear W20875608962021 @default.
• W2087560896 countsByYear W20875608962022 @default.
• W2087560896 countsByYear W20875608962023 @default.
• W2087560896 crossrefType "journal-article" @default.
• W2087560896 hasAuthorship W2087560896A5004185009 @default.
• W2087560896 hasAuthorship W2087560896A5013638005 @default.
• W2087560896 hasAuthorship W2087560896A5015544930 @default.
• W2087560896 hasAuthorship W2087560896A5017583915 @default.
• W2087560896 hasAuthorship W2087560896A5045752196 @default.
• W2087560896 hasAuthorship W2087560896A5056741959 @default.
• W2087560896 hasAuthorship W2087560896A5076172595 @default.
• W2087560896 hasAuthorship W2087560896A5086071913 @default.
• W2087560896 hasBestOaLocation W20875608961 @default.
• W2087560896 hasConcept C185592680 @default.
• W2087560896 hasConcept C2779489039 @default.
• W2087560896 hasConcept C523546767 @default.
• W2087560896 hasConcept C54355233 @default.
• W2087560896 hasConcept C86803240 @default.
• W2087560896 hasConcept C89423630 @default.
• W2087560896 hasConceptScore W2087560896C185592680 @default.
• W2087560896 hasConceptScore W2087560896C2779489039 @default.
• W2087560896 hasConceptScore W2087560896C523546767 @default.
• W2087560896 hasConceptScore W2087560896C54355233 @default.
• W2087560896 hasConceptScore W2087560896C86803240 @default.
• W2087560896 hasConceptScore W2087560896C89423630 @default.
• W2087560896 hasIssue "37" @default.

• next