FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2087639494> ?p ?o ?g. }

• W2087639494 endingPage "12887" @default.
• W2087639494 startingPage "12876" @default.
• W2087639494 abstract "In the bacteriophage T4 DNA replication system, T4 RNase H removes the RNA primers and some adjacent DNA before the lagging strand fragments are ligated. This 5′-nuclease has strong structural and functional similarity to the FEN1 nuclease family. We have shown previously that T4 32 protein binds DNA behind the nuclease and increases its processivity. Here we show that T4 RNase H with a C-terminal deletion (residues 278–305) retains its exonuclease activity but is no longer affected by 32 protein. T4 gene 45 replication clamp stimulates T4 RNase H on nicked or gapped substrates, where it can be loaded behind the nuclease, but does not increase its processivity. An N-terminal deletion (residues 2–10) of a conserved clamp interaction motif eliminates stimulation by the clamp. In the crystal structure of T4 RNase H, the binding sites for the clamp at the N terminus and for 32 protein at the C terminus are located close together, away from the catalytic site of the enzyme. By using mutant T4 RNase H with deletions in the binding site for either the clamp or 32 protein, we show that it is the interaction of T4 RNase H with 32 protein, rather than the clamp, that most affects the maturation of lagging strand fragments in the T4 replication system in vitro and T4 phage production in vivo. In the bacteriophage T4 DNA replication system, T4 RNase H removes the RNA primers and some adjacent DNA before the lagging strand fragments are ligated. This 5′-nuclease has strong structural and functional similarity to the FEN1 nuclease family. We have shown previously that T4 32 protein binds DNA behind the nuclease and increases its processivity. Here we show that T4 RNase H with a C-terminal deletion (residues 278–305) retains its exonuclease activity but is no longer affected by 32 protein. T4 gene 45 replication clamp stimulates T4 RNase H on nicked or gapped substrates, where it can be loaded behind the nuclease, but does not increase its processivity. An N-terminal deletion (residues 2–10) of a conserved clamp interaction motif eliminates stimulation by the clamp. In the crystal structure of T4 RNase H, the binding sites for the clamp at the N terminus and for 32 protein at the C terminus are located close together, away from the catalytic site of the enzyme. By using mutant T4 RNase H with deletions in the binding site for either the clamp or 32 protein, we show that it is the interaction of T4 RNase H with 32 protein, rather than the clamp, that most affects the maturation of lagging strand fragments in the T4 replication system in vitro and T4 phage production in vivo. DNA synthesis on the lagging strand of the replication fork is accomplished by the rapid repetition of a cycle in which primase makes a short RNA primer that is elongated by polymerase; the primer is removed from the previous fragment, and the two fragments are joined by DNA ligase. The efficient sealing of adjacent fragments is essential to maintain the accuracy of DNA replication. The accumulation of nicks and gaps on the lagging strand ultimately results in double-stranded breaks, increased mutation frequencies, and cell lethality (reviewed in Refs. 1.Liu Y. Kao H.-I. Bambara R.A. Annu. Rev. Biochem. 2004; 73: 589-615Crossref PubMed Scopus (303) Google Scholar and 2.Henneke G. Friedrich-Heineken E. Hubscher U. Trends Biochem. Sci. 2003; 28: 384-390Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar). The lagging strand cycle must be repeated every few seconds because the discontinuous fragments are so short, 1–2 kb in prokaryotes and less than 200 bases in eukaryotes. In each of the replication systems studied, the primers are removed by a member of a family of 5′-nucleases with conserved sequences and similar structures (Fig. 1). It is important that the process of primer removal from one fragment is coordinated with the elongation of the next fragment to ensure rapid and accurate replication. Our studies indicate that the mechanism by which lagging strand polymerization and primer removal are coordinated in bacteriophage T4 replication is different from that used in eukaryotes. The phage T4 member of the FEN1 nuclease family was called T4 RNase H because it hydrolyzed the RNA strand in an RNA:DNA hybrid, as expected for an enzyme removing the RNA primers. However, it also acts as a 5′-nuclease on DNA duplexes (3.Hollingsworth H.C. Nossal N.G. J. Biol. Chem. 1991; 266: 1888-1897Abstract Full Text PDF PubMed Google Scholar). Genetic studies indicate that either T4 RNase H or the 5′- to 3′-exonuclease of the Escherichia coli host DNA polymerase I is necessary for phage production (4.Hobbs L.J. Nossal N.G. J. Bacteriol. 1996; 178: 6772-6777Crossref PubMed Google Scholar). A T4 mutant with a large deletion (Δ118–305) in the rnh gene gives a burst size of 50% of wild type T4 phage in a wild type host, but a burst of only a few phage per infected cell under nonpermissive conditions in E. coli PolA12, which has a conditionally lethal mutation in the host nuclease. Short DNA fragments accumulate, consistent with a defect in removing the primers from lagging strand fragments that prevents ligation of adjacent fragments. Phage production is restored by supplying T4 RNase H on a plasmid. The T4 rnh deletion mutant is also hypersensitive to UV irradiation and to antitumor agents that induce T4 topoisomerase cleavage products (5.Woodworth D.L. Kreuzer K.N. Genetics. 1996; 143: 1081-1090Crossref PubMed Google Scholar) and is defective in DNA homing (6.Huang Y.-J. Parker M.M. Belfort M. Genetics. 1999; 153: 1501-1512PubMed Google Scholar). Processing of the RNA transcript that serves as the primer for leading strand synthesis at the T4 uvsY origin appears to be impaired in the T4 rnh mutant (7.Belanger K.G. Kreuzer K.N. Mol. Cell. 1998; 2: 693-701Abstract Full Text Full Text PDF PubMed Scopus (23) Google Scholar). The 5′-nucleases in this family have both a 5′-exonuclease activity that degrades RNA:DNA and DNA:DNA duplexes, giving short oligonucleotide products, and a flap endonuclease activity that cuts close to the junction of single- and double-stranded DNA on fork and flap substrates (reviewed in Ref. 1.Liu Y. Kao H.-I. Bambara R.A. Annu. Rev. Biochem. 2004; 73: 589-615Crossref PubMed Scopus (303) Google Scholar). The relative strength of these two activities differs within the family, with the exonuclease stronger in the phage enzymes (T4 RNase H (8.Bhagwat M. Hobbs L.J. Nossal N.G. J. Biol. Chem. 1997; 272: 28523-28530Abstract Full Text Full Text PDF PubMed Scopus (21) Google Scholar) and T5 5′ to 3′-exonuclease (9.Pickering T. Garforth S. Thorpe S. Sayers J. Grasby J. Nucleic Acids Res. 1999; 27: 730-735Crossref PubMed Scopus (21) Google Scholar)) and the flap endonuclease stronger in the FEN proteins (10.Harrington J.J. Lieber M.R. EMBO J. 1994; 13: 1235-1246Crossref PubMed Scopus (373) Google Scholar). The 5′-exonuclease activity of T4 RNase H is nonprocessive, removing a single oligonucleotide (predominantly dimers and trimers) each time it binds its substrate. On substrates where the T4 gene 32 ssDNA 1The abbreviations used are: ssDNA, single-stranded DNA; PCNA, proliferating cell nuclear antigen; RPA, replication protein A; pol, polymerase; b, base; gp, gene product.-binding protein can bind behind the nuclease, its processivity is increased, so that a total of about 10 short oligonucleotides are hydrolyzed at each binding. However, the flap endonuclease of T4 RNase H is inhibited when 32 protein binds to the single-stranded flap (8.Bhagwat M. Hobbs L.J. Nossal N.G. J. Biol. Chem. 1997; 272: 28523-28530Abstract Full Text Full Text PDF PubMed Scopus (21) Google Scholar). Similarly, FEN1 cutting of flaps long enough to bind RPA, the eukaryotic counterpart of 32 protein, is inhibited when RPA is present (1.Liu Y. Kao H.-I. Bambara R.A. Annu. Rev. Biochem. 2004; 73: 589-615Crossref PubMed Scopus (303) Google Scholar). In the bacteriophage T4 replication system, the polymerase is held on the primer by the gene 45 clamp, which is loaded by the 44/62 clamp loader complex. T4 32 protein plays a major role in orchestrating the lagging strand cycle by increasing primer synthesis, promoting loading of the clamp by the clamp loader, and increasing the processivity of both polymerase and RNase H (11.Nossal N.G. Karem J. Molecular Biology of Bacteriophage T4. American Society for Microbiology, Washington, D. C.1994: 43-53Google Scholar, 12.Benkovic S.J. Valentine A.M. Salinas F. Annu. Rev. Biochem. 2001; 70: 181-208Crossref PubMed Scopus (274) Google Scholar). We have previously shown that T4 RNase H removes the RNA primers and about 30 nucleotides of adjacent DNA from each lagging strand fragment during DNA replication in vitro, and that it is the 5′-exonuclease activity, rather than the flap endonuclease, that is responsible for most of this digestion (13.Bhagwat M. Nossal N.G. J. Biol. Chem. 2001; 276: 28516-28524Abstract Full Text Full Text PDF PubMed Scopus (25) Google Scholar). Our studies indicated that, on most molecules, polymerase filled in the gap between adjacent fragments before the nuclease could bind for a second round of degradation. The amount of DNA removed along with the primers was similar to the DNA removed during a single binding by T4 RNase H, when 32 protein was behind it. Thus our studies were consistent with a model in which the extent of degradation was controlled by the difference in rates of digestion by T4 RNase H and synthesis by polymerase, when 32 protein covered the single-stranded DNA between them. In eukaryotic DNA replication, both FEN1 nuclease and the nuclease activity of the Dna2 helicase-nuclease have roles in removing primers from eukaryotic lagging strand fragments (reviewed in Refs. 1.Liu Y. Kao H.-I. Bambara R.A. Annu. Rev. Biochem. 2004; 73: 589-615Crossref PubMed Scopus (303) Google Scholar and 14.Hubscher U. Seo Y.S. Mol. Cell. 2001; 12: 149-157Google Scholar). Recent studies (15.Garg P. Stith C.M. Sabouri N. Johansson E. Burgers P.M. Genes Dev. 2004; 18: 2764-2773Crossref PubMed Scopus (174) Google Scholar, 16.Ayyagari R. Gomes X.V. Gordenin D.A. Burgers P.M. J. Biol. Chem. 2003; 278: 1618-1625Abstract Full Text Full Text PDF PubMed Scopus (201) Google Scholar, 17.Kao H.I. Veeraraghavan J. Polaczek P. Campbell J.L. Bambara R.A. J. Biol. Chem. 2004; 279: 15014-15024Abstract Full Text Full Text PDF PubMed Scopus (87) Google Scholar, 18.Maga G. Villani G. Tillement V. Stucki M. Locatelli G.A. Frouin I. Spadari S. Hubscher U. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 14298-14303Crossref PubMed Scopus (112) Google Scholar) indicate that, in contrast to T4 RNase H, FEN1 uses its flap endonuclease to remove the primer and adjacent DNA, after a flap is created by the polymerase extending the upstream fragment. The rate of strand displacement synthesis by Saccharomyces cerevisiae pol δ with the PCNA clamp and replication factor C clamp loader is increased by FEN1, so that these four proteins together catalyze efficient nick translation. The interaction between FEN1 and the PCNA replication clamp is clearly important, because there was less strand displacement synthesis with a FEN1 protein with a mutation in the C-terminal PCNA interaction site (16.Ayyagari R. Gomes X.V. Gordenin D.A. Burgers P.M. J. Biol. Chem. 2003; 278: 1618-1625Abstract Full Text Full Text PDF PubMed Scopus (201) Google Scholar). In this paper we show that T4 RNase H, like FEN1, is stimulated by its replication clamp, the T4 gene 45 protein. However, in contrast to FEN1, T4 RNase H interaction with the 45 clamp is not required for the normal processing of lagging strand fragments. Instead, it is the T4 RNase H interaction with 32 protein that is essential. T4 RNase H interacts with the clamp through a conserved clamp-binding motif at the N terminus of the nuclease. A C-terminal helical bundle at the C terminus of the nuclease is needed for its stimulation by 32 protein. An N-terminal deletion in T4 RNase H that prevents stimulation by the clamp does not decrease fragment sealing in the T4 replication system in vitro. Plasmid encoding this mutant T4 RNase H can replace the wild type in restoring production of T4 phage with a disrupted rnh gene. C-terminal deletions that abolish T4 RNase H interaction with 32 protein strongly impair fragment maturation in vitro and fail to restore T4 Δrnh mutant phage production in vivo. DNA Substrates—Oligonucleotides were made and reverse phase-purified by Sigma-Genosys, except that oligonucleotides longer than 50 bases were gel-purified. The 3′ or 5′ end-labeled partial duplexes were made by annealing an 84-mer DNA complementary to nucleotides 6198–6281 of M13mp19 to the viral single-stranded DNA, as described previously (13.Bhagwat M. Nossal N.G. J. Biol. Chem. 2001; 276: 28516-28524Abstract Full Text Full Text PDF PubMed Scopus (25) Google Scholar). Nicked or gapped molecules were made as described (13.Bhagwat M. Nossal N.G. J. Biol. Chem. 2001; 276: 28516-28524Abstract Full Text Full Text PDF PubMed Scopus (25) Google Scholar) by annealing oligonucleotides complementary to the following sequences of M13mp19 behind the labeled 86-mer: nicked, 41-mer, 6282– 6322; gap of 7, 61-mer, 6289–6350; 14, 61-mer, 6296–6357; 28, 43-mer, 6309–6351; 100, 44-mer, 6382– 6426; 200, 44-mer, 6482– 6526; and 1479, 42-mer, 510–551. The construction and nicking of the 2.7-kb pUCNICK circular plasmid, a pUC19 derivative with a single recognition site for the N.BbvC IA nicking enzyme (New England Biolabs), have been described (19.Jones C.E. Green E.M. Stephens J.A. Mueser T.C. Nossal N.G. J. Biol. Chem. 2004; 279: 25721-25728Abstract Full Text Full Text PDF PubMed Scopus (13) Google Scholar). T4 Replication Proteins—Wild type T4 RNase H, T4 DNA polymerase, T4 gene 45 clamp, genes 44/62 clamp loader, gene 41 helicase, gene 59 helicase loading protein, and gene 61 primase were purified to apparent homogeneity as described by Nossal et al. (20.Nossal N.G. Hinton D.M. Hobbs L.J. Spacciapoli P. Methods Enzymol. 1995; 262: 560-584Crossref PubMed Scopus (33) Google Scholar). Wild type 32 protein was purified as described (21.Jones C.E. Mueser T.C. Nossal N.G. J. Biol. Chem. 2004; 279: 12067-12075Abstract Full Text Full Text PDF PubMed Scopus (23) Google Scholar). The truncated 32 proteins, 32-A and 32-B, were the generous gift of David Geidroc (22.Jiang H. Giedroc D. Kodadek T. J. Biol. Chem. 1993; 268: 7904-7911Abstract Full Text PDF PubMed Google Scholar, 23.Giedroc D.P. Khan R. Barnhart K. J. Biol. Chem. 1990; 265: 11444-11455Abstract Full Text PDF PubMed Google Scholar). T4 DNA ligase was obtained from U. S. Biochemical Corp. Nuclease and Polymerase Assays—Unless otherwise indicated, reaction mixtures (10 μl) contained 1.0 nm substrate, 25 mm Tris acetate, pH 7.5, 63 mm potassium acetate, 6 mm magnesium acetate, 20 mm dithiothreitol, 1 mm EDTA, and 200 μg/ml bovine serum albumin. The concentrations of wild type and mutant T4 RNase H are indicated in the figure legends. When present, gene 32 single-stranded DNA-binding protein was 1 μm; T4 DNA polymerase, gene 45 clamp protein (trimer), and gene 44/62 (4:1 complex) clamp loader were 60, 160, and 240 nm, respectively; and T4 DNA ligase was 200 Weiss units/ml, unless otherwise indicated. In experiments that included polymerase, clamp, and clamp loader, ATP was present at 1 mm and each dNTP at 250 μm. Unless otherwise indicated, reaction mixtures without T4 RNase H, ligase, or DNA polymerase were incubated for 2 min at 30 °C, and the reaction was begun by the addition of the nuclease, or a mixture of the nuclease, ligase, and polymerase, as noted in the figures. Aliquots were taken at the times indicated, and the reaction was stopped by addition of 1.5 volumes of a solution of 83% (v/v) formamide, 0.01% xylene cyanol and bromphenol blue, and 33 mm EDTA. Products were heated for 3 min at 95 °C before electrophoresis on polyacrylamide (19:1), 7 m urea gels of the percentage indicated in the figure legends. Gels were exposed to Kodak Biomax MR film or were scanned and quantified with a Fujifilm FLA 3000 PhosphorImager and Fuji Multigauge software. In the experiments shown in Figs. 2B and 10, 5-μl aliquots of the reaction mixtures were removed at the indicated times and then heated for 20 min at 60 °C to inactivate the enzymes. BstNI endonuclease (2 units) (New England Biolabs) was then added, and the incubation at 60 °C continued for 30 min, before adding 7 μl of the formamide stop solution.Fig. 10Sealing of lagging strand fragments in a model lagging strand system is less efficient with the T4 RNase H C-terminal Δ278–305 deletion. The template is M13mp19 ssDNA with a 1479-base (b) gap between the annealed 3′ end-labeled 86-mer and the unlabeled 42-mer. The DNA was incubated with the T4 32 protein, 45 clamp, and 44/62 clamp loader for 2 min at 30 °C, before the addition of wild type (WT) or mutant T4 RNase H (10 nm), T4 DNA ligase, and T4 DNA polymerase for the times shown, as indicated. The reactions were stopped by heating to 60 °C, the products digested with BstNI nuclease, and then heated for 3 min at 95 °C before electrophoresis. The [32P] 86-mer was elongated past the BstNI site, giving a 143-base restriction product in the absence of T4 RNase H (reactions 7 and 8). The products shorter than 143 bases are a measure of hydrolysis by the exonuclease activity of T4 RNase H (reactions 1, 3, and 5). The 191-base products are molecules ligated following T4 RNase H digestion to expose a 5′-phosphate, and gap filling by polymerase (reactions 2, 4, and 6). * marks the position of 32P on the 86-mer. Conditions for the replication and BstNI restriction reactions are described under “Experimental Procedures.” Products are displayed on a 12% polyacrylamide gel.View Large Image Figure ViewerDownload Hi-res image Download (PPT) Coupled Leading and Lagging Strand Synthesis—The reaction mixtures (10 μl) contained 1.6 nm singly nicked pUCNICK plasmid (2.7 kb), 2 mm ATP, 250 μm of each dNTP including [α-32P] dTTP (∼1800 cpm/pmol), 250 μm CTP, GTP, and UTP, 25 mm Tris acetate, pH 7.5, 60 mm potassium acetate, 6 mm magnesium acetate, 10 mm dithiothreitol, and 20 μg/ml bovine serum albumin. The protein concentrations were 2 μm 32 ssDNA-binding protein, 328 nm 41 helicase, 30 nm wild type DNA polymerase, 242 nm 44/62 clamp loader, 162 nm 45 clamp, 95 nm 59 helicase loading protein, and 64 nm 61 primase. When indicated, RNase H was 100 nm, and DNA ligase was 200 Weiss units/ml. Reaction mixtures without polymerase, primase, helicase, RNase H, and DNA ligase were incubated for 2 min at 37 °C, and synthesis was begun by the addition of polymerase, primase, and helicase. RNase H and DNA ligase were added 1 min later. At the times indicated, aliquots of the reaction mixtures were mixed with an equal volume of 0.2 m EDTA to stop the synthesis, and the products were analyzed by 0.6% alkaline agarose gel electrophoresis (24.Venkatesan M. Silver L.L. Nossal N.G. J. Biol. Chem. 1982; 257: 12426-12434Abstract Full Text PDF PubMed Google Scholar) and trichloroacetic acid precipitation (20.Nossal N.G. Hinton D.M. Hobbs L.J. Spacciapoli P. Methods Enzymol. 1995; 262: 560-584Crossref PubMed Scopus (33) Google Scholar). Plasmids Encoding T4 RNase H Mutant Proteins—The C-terminal deletion of T4 RNase H ΔC 278–305 (ΔC) was made by cutting plasmid pNN2202 (3.Hollingsworth H.C. Nossal N.G. J. Biol. Chem. 1991; 266: 1888-1897Abstract Full Text PDF PubMed Google Scholar) (wild type T4 RNase H under the control of the T7 promoter) partially with SspI and totally with EcoRI restriction nucleases, and ligating the duplex made by annealing 5′-ATTGCTTCAAACATTGTGAATTACTATAATTCATAGTAG with 3′-TAACGAAGTTTGTAACACTTAATGATATTAAGTATCATCTTAA to the 3936-bp fragment. The Δ286–305 and Δ295–305 deletions were made by cutting with DraIII and EcoRI nucleases and inserting duplexes made by annealing 5′-GTGGCAAAATTTAG with 3′-GCGCACCGTTTTAAATCTTAA and 5′-GTGGCAAAATTTATTCATATTTTGTAAAAGCGGGTCTTTAG with 3′GCGCACCGTTTTAAATAAGTATAAAACATTTTCGCCCAGAAATCTTAA, respectively. The ΔN 2–10 deletion was made by cutting pNQ1004 (wild type T4 RNase H in the pNN1901 T7 vector (3.Hollingsworth H.C. Nossal N.G. J. Biol. Chem. 1991; 266: 1888-1897Abstract Full Text PDF PubMed Google Scholar)) with NdeI and PshAI nucleases and inserting the duplex formed from 5′-TATGTACAAAGAAGGAATCTGCTTAATTGACTT and 3′-ACATGTTTCTTCCTTAGACGAATTAACTGAA. Point mutations in the N-terminal region of T4 RNase H were made by site-directed mutagenesis of the wild type gene in the plasmid pV-C2001 (3.Hollingsworth H.C. Nossal N.G. J. Biol. Chem. 1991; 266: 1888-1897Abstract Full Text PDF PubMed Google Scholar), using the method of Kunkel et al. (25.Kunkel T.A. Roberts J.D. Zakour R.A. Methods Enzymol. 1987; 154: 367-382Crossref PubMed Scopus (4558) Google Scholar), modified by using T4 DNA polymerase, T4 44/64 clamp loader, and 45 clamp to copy the ssDNA template. The oligonucleotide primers (the sequence complementary to the mutation codon is underlined) used are as follows: L3A, 5′-CCAACATCATTTCTGCATCCATATATATCTCC; M6A, 5′-GTAATCTTCATCCAACGCCATTTCTAAATCC; L3A,M6A, 5′-GTAATCTTCATCCAACGCCATTTCTGCATCCATATATATCTCC; M5A, 5′-CTTCATCCAACATCGCTTCTAAATCCATATATATCTCC; and D8A, 5′-CCTTCTTTGTAATCTTCAGCCAACATCATTTCTAAATCC. Mutations were verified by DNA sequencing. Purification of the Mutant Proteins—All of the plasmids were transformed into E. coli BL21(DE3)pLysS (26.Studier F.W. Rosenberg A.H. Dunn J.J. Dubendorff J.W. Methods Enzymol. 1990; 185: 60-89Crossref PubMed Scopus (6004) Google Scholar) for expression of the proteins. With the exception of ΔC-(278–305), the mutant proteins were induced with isopropyl thioglucoside for 2 h at 37 °C, as described for the wild type protein (20.Nossal N.G. Hinton D.M. Hobbs L.J. Spacciapoli P. Methods Enzymol. 1995; 262: 560-584Crossref PubMed Scopus (33) Google Scholar), and partially purified by the small scale procedure described in Ref. 27.Bhagwat M. Meara D. Nossal N.G. J. Biol. Chem. 1997; 272: 28531-28538Abstract Full Text Full Text PDF PubMed Scopus (34) Google Scholar. For ΔC-(278–305), plasmid pMB5002 in BL21(DE3)pLysS was grown in Luria Broth with 50 μg/ml of carbenicillin (Invitrogen) at 24 °C to A600 = 0.4 in a 20-liter New Brunswick Scientific BioFlo 3000 fermentor, and protein synthesis was induced by addition of 1 mm isopropyl thioglucoside. The cells (45 g) were harvested after overnight induction, resuspended in 50 mm Tris-Cl, pH 7.5, 500 mm NH4Cl, 10 mm MgCl2, 2 mm dithiothreitol, and 0.1 mm 4-(2-aminoethyl)-benzenesulfonyl fluoride hydrochloride, and broken by sonication, and the cell lysate was clarified by centrifugation at 100,000 × g at 4 °C. T4 RNase H was purified from the supernatant by chromatography first on SP-Sepharose (Amersham Biosciences) and then on Poros-S (Perspective Biosystems) by using linear gradients formed from PC buffer A (50 mm Tris-Cl, pH 8.0, 100 mm NH4Cl, 10 mm MgCl2,1mm dithiothreitol, 1 mm EDTA, and 25 μg/ml 4-(2-aminoethyl)-benzenesulfonyl fluoride hydrochloride) and PC buffer B (PC, buffer A containing 750 mm NaCl). Complementation of Bacteriophage T4 Δrnh by Plasmids Encoding Wild Type and Mutant T4 RNase H—T4 Δrnh (4.Hobbs L.J. Nossal N.G. J. Bacteriol. 1996; 178: 6772-6777Crossref PubMed Google Scholar) has a deletion of residues 118–305 in the gene encoding T4 RNase H. The host E. coli MIC2003, an rnhA339::catpolA12 derivative of E. coli FB2 (28.Itaya M. Crouch R.J. Mol. Gen. Genet. 1991; 227: 424-432Crossref PubMed Scopus (58) Google Scholar), has an interruption in the gene for RNase HI and a temperature-sensitive mutation in DNA pol I affecting its 5′-nuclease. The host also contained pGP1.2 (29.Tabor S. Richardson C.C. Proc. Natl. Acad. Sci. U. S. A. 1985; 82: 1074-1078Crossref PubMed Scopus (2456) Google Scholar), a plasmid with the gene for T7 RNA polymerase under the temperature controlled PL promoter, as well as a compatible plasmid with T4 RNase H under control of the T7 promoter as follows: pNQ1004 (wild type), pNQ1101 (ΔN-(Δ2–10)), pMB5002 (ΔC-(Δ278–305)), pGO1701 (ΔC-(Δ286–305)), pGO1801(ΔC-(Δ295–305)), or the pVex11 vector (see Refs. 3.Hollingsworth H.C. Nossal N.G. J. Biol. Chem. 1991; 266: 1888-1897Abstract Full Text PDF PubMed Google Scholar and 4.Hobbs L.J. Nossal N.G. J. Bacteriol. 1996; 178: 6772-6777Crossref PubMed Google Scholar and this paper). Cells were grown in LB media with 60 μg/ml kanomycin and 50 μg/ml carbenicillin to 1 × 10 8/ml at 30 °C, shifted to 43 °C for 15 min to induce production of T7 RNA polymerase and disrupt the polA12 DNA polymerase, and then infected with wild type T4D or T4 Δrnh at a multiplicity of 0.5 phage/bacteria. Infective centers were determined by plating on E. coli CR63 after 5 min. Total phage were measured at 60 min, after lysis with chloroform. T4 RNase H Exonuclease Activity Is Stimulated When the T4 Gene 45 Clamp Protein Is Loaded Behind It—The T4 gene 45 replication clamp protein is loaded preferentially at the 3′ end of a junction between single- and double-stranded DNA and at the 3′ side of a nick (11.Nossal N.G. Karem J. Molecular Biology of Bacteriophage T4. American Society for Microbiology, Washington, D. C.1994: 43-53Google Scholar, 12.Benkovic S.J. Valentine A.M. Salinas F. Annu. Rev. Biochem. 2001; 70: 181-208Crossref PubMed Scopus (274) Google Scholar), whereas T4 RNase H is loaded at the 5′ end (3.Hollingsworth H.C. Nossal N.G. J. Biol. Chem. 1991; 266: 1888-1897Abstract Full Text PDF PubMed Google Scholar) (see Fig. 1C and diagrams at the top of Fig. 2A). The clamp protein can move in both directions on the duplex DNA. It can also track for short distances on single-stranded DNA but falls off single-stranded DNA more rapidly than double-stranded DNA (30.Sanders G.M. Kassavetis G.A. Geiduschek E.P. EMBO J. 1995; 14: 3966-3976Crossref PubMed Scopus (21) Google Scholar). In Fig. 2, the nicked, gapped, and partial duplex substrates were made by annealing oligonucleotides to single-stranded circular DNA and were labeled at the 3′ end of the downstream 86-base fragment. Addition of the T4 clamp, clamp loader, and ATP stimulates the 5′- to 3′-exonuclease on the nicked substrate (Fig. 2A, lane 9) and on the substrate with the 28-base gap (lane 14), where the clamp can be loaded behind the nuclease but does not stimulate on the partial duplex (lane 4). The nuclease, by itself, has similar activity on the partial duplex and the gapped molecule (Fig. 2A, lanes 2 and 12) but has very little activity on the nicked substrate (lane 7), where there is no single-stranded DNA behind the 3′-labeled duplex. As we have shown previously (8.Bhagwat M. Hobbs L.J. Nossal N.G. J. Biol. Chem. 1997; 272: 28523-28530Abstract Full Text Full Text PDF PubMed Scopus (21) Google Scholar), 32 protein increases the processivity of the nuclease when there is single-stranded DNA behind the nuclease (Fig. 2A, lanes 3 and 13). However, it does not increase the nuclease activity on the nicked substrate (Fig. 2A, lane 8). There will be more clamp loaded in front of the nuclease in reactions with 32 protein because 32 protein increases the loading of the clamp by the clamp loader (31.Richardson R.W. Ellis R.L. Nossal N.G. UCLA Symp. Mol. Cell. Biol. 1990; 127: 247-259Google Scholar, 32.Capson T.L. Benkovic S.J. Nossal N.G. Cell. 1991; 65: 249-258Abstract Full Text PDF PubMed Scopus (70) Google Scholar). Interference by this increased clamp in front of the nuclease is the likely reason that there is less activity on the nicked substrate when 32 protein is present in addition to the clamp, clamp loader, and ATP (compare Fig. 2A, lanes 9 and 10, and Fig. 2B, reactions 4 and 5). When polymerase is present to extend the duplex available to the clamp ahead of the nuclease, there is no longer inhibition by 32 protein (Fig. 2B, compare reactions 12 and 13). Note that in Fig. 2B, the reaction products were cut with BstNI restriction nuclease to allow determination of the extent of hydrolysis at the 5′ end. ATP and the T4 gene 44/62 clamp loader are needed in addition to the clamp for stimulation of T4 RNase H activity on nicked substrates. This is shown, using 5′ end-labeled substrates, in Fig. 3. Addition of the clamp did not change the size of the oligonucleotides removed by the nuclease, which are predominantly dimers and trimers (8.Bhagwat M. Hobbs L.J. Nossal N.G. J. Biol. Chem. 1997; 272: 28523-28530Abstract Full Text Full Text PDF PubMed Scopus (21) Google Scholar). The same size distribution is observed when a 5′-labeled partial duplex is cut by the nuclease alone (Fig. 3, reaction 2), and when the nicked substrate is cut in the presence of the clamp, clamp loader, and ATP (reaction 10). The T4 clamp can move along single-stranded DNA, but it falls off more rapidly than on a duplex (30.Sanders G.M. Kassavetis G.A. Geiduschek E.P. EMBO J. 1995; 14: 3966-3976Crossref PubMed Scopus (21) Google Scholar, 33.Fu T.J. Sanders G.M. O'Donnell M. Geiduschek E.P. EMBO J. 1996; 15: 4414-4422Crossref PubMed Scopus (26) Google Scholar). We detected some stimulation of RNase H when the gap between the nucleotides was increased from 28 to 100 bases, but none with a gap of 200 bases (Fig. 4). The Clamp Does Not Increase the Processivity of T4 RNase H—Circular replication clamps surrounding the DNA tether their respective polymerases on the template, thus increasing their processivity (number of nucleotides added per polymerase binding). We have shown previously that T4 RNase H by itself is nonprocessive, hydrolyzing a single small oligonucleotide with each binding, but that the nuclease becomes processive when the T4 gene 32 protein is added (8.Bhagwat M. Hobbs L.J. Nossal N.G. J. Biol. Chem. 1997; 272: 28523-28530Abstract F" @default.
• W2087639494 created "2016-06-24" @default.
• W2087639494 creator A5040061561 @default.
• W2087639494 creator A5042554621 @default.
• W2087639494 creator A5047728166 @default.
• W2087639494 creator A5063784999 @default.
• W2087639494 date "2005-04-01" @default.
• W2087639494 modified "2023-10-03" @default.
• W2087639494 title "Maturation of Bacteriophage T4 Lagging Strand Fragments Depends on Interaction of T4 RNase H with T4 32 Protein Rather than the T4 Gene 45 Clamp" @default.
• W2087639494 cites W1482984452 @default.
• W2087639494 cites W1509876975 @default.
• W2087639494 cites W1525204026 @default.
• W2087639494 cites W1560122944 @default.
• W2087639494 cites W1563567580 @default.
• W2087639494 cites W1575390278 @default.
• W2087639494 cites W1588334665 @default.
• W2087639494 cites W1729887059 @default.
• W2087639494 cites W1869365373 @default.
• W2087639494 cites W1873199501 @default.
• W2087639494 cites W1965325498 @default.
• W2087639494 cites W1972794006 @default.
• W2087639494 cites W1986113777 @default.
• W2087639494 cites W1988018492 @default.
• W2087639494 cites W1992210568 @default.
• W2087639494 cites W1994561103 @default.
• W2087639494 cites W1997002747 @default.
• W2087639494 cites W2002995501 @default.
• W2087639494 cites W2006717413 @default.
• W2087639494 cites W2007362519 @default.
• W2087639494 cites W2013755417 @default.
• W2087639494 cites W2014523793 @default.
• W2087639494 cites W2021483139 @default.
• W2087639494 cites W2022851315 @default.
• W2087639494 cites W2027658259 @default.
• W2087639494 cites W2033384358 @default.
• W2087639494 cites W2041249795 @default.
• W2087639494 cites W2057697439 @default.
• W2087639494 cites W2063442955 @default.
• W2087639494 cites W2064264662 @default.
• W2087639494 cites W2067462159 @default.
• W2087639494 cites W2068518785 @default.
• W2087639494 cites W2069549484 @default.
• W2087639494 cites W2078897874 @default.
• W2087639494 cites W2082995057 @default.
• W2087639494 cites W2085547772 @default.
• W2087639494 cites W2086103125 @default.
• W2087639494 cites W2086712020 @default.
• W2087639494 cites W2100626549 @default.
• W2087639494 cites W2104247890 @default.
• W2087639494 cites W2104261681 @default.
• W2087639494 cites W2111202021 @default.
• W2087639494 cites W2116537286 @default.
• W2087639494 cites W2121844676 @default.
• W2087639494 cites W2123511727 @default.
• W2087639494 cites W2125134074 @default.
• W2087639494 cites W2132978503 @default.
• W2087639494 cites W2133231925 @default.
• W2087639494 cites W2152326664 @default.
• W2087639494 cites W2152920971 @default.
• W2087639494 cites W2153734931 @default.
• W2087639494 cites W2159531864 @default.
• W2087639494 cites W2161248815 @default.
• W2087639494 cites W2168114577 @default.
• W2087639494 cites W2236641604 @default.
• W2087639494 cites W2399352549 @default.
• W2087639494 cites W2888511473 @default.
• W2087639494 cites W47123523 @default.
• W2087639494 doi "https://doi.org/10.1074/jbc.m414025200" @default.
• W2087639494 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/15659404" @default.
• W2087639494 hasPublicationYear "2005" @default.
• W2087639494 type Work @default.
• W2087639494 sameAs 2087639494 @default.
• W2087639494 citedByCount "11" @default.
• W2087639494 countsByYear W20876394942015 @default.
• W2087639494 countsByYear W20876394942016 @default.
• W2087639494 countsByYear W20876394942018 @default.
• W2087639494 countsByYear W20876394942021 @default.
• W2087639494 crossrefType "journal-article" @default.
• W2087639494 hasAuthorship W2087639494A5040061561 @default.
• W2087639494 hasAuthorship W2087639494A5042554621 @default.
• W2087639494 hasAuthorship W2087639494A5047728166 @default.
• W2087639494 hasAuthorship W2087639494A5063784999 @default.
• W2087639494 hasBestOaLocation W20876394941 @default.
• W2087639494 hasConcept C104317684 @default.
• W2087639494 hasConcept C10879258 @default.
• W2087639494 hasConcept C12554922 @default.
• W2087639494 hasConcept C127413603 @default.
• W2087639494 hasConcept C153911025 @default.
• W2087639494 hasConcept C185592680 @default.
• W2087639494 hasConcept C2776161997 @default.
• W2087639494 hasConcept C2776441376 @default.
• W2087639494 hasConcept C54355233 @default.
• W2087639494 hasConcept C547475151 @default.
• W2087639494 hasConcept C67705224 @default.
• W2087639494 hasConcept C78519656 @default.
• W2087639494 hasConcept C84111939 @default.
• W2087639494 hasConcept C86803240 @default.
• W2087639494 hasConceptScore W2087639494C104317684 @default.

• next