Matches in SemOpenAlex for { <https://semopenalex.org/work/W2087902039> ?p ?o ?g. }
Showing items 1 to 94 of
94
with 100 items per page.
- W2087902039 endingPage "149" @default.
- W2087902039 startingPage "139" @default.
- W2087902039 abstract "A novel and practical assay for the detection of hepatitis B virus (HBV) DNA in serum is described that utilizes as probe a 21-nucleotide sequence 5'-d (CTTCGCTTCACCTCTGCACGT) labelled at the 3'-end with [32P]ddAMP. The oligonucleotide probe sequence occurs in all known HBV genomes and is complementary to a region near the end of the single-stranded gap. It includes the 11-nucleotide direct repeat 5'-d(TTCACCTCTGC). The method was tested on 988 serum HBsAg-positive or -negative specimens and compared to results with HBV DNA probe, with over 98% concordance between the methods. The sensitivity of the two assays was comparable. The assay was developed for testing serum samples fixed to nylon or nitrocellulose membranes. Hybridization time could be shortened to a few hours as compared to 16 h for HBV DNA probes. Immaculate backgrounds were obtained by using a hybridization medium containing polyethylene glycol, heparin and pyrophosphate, and a particular washing procedure." @default.
- W2087902039 created "2016-06-24" @default.
- W2087902039 creator A5072540474 @default.
- W2087902039 creator A5082651902 @default.
- W2087902039 creator A5091803938 @default.
- W2087902039 date "1987-02-01" @default.
- W2087902039 modified "2023-10-18" @default.
- W2087902039 title "An oligonucleotide probe for the detection of hepatitis B virus DNA in serum" @default.
- W2087902039 cites W1858587707 @default.
- W2087902039 cites W192281414 @default.
- W2087902039 cites W1968756188 @default.
- W2087902039 cites W1989995638 @default.
- W2087902039 cites W2013054809 @default.
- W2087902039 cites W2013859724 @default.
- W2087902039 cites W2053335994 @default.
- W2087902039 cites W2053738348 @default.
- W2087902039 cites W2060273986 @default.
- W2087902039 cites W2073398409 @default.
- W2087902039 cites W2090476883 @default.
- W2087902039 cites W2095701059 @default.
- W2087902039 cites W2101584234 @default.
- W2087902039 cites W2104482885 @default.
- W2087902039 cites W2113597524 @default.
- W2087902039 cites W2114289738 @default.
- W2087902039 cites W2140852811 @default.
- W2087902039 doi "https://doi.org/10.1016/0166-0934(87)90057-7" @default.
- W2087902039 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/3558701" @default.
- W2087902039 hasPublicationYear "1987" @default.
- W2087902039 type Work @default.
- W2087902039 sameAs 2087902039 @default.
- W2087902039 citedByCount "23" @default.
- W2087902039 countsByYear W20879020392014 @default.
- W2087902039 crossrefType "journal-article" @default.
- W2087902039 hasAuthorship W2087902039A5072540474 @default.
- W2087902039 hasAuthorship W2087902039A5082651902 @default.
- W2087902039 hasAuthorship W2087902039A5091803938 @default.
- W2087902039 hasConcept C104317684 @default.
- W2087902039 hasConcept C111824103 @default.
- W2087902039 hasConcept C129312508 @default.
- W2087902039 hasConcept C130197536 @default.
- W2087902039 hasConcept C153911025 @default.
- W2087902039 hasConcept C159047783 @default.
- W2087902039 hasConcept C2522874641 @default.
- W2087902039 hasConcept C2777410769 @default.
- W2087902039 hasConcept C2780593183 @default.
- W2087902039 hasConcept C2780617729 @default.
- W2087902039 hasConcept C3017666073 @default.
- W2087902039 hasConcept C49105822 @default.
- W2087902039 hasConcept C512185932 @default.
- W2087902039 hasConcept C54871578 @default.
- W2087902039 hasConcept C552990157 @default.
- W2087902039 hasConcept C55493867 @default.
- W2087902039 hasConcept C84148353 @default.
- W2087902039 hasConcept C86803240 @default.
- W2087902039 hasConceptScore W2087902039C104317684 @default.
- W2087902039 hasConceptScore W2087902039C111824103 @default.
- W2087902039 hasConceptScore W2087902039C129312508 @default.
- W2087902039 hasConceptScore W2087902039C130197536 @default.
- W2087902039 hasConceptScore W2087902039C153911025 @default.
- W2087902039 hasConceptScore W2087902039C159047783 @default.
- W2087902039 hasConceptScore W2087902039C2522874641 @default.
- W2087902039 hasConceptScore W2087902039C2777410769 @default.
- W2087902039 hasConceptScore W2087902039C2780593183 @default.
- W2087902039 hasConceptScore W2087902039C2780617729 @default.
- W2087902039 hasConceptScore W2087902039C3017666073 @default.
- W2087902039 hasConceptScore W2087902039C49105822 @default.
- W2087902039 hasConceptScore W2087902039C512185932 @default.
- W2087902039 hasConceptScore W2087902039C54871578 @default.
- W2087902039 hasConceptScore W2087902039C552990157 @default.
- W2087902039 hasConceptScore W2087902039C55493867 @default.
- W2087902039 hasConceptScore W2087902039C84148353 @default.
- W2087902039 hasConceptScore W2087902039C86803240 @default.
- W2087902039 hasIssue "2" @default.
- W2087902039 hasLocation W20879020391 @default.
- W2087902039 hasLocation W20879020392 @default.
- W2087902039 hasOpenAccess W2087902039 @default.
- W2087902039 hasPrimaryLocation W20879020391 @default.
- W2087902039 hasRelatedWork W1539824308 @default.
- W2087902039 hasRelatedWork W1981296682 @default.
- W2087902039 hasRelatedWork W1996979233 @default.
- W2087902039 hasRelatedWork W2021712506 @default.
- W2087902039 hasRelatedWork W2082707786 @default.
- W2087902039 hasRelatedWork W2087902039 @default.
- W2087902039 hasRelatedWork W2088139568 @default.
- W2087902039 hasRelatedWork W2316226786 @default.
- W2087902039 hasRelatedWork W2397465696 @default.
- W2087902039 hasRelatedWork W2480411 @default.
- W2087902039 hasVolume "15" @default.
- W2087902039 isParatext "false" @default.
- W2087902039 isRetracted "false" @default.
- W2087902039 magId "2087902039" @default.
- W2087902039 workType "article" @default.