FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2087942844> ?p ?o ?g. }

• W2087942844 endingPage "16369" @default.
• W2087942844 startingPage "16361" @default.
• W2087942844 abstract "The promoter of the murine c-Ki-ras proto-oncogene contains a critical homopurine-homopyrimidine sequence which is recognized by a protein factor and is a potential site for triplex-forming oligonucleotides (TFOs). The TFOs designed to bind this critical c-Ki-ras target have either an AG or a GT sequence motif. Of the two types, the first is found to form triplexes with extraordinarily high stability. For instance, both d(AGGGAGGGAGGAAGGGAGGG) (20AG) and d(GGGAGGGAGGGAAGGAGGGAGGGAGGGAGC) (30AG) are able to bind the c-Ki-ras target at 65 degrees C and to resist a polyacrylamide gel temperature of 55 degrees C. By contrast, the triplex formed by d(TGGGTGGGTGGTTGGGTGGG) (20GT) is largely dissociated at a gel temperature of 55 degrees C. The affinity constants of the TFOs at 37 degrees C, 50 mM Tris-HCl, pH 7.4, 50 mM NaCl, 5 mM MgCl2 (standard buffer) were determined through band-shift experiments and found to be respectively 1.0 x 10(6), 4.0 x 10(6), and 2.5 x 10(7) M-1 for 20GT, 30AG, and 20AG. The AG-triplexes exhibit in standard buffer monophasic melting profiles (Tm approximately 75 degrees C) and circular dichoroism spectra showing the typical negative ellipticity at 212 nm, which is a hallmark for triplex DNA. The rate at which the TFOs bind to the c-Ki-ras target at 37 degrees C was examined under pseudo-first-order conditions. When the TFOs are in excess over the target and in the micromolar concentration range, the kinetics of triplex formation are slow, characterized by association half-lives of about 1 h. The ability of the TFOs to act as artificial transcription repressors was examined in a cellular system employing transient transfection experiments. Cultured NIH 3T3 fibroblast cells were cotransfected with a DNA mixture composed by a TFO and plasmid pKRS-413 containing the chloramphenicol acetyltransferase (CAT) gene driven by the c-Ki-ras promoter. It was found that the CAT activity is specifically inhibited by the TFOs in a dose-dependent manner. As expected, stronger CAT repression is obtained with 20AG, the oligonucleotide which forms the more stable triplex. These data suggest that (A,G)-oligonucleotides may provide a valuable means for the selective repression of the c-Ki-ras gene expression." @default.
• W2087942844 created "2016-06-24" @default.
• W2087942844 creator A5055386727 @default.
• W2087942844 creator A5060042575 @default.
• W2087942844 creator A5064906611 @default.
• W2087942844 creator A5065165497 @default.
• W2087942844 date "1996-01-01" @default.
• W2087942844 modified "2023-09-24" @default.
• W2087942844 title "(A,G)-Oligonucleotides Form Extraordinary Stable Triple Helices with a Critical R·Y Sequence of the Murine c-Ki-ras Promoter and Inhibit Transcription in Transfected NIH 3T3 Cells" @default.
• W2087942844 cites W1499463091 @default.
• W2087942844 cites W1569055773 @default.
• W2087942844 cites W1569085750 @default.
• W2087942844 cites W1603718713 @default.
• W2087942844 cites W1977811329 @default.
• W2087942844 cites W2009954568 @default.
• W2087942844 cites W2026254622 @default.
• W2087942844 cites W2038912254 @default.
• W2087942844 cites W2051217184 @default.
• W2087942844 cites W2088076921 @default.
• W2087942844 cites W2105756213 @default.
• W2087942844 cites W2113847593 @default.
• W2087942844 cites W2123017921 @default.
• W2087942844 cites W4251663802 @default.
• W2087942844 doi "https://doi.org/10.1021/bi961750h" @default.
• W2087942844 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/8973212" @default.
• W2087942844 hasPublicationYear "1996" @default.
• W2087942844 type Work @default.
• W2087942844 sameAs 2087942844 @default.
• W2087942844 citedByCount "28" @default.
• W2087942844 countsByYear W20879428442013 @default.
• W2087942844 countsByYear W20879428442014 @default.
• W2087942844 countsByYear W20879428442018 @default.
• W2087942844 crossrefType "journal-article" @default.
• W2087942844 hasAuthorship W2087942844A5055386727 @default.
• W2087942844 hasAuthorship W2087942844A5060042575 @default.
• W2087942844 hasAuthorship W2087942844A5064906611 @default.
• W2087942844 hasAuthorship W2087942844A5065165497 @default.
• W2087942844 hasConcept C121332964 @default.
• W2087942844 hasConcept C129312508 @default.
• W2087942844 hasConcept C148898269 @default.
• W2087942844 hasConcept C153911025 @default.
• W2087942844 hasConcept C185592680 @default.
• W2087942844 hasConcept C552990157 @default.
• W2087942844 hasConcept C55493867 @default.
• W2087942844 hasConcept C62520636 @default.
• W2087942844 hasConcept C71240020 @default.
• W2087942844 hasConcept C8010536 @default.
• W2087942844 hasConcept C86803240 @default.
• W2087942844 hasConceptScore W2087942844C121332964 @default.
• W2087942844 hasConceptScore W2087942844C129312508 @default.
• W2087942844 hasConceptScore W2087942844C148898269 @default.
• W2087942844 hasConceptScore W2087942844C153911025 @default.
• W2087942844 hasConceptScore W2087942844C185592680 @default.
• W2087942844 hasConceptScore W2087942844C552990157 @default.
• W2087942844 hasConceptScore W2087942844C55493867 @default.
• W2087942844 hasConceptScore W2087942844C62520636 @default.
• W2087942844 hasConceptScore W2087942844C71240020 @default.
• W2087942844 hasConceptScore W2087942844C8010536 @default.
• W2087942844 hasConceptScore W2087942844C86803240 @default.
• W2087942844 hasIssue "50" @default.
• W2087942844 hasLocation W20879428441 @default.
• W2087942844 hasLocation W20879428442 @default.
• W2087942844 hasOpenAccess W2087942844 @default.
• W2087942844 hasPrimaryLocation W20879428441 @default.
• W2087942844 hasRelatedWork W1925816059 @default.
• W2087942844 hasRelatedWork W1965478202 @default.
• W2087942844 hasRelatedWork W1992151770 @default.
• W2087942844 hasRelatedWork W2033358700 @default.
• W2087942844 hasRelatedWork W2052472050 @default.
• W2087942844 hasRelatedWork W2081150133 @default.
• W2087942844 hasRelatedWork W2094761008 @default.
• W2087942844 hasRelatedWork W2117613982 @default.
• W2087942844 hasRelatedWork W2332742217 @default.
• W2087942844 hasRelatedWork W2951855440 @default.
• W2087942844 hasVolume "35" @default.
• W2087942844 isParatext "false" @default.
• W2087942844 isRetracted "false" @default.
• W2087942844 magId "2087942844" @default.
• W2087942844 workType "article" @default.