FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2088087993> ?p ?o ?g. }

• W2088087993 endingPage "2697" @default.
• W2088087993 startingPage "2693" @default.
• W2088087993 abstract "Stat4 activation is involved in differentiation of type 1 helper (Th1) T cells. Although Stat4 is activated by interleukin (IL)-12 in both human and murine T cells, Stat4 is activated by interferon (IFN)-α only in human, but not murine, CD4+ T cells. This species-specific difference in cytokine activation of Stat4 underlies critical differences in Th1 development in response to cytokines and is important to the interpretation of murine models of immunopathogenesis. Here, we sought to determine the mechanism of Stat4 recruitment and activation by the human IFN-α receptor. Analysis of phosphopeptide binding analysis suggests that Stat4 does not interact directly with tyrosine-phosphorylated amino acid residues within the cytoplasmic domains of either of the subunits of the IFN-α receptor complex. Expression of murine Stat4 in the Stat1-deficient U3A and the Stat2-deficient U6A cell lines shows that IFN-α-induced Stat4 phosphorylation requires the presence of activated Stat2 but not Stat1. Thus, in contrast to the direct recruitment of Stat4 by the IL-12 receptor, Stat4 activation by the human IFN-α receptor occurs through indirect recruitment by intermediates involving Stat2. Stat4 activation is involved in differentiation of type 1 helper (Th1) T cells. Although Stat4 is activated by interleukin (IL)-12 in both human and murine T cells, Stat4 is activated by interferon (IFN)-α only in human, but not murine, CD4+ T cells. This species-specific difference in cytokine activation of Stat4 underlies critical differences in Th1 development in response to cytokines and is important to the interpretation of murine models of immunopathogenesis. Here, we sought to determine the mechanism of Stat4 recruitment and activation by the human IFN-α receptor. Analysis of phosphopeptide binding analysis suggests that Stat4 does not interact directly with tyrosine-phosphorylated amino acid residues within the cytoplasmic domains of either of the subunits of the IFN-α receptor complex. Expression of murine Stat4 in the Stat1-deficient U3A and the Stat2-deficient U6A cell lines shows that IFN-α-induced Stat4 phosphorylation requires the presence of activated Stat2 but not Stat1. Thus, in contrast to the direct recruitment of Stat4 by the IL-12 receptor, Stat4 activation by the human IFN-α receptor occurs through indirect recruitment by intermediates involving Stat2. interferon type 1 helper cells interleukin IL-12 receptor phytohemagglutinin green fluorescence protein murine (e.g. mIFN) human (e.g. hIFN) fluorescence-activated cell sorter electrophoretic mobility shift assay Src homology 2 signal transducers and activators of transcription IFN1-γ production by CD4+ Th1 cells underlies host resistance to many intracellular pathogens (1.Bach E.A. Aguet M. Schreiber R.D. Annu. Rev. Immunol. 1997; 15: 563-591Crossref PubMed Scopus (871) Google Scholar). The development of Th1 cells was recently shown to involve IL-12 signaling and activation of the transcription factor Stat4 in activated T cells (2.Jacobson N.G. Szabo S.J. Weber-Nordt R.M. Zhong Z. Schreiber R.D. Darnell J.E. Murphy K.M. J. Exp. Med. 1995; 181: 1755-1762Crossref PubMed Scopus (582) Google Scholar, 3.Bacon C.M. Petricoin III E.F. Ortaldo J.R. Rees R.C. Larner A.C. Johnston J.A. O'Shea J.J. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 7307-7311Crossref PubMed Scopus (368) Google Scholar, 4.Kaplan M.H. Sun Y.-L. Hoey T. Grusby M.J. Nature. 1996; 382: 174-177Crossref PubMed Scopus (1055) Google Scholar, 5.Thierfelder W.E. van Deursen J.M. Yamamoto K. Tripp R.A. Sarawar S.R. Carson R.T. Sangster M.Y. Vignali D.A. Doherty P.C. Grosveld G.C. Ihle J.N. Nature. 1996; 382: 171-174Crossref PubMed Scopus (948) Google Scholar). In the human system, type I IFNs can also promote Th1 development (6.Parronchi P. De Carli M. Manetti R. Simonelli C. Sampognaro S. Piccinni M.-P. Macchia D. Maggi E. Del Prete G. Romangnani S. J. Immunol. 1992; 149: 2977-2983PubMed Google Scholar, 7.Brinkmann V. Geiger T. Alkan S. Heusser C.H. J. Exp. Med. 1993; 178: 1655-1663Crossref PubMed Scopus (438) Google Scholar), whereas in the murine system, IFN-α/β do not induce Th1 development either directly or indirectly (8.Wenner C.A. Güler M.L. Macatonia S.E. O'Garra A. Murphy K.M. J. Immunol. 1996; 156: 1442-1447PubMed Google Scholar). In murine CD4+ T cells, IL-12 is unique among the known cytokines in activating Stat4 in directing Th1 development. In contrast, in human CD4+ T cells, both IL-12 and IFN-α can activate Stat4 and induce IFN-γ production characteristic of Th1 cells (9.Cho S. Bacon C.M. Sudarshan C. Rees R.C. Finbloom D. Pine R. O'Shea J.J. J. Immunol. 1996; 157: 4781-4789PubMed Google Scholar, 10.Rogge L. D'Ambrosio D. Biffi M. Penna G. Minetti L.J. Presky D.H. Adorini L. Sinigaglia F. J. Immunol. 1998; 161: 6567-6574PubMed Google Scholar). Thus, a key difference between the human and mouse is that IFN-α/β activates Stat4 in human but not mouse T cells (2.Jacobson N.G. Szabo S.J. Weber-Nordt R.M. Zhong Z. Schreiber R.D. Darnell J.E. Murphy K.M. J. Exp. Med. 1995; 181: 1755-1762Crossref PubMed Scopus (582) Google Scholar, 9.Cho S. Bacon C.M. Sudarshan C. Rees R.C. Finbloom D. Pine R. O'Shea J.J. J. Immunol. 1996; 157: 4781-4789PubMed Google Scholar, 10.Rogge L. D'Ambrosio D. Biffi M. Penna G. Minetti L.J. Presky D.H. Adorini L. Sinigaglia F. J. Immunol. 1998; 161: 6567-6574PubMed Google Scholar, 11.Bacon C.M. McVicar D.W. Ortaldo J.R. Rees R.C. O'Shea J.J. Johnston J.A. J. Exp. Med. 1995; 181: 399-404Crossref PubMed Scopus (292) Google Scholar), with important implications for directing Th1 development between these two species. Given the extensive use of murine models in analyzing the roles of cytokines in pathogen resistance, it is important to understand the basis for any significant difference between murine and human cells that significantly influence cytokine actions. The IFN-α/β receptor consists of two subunits, IFNAR1 (12.Uze G. Lutfalla G. Gresser I. Cell. 1990; 60: 225-234Abstract Full Text PDF PubMed Scopus (510) Google Scholar, 13.Cook J.R. Cleary C.M. Mariano T.M. Izotova L. Pestka S. Journal of Biological Chemistry. 1996; 271: 13448-13453Abstract Full Text Full Text PDF PubMed Scopus (56) Google Scholar) and IFNAR2 (14.Novick D. Cohen B. Rubinstein M. Cell. 1994; 77: 391-400Abstract Full Text PDF PubMed Scopus (582) Google Scholar, 15.Soh J. Mariano T.M. Lim J.K. Izotova L. Mirochnitchenko O. Schwartz B. Langer J.A. Pestka S. Journal of Biological Chemistry. 1994; 269: 18102-18110Abstract Full Text PDF PubMed Google Scholar, 16.Colamonici O.R. Domanski P. J. Biol. Chem. 1993; 268: 10895-10899Abstract Full Text PDF PubMed Google Scholar), and uses the Janus kinases, Jak1 and Tyk2, with subsequent phosphorylation of Stat1, Stat2, and Stat3 (reviewed in Ref.17.Stark G.R. Kerr I.M. Williams B.R. Silverman R.H. Schreiber R.D. Annu. Rev. Biochem. 1998; 67: 227-264Crossref PubMed Scopus (3375) Google Scholar). In addition, the human IFN-α receptor was recently shown to recruit and activate Stat4 (10.Rogge L. D'Ambrosio D. Biffi M. Penna G. Minetti L.J. Presky D.H. Adorini L. Sinigaglia F. J. Immunol. 1998; 161: 6567-6574PubMed Google Scholar). Although the role for Stat4 in human Th1 development has not been formally demonstrated, Stat4 plays a critical role in murine Th1 development (4.Kaplan M.H. Sun Y.-L. Hoey T. Grusby M.J. Nature. 1996; 382: 174-177Crossref PubMed Scopus (1055) Google Scholar, 5.Thierfelder W.E. van Deursen J.M. Yamamoto K. Tripp R.A. Sarawar S.R. Carson R.T. Sangster M.Y. Vignali D.A. Doherty P.C. Grosveld G.C. Ihle J.N. Nature. 1996; 382: 171-174Crossref PubMed Scopus (948) Google Scholar). It therefore seems likely that the ability of IFN-α to activate Stat4 in human but not mouse cells explains its ability to induce Th1 development in human but not mouse T cells. In the present study, we wished to define the mechanism of Stat4 recruitment in human IFN-α signaling as a starting point to understand the basis of the species-specific difference in Th1 development. In this report, we demonstrate an important difference between Stat4 activation by the IL-12 and IFN-α signaling pathways. In IL-12 signaling, Stat4 is recruited directly to the receptor complex by the cytoplasmic domain of the IL-12R β2 subunit (18.Naeger L.K. McKinney J. Salvekar A. Hoey T. J. Biol. Chem. 1999; 274: 1875-1878Abstract Full Text Full Text PDF PubMed Scopus (59) Google Scholar). In contrast, in IFN-α signaling, Stat4 is not recruited directly to the receptor but appears to be indirectly recruited through an intermediate involving activated Stat2. Recombinant murine and human IL-12 and human IFN-α A/D were kind gifts from Dr. U. Gubler (Hoffmann-LaRoche). Recombinant murine IFN-α A was purchased fromBIOSOURCE (Camarillo, CA). Polyclonal antisera specific for both murine and human Stat1, Stat2, Stat3, and Stat4 were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). The anti-Stat4 monoclonal antibody, NB34, has been described previously (19.Güler M.L. Jacobson N.G. Gubler U. Murphy K.M. J. Immunol. 1997; 159: 1767-1774PubMed Google Scholar). The peroxidase-conjugated anti-phosphotyrosine antibody RC20 was purchased from Transduction Laboratories (Lexington, KY). The chicken ovalbumin peptide 323–339 (20.Murphy K.M. Heimberger A.B. Loh D.Y. Science. 1990; 250: 1720-1723Crossref PubMed Scopus (1652) Google Scholar), phosphorylated and nonphosphorylated peptides of the human IFN-α/β R1 (14.Novick D. Cohen B. Rubinstein M. Cell. 1994; 77: 391-400Abstract Full Text PDF PubMed Scopus (582) Google Scholar) and R2 (21.Cohen B. Novick D. Barak S. Rubinstein M. Mol. Cell. Biol. 1995; 15: 4208-4214Crossref PubMed Scopus (149) Google Scholar), and the human Stat4-Y694 were synthesized on an Applied Biosystems' peptide synthesizer, model 430 (Foster City, CA). The peptide sequences for the cytoplasmic domains of the IFN-α/β receptors are as follows: IFNAR1 subunit: Tyr466, RCINYVFFY(PO4)SLKPSS; Tyr481, SIDEY(PO4)FSEQPLKNLL; Tyr527, DEDHKKY(PO4)SSQTSQDSGN; and Tyr538, DSGNY(PO4)SNEDESESKSEEL; IFNAR2 subunit: Tyr269, KWIGY(PO4)ICLRNSLPKVL; Tyr306, MVEVIY(PO4)INRKKKVWD; Tyr316/318, KVWDY(PO4)NY(PO4)DDESDSDT; Tyr337, SGGGY(PO4)TMHGLTVRPL; Tyr411, PEEDY(PO4)SSTEGSGGRIT; and Tyr512, TSESDVDLGDGY(PO4)IMR. The peptide sequences for the control peptides were: hIFN-γR-Y-P-440, TSFGY(PO4)DKPHVLV; and hStat4-Y-P-696, GDKGY(PO4)VPSVFIP. The control peptide from the IL-12R β2 cytoplasmic tail was DLPTHDGY(PO4)LPSNIDD. All peptides were purified by reverse phase C18-HPLC, and their purity and molecular weights were determined by mass spectrometry. Synthetic peptides used in this study were determined to be >85% pure and of the correct molecular weight for each species. The DO11.10 Th1 clone, 3F6, was maintained by weekly stimulation with irradiated BALB/c spleen cells pulsed with the ovalbumin peptide as described previously (22.Hsieh C.-S. Heimberger A.B. Gold J.S. O'Garra A. Murphy K.M. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 6065-6069Crossref PubMed Scopus (727) Google Scholar). The human Kit225 cell line was maintained in complete RPMI 1640 supplemented with 1000 units/ml IL-2 as described (23.Beadling C. Guschin D. Witthuhn B.A. Ziemiecki A. Ihle J.N. Kerr I.M. Cantrell D. EMBO J. 1994; 13: 5605-5615Crossref PubMed Scopus (194) Google Scholar). Human peripheral blood mononuclear cells were purified by Ficoll-Hypaque (Sigma) and stimulated for 3 days in complete RPMI 1640 medium containing 5 μg/ml phytohemagglutinin antigen (PHA, Sigma) and 40 units/ml IL-2. The PHA-blasts were split on day 3 in complete RPMI containing 40 units/ml IL-2 and rested to day 7. The parental 2fTGH, the Stat2-deficient U6A, and the Stat1-deficient U3A cell lines were maintained in complete Dulbecco's modified Eagle's medium as described previously (24.McKendry R. John J. Flavell R.A. Kerr I.M. Stark G.R. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 11455-11459Crossref PubMed Scopus (229) Google Scholar). The Stat2-complemented U6A (U6R) was maintained in complete Dulbecco's modified Eagle's medium containing 400 μg/ml Geneticin (G418, Life Technologies, Inc.). The retroviral vector used in this study is a derivative of the murine stem cell virus MSCV2.2 and contains an internal ribosomal entry site and the coding region for green fluorescence protein (GFP) downstream of a uniqueXhoI cloning site (described in Refs. 25.Ranganath S. Ouyang W. Bhattacharya D. Sha W.C. Grupe A. Peltz G. Murphy K.M. J. Immunol. 1998; 161: 3822-3826PubMed Google Scholar and 26.Ouyang W. Ranganath S.H. Weindel K. Bhattacharya D. Murphy T.L. Sha W.C. Murphy K.M. Immunity. 1998; 9: 745-755Abstract Full Text Full Text PDF PubMed Scopus (667) Google Scholar). The complete coding region of mStat4 and hStat2 was cloned into theXhoI site of the GFPRV vector. The Phoenix-Ampho packaging cell line was transfected with the retroviral vectors described above by calcium phosphate precipitation (26.Ouyang W. Ranganath S.H. Weindel K. Bhattacharya D. Murphy T.L. Sha W.C. Murphy K.M. Immunity. 1998; 9: 745-755Abstract Full Text Full Text PDF PubMed Scopus (667) Google Scholar). 24 h after transfection, the medium was replaced, and the retroviral supernatant was generated by culturing the cells at 32 °C for 24 h. The 2fTGH, U3A, and U6A cell lines were infected by overnight culture in retroviral culture supernatant containing 4 μg/ml polybrene (1,5-dimethyl-1,5-diazaundecamethylene polymethobromide, Sigma). Transduced cells were purified by FACS sorting for GFP expression. Sorted cells were expanded in culture for 1 week and were then determined to be >90% pure and to stably express the retroviral marker protein by post-sort analysis. Analysis of phosphotyrosine-containing Stat proteins was performed as described previously (2.Jacobson N.G. Szabo S.J. Weber-Nordt R.M. Zhong Z. Schreiber R.D. Darnell J.E. Murphy K.M. J. Exp. Med. 1995; 181: 1755-1762Crossref PubMed Scopus (582) Google Scholar). Briefly, 5 × 107 cells were incubated with the indicated cytokines for 30 min at 37 °C. Whole-cell lysates were prepared, and STAT molecules were precipitated with specific polyclonal antibodies and protein G-Sepharose (Amersham Pharmacia Biotech). Immunoprecipitates were resolved by denaturing SDS-polyacrylamide gel electrophoresis and were transferred to nitrocellulose. Phosphotyrosine-containing proteins were detected by blotting with the peroxidase-conjugated RC20 antibody followed by enhanced chemiluminescence with ECL (Amersham Pharmacia Biotech). The membranes were then stripped and re-probed with anti-Stat polyclonal antibodies followed by detection with peroxidase-conjugated Gt-anti-Rb Ig (Jackson ImmunoResearch, West Grove, PA). Nuclear extracts were prepared from cytokine-treated cells as described previously (2.Jacobson N.G. Szabo S.J. Weber-Nordt R.M. Zhong Z. Schreiber R.D. Darnell J.E. Murphy K.M. J. Exp. Med. 1995; 181: 1755-1762Crossref PubMed Scopus (582) Google Scholar). Binding reactions consisted of 3 μg of nuclear extract, 1 μg of poly(dI·dC) (Amersham Pharmacia Biotech), 10 mm Tris-Cl (pH 7.5), 50 mm NaCl, 1 mm dithiothreitol, 1 mm EDTA, 5% (v/v) glycerol, and 1 × 105cpm Klenow-labeled probe in 20-μl reaction volumes. Reactions were incubated at room temperature for 30 min. Supershifting polyclonal antibodies were added to some samples (2 μg) and incubated for an additional 30 min at room temperature. DNA-binding complexes were resolved by nondenaturing 4.5% polyacrylamide gel electrophoresis for 2 h at 150 V followed by autoradiography. The DNA probes used in this study were as follows: M67 SIE, GTCGACATTTCCCGTAAATCGTCGA; FcγRI, TCGACGCATGTTTCAAGGATTTGAGATGTATTTCCCAGAAAAGGCTCGA; Eα-Y Box, TCGACATTTTTCTGATTGGTTAAAAGTC. For peptide competition studies, nuclear extracts were first denatured with the addition of 200 mm guanidinium HCl for 2 min at room temperature prior to their addition to the DNA binding reaction mixtures as described previously (27.Yan H. Krishnan K. Greenlund A.C. Gupta S. Lim J.T.E. Schreiber R.D. Schindler C.W. Krolewski J.J. EMBO J. 1996; 15: 1064-1074Crossref PubMed Scopus (160) Google Scholar). These binding reactions included purified phosphorylated or nonphosphorylated peptides, as indicated in the text, at concentrations ranging from 20 to 100 μm. First, to confirm the reported differences in Stat4 activation by IFN-α between mouse and human, we compared the murine Th1 clone 3F6 and human Th1 cells derived by PHA activationin vitro as described under “Materials and Methods.” For IL-12 signaling, murine or human Th1 cells were treated with recombinant murine or human IL-12, respectively. For IFN-α signaling, murine and human Th1 cells were treated with hIFN-A/D, which activates both murine and human IFN-α receptors. IL-12 induced the tyrosine phosphorylation of Stat4 in both murine and human T cells (Fig.1 A, lanes 2 and5). IL-12 also induced tyrosine phosphorylation of Stat3 in both species, although more strongly in human compared with murine cells (Fig. 1 A). In contrast, IFN-α induced tyrosine phosphorylation Stat4 and Stat3 only in human T cells but not in murine T cells (Fig. 1 A, lanes 3 and 6). In addition, IFN-α induced Stat4 DNA binding activity in human (Fig.1 B, lower panel, lanes 6 and9), but not mouse, Th1 cells (Fig. 1 B, upper panel, lanes 6–9). The lack of Stat4 activation by IFN-α in murine T cells was not due to inactivity of the hIFN-α (A/D) at murine hIFN-α receptors, because hIFN-α (A/D) strongly induced Stat1 DNA binding in murine Th1 cells (Fig. 1 B, upper panel, lanes 6–9). Furthermore, DNA-binding complexes induced by mIFN-α (A) were similar to hIFN-α (A/D) (not shown). These results confirm the report of Rogge et al. (10.Rogge L. D'Ambrosio D. Biffi M. Penna G. Minetti L.J. Presky D.H. Adorini L. Sinigaglia F. J. Immunol. 1998; 161: 6567-6574PubMed Google Scholar) that IFN-α signaling activates Stat4 in human and not murine T cells. However, that recent report did not address the mechanism underlying this difference. Differential Stat4 activation could be caused by sequence variations in the IFN-α receptor subunits, particularly phosphotyrosine residues within the cytoplasmic domains that may act as binding sites for Stat4. Indeed, amino acid sequences of the IFNAR1 and IFNAR2 subunits are not well conserved between mouse and human (28.Kim S.H. Cohen B. Novick D. Rubinstein M. Gene. 1997; 196: 279-286Crossref PubMed Scopus (50) Google Scholar, 29.Owczarek C.M. Hwang S.Y. Holland K.A. Gulluyam L.M. Tavaria M. Weaver B. Reich N.C. Kola I. Hertzog P.J. J. Biol. Chem. 1997; 272: 23865-23870Abstract Full Text Full Text PDF PubMed Scopus (51) Google Scholar). Therefore, we examined the ability of specific phosphotyrosine-containing peptides from the IFNAR1 and IFNAR2 subunits to interact with STAT complexes by EMSA (Fig. 2). Tyrosine residues within the cytoplasmic domains of the IFNAR1 (Tyr466, Tyr481, Tyr527, and Tyr538) and IFNAR2 (Tyr269, Tyr306, Tyr316, Tyr318, Tyr337, Tyr411, and Tyr512) receptor subunits could serve as recruitment sites for Stat4. Phosphopeptides corresponding to amino acids surrounding each of the potential tyrosines were tested for their abilities to disrupt Stat4 DNA binding activity as a measure of sequence-specific binding (27.Yan H. Krishnan K. Greenlund A.C. Gupta S. Lim J.T.E. Schreiber R.D. Schindler C.W. Krolewski J.J. EMBO J. 1996; 15: 1064-1074Crossref PubMed Scopus (160) Google Scholar). As controls, we used phosphotyrosine- and a nonphosphotyrosine-containing peptide consisting of the Stat4 recruitment site from the cytoplasmic domain of the human IL-12R β2 subunit (18.Naeger L.K. McKinney J. Salvekar A. Hoey T. J. Biol. Chem. 1999; 274: 1875-1878Abstract Full Text Full Text PDF PubMed Scopus (59) Google Scholar) (IL-12Rβ2-T-P-800) as a positive control for Stat4 DNA binding activity and a peptide from the Stat1 recruitment site of the IFN-γ receptor, IFNγR-Y-440 (positive control for Stat1 DNA binding activity) (30.Greenlund A.C. Farrar M.A. Viviano B.L. Schreiber R.D. EMBO J. 1994; 7: 1591-1600Crossref Scopus (376) Google Scholar). Nuclear extracts were prepared from hIFN-α (A/D)-treated human Kit225 cells as a source of Stat1 and Stat4 DNA-binding complexes. First, the specificity of these complexes was confirmed by using anti-Stat1 and anti-Stat4 antibodies in supershift assays (Fig. 2, first and second panels). Next, we demonstrated that the hStat4 SH2-dependent phosphopeptide hStat4-Y-P-694 and the IFN-γ receptor phosphopeptide IFNγR-Y-P-440 potently inhibited Stat4 and Stat1 complexes, respectively, in EMSA (Fig. 2, first and second panels). These data are consistent with the ability of these phosphopeptide sequences to interact with the SH2 domains of Stat4 and Stat1. This inhibition was specific, because the nonphosphorylated versions of these peptides did not block STAT binding in the EMSA. Next, we asked whether phosphotyrosine peptides from either the IFNAR1 or the IFNAR2 could inhibit Stat1 or Stat4 binding activity by EMSA (Fig. 2, third and fourth panels). All of the phosphopeptides from the IFNAR1 (Tyr466, Tyr481, Tyr527, and Tyr538) and IFNAR2 (Tyr269, Tyr306, Tyr316, Tyr318, Tyr337, Tyr411, and Tyr512) were tested in this EMSA binding assay. Fig. 2shows two representative experiments from the analysis of phosphopeptides from the IFNAR1 (third panel) and the IFNAR2 (fourth panel). Surprisingly, none of the phosphotyrosine-containing peptides from either the IFNAR1 (Tyr466, Tyr481, Tyr538 (Fig. 2,third panel), and Tyr527 (data not shown)) or IFNAR2 (Tyr306, Tyr316 (Fig. 2, fourth panel) and Tyr269, Tyr318, Tyr337, Tyr411, and Tyr512 (data not shown)) subunits inhibited Stat4 complex formation. Interestingly, a phospohopeptide containing tyrosine 306 of IFNRA2 (IFN-αR2-Y-P306) potently inhibited Stat1 binding (Fig. 2, fourth panel). This inhibition was specific, because IFN-αR2-Y-P306 did not inhibit Stat4 binding. In summary, whereas phosphotyrosine peptide sequences expected to interact with Stat1 did selectively inhibit Stat1 binding in EMSA, none of the phosphotyrosine-containing peptide sequences from either the IFNAR1 or IFNAR2 receptor chain subunits showed significant interaction with Stat4. These results indicate that Stat4 either does not interact with, or interacts only very weakly with, any of the phosphotyrosine-containing regions in the cytoplasmic domain of IFNRA1 and IFNAR2. This finding suggests that, potentially, Stat4 may not be recruited by direct receptor interactions but rather indirectly via an intermediate adapter molecule. Previous studies showed that Stat2 acts as a docking site for the recruitment of Stat1 in IFN-α receptor signaling (31.Leung S. Qureshi S.A. Kerr I.M. Darnell J.E. Stark G.R. Mol. Cell. Biol. 1995; 15: 1312-1317Crossref PubMed Google Scholar). During IFN-α signaling, Stat2 is first recruited to specific residues from the cytoplasmic domain of the IFNAR1 receptor subunit (27.Yan H. Krishnan K. Greenlund A.C. Gupta S. Lim J.T.E. Schreiber R.D. Schindler C.W. Krolewski J.J. EMBO J. 1996; 15: 1064-1074Crossref PubMed Scopus (160) Google Scholar, 32.Li X. Leung S. Kerr I.M. Stark G.R. Mol. Cell. Biol. 1997; 17: 2048-2056Crossref PubMed Scopus (164) Google Scholar). Stat2 next becomes phosphorylated on tyrosine 690 (33.Improta T. Schindler C. Horvath C.M. Kerr I.M. Stark G.R. Darnell J.E. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 4776-4780Crossref PubMed Scopus (128) Google Scholar), and the surrounding region (YLKHR) serves as a docking site for the SH2-dependent recruitment of Stat1 (31.Leung S. Qureshi S.A. Kerr I.M. Darnell J.E. Stark G.R. Mol. Cell. Biol. 1995; 15: 1312-1317Crossref PubMed Google Scholar, 34.Qureshi S.A. Leung S. Kerr I.M. Stark G.R. Darnell J.E. Mol. Cell. Biol. 1996; 16: 288-293Crossref PubMed Scopus (148) Google Scholar). Stat1 docking presumably allows for its subsequent phosphorylation by receptor-associated kinases. Based on these observations, we wondered whether Stat4 might be recruited to the receptor complex by a similar STAT-dependent mechanism. To determine whether Stat4 activation proceeds by a similar Stat2-dependent mechanism, we used cells deficient in specific components of IFN-α signaling to determine which component may be responsible for Stat4 recruitment. The U6A cell line, derived from the parental line 2fTGH, has an uncharacterized mutation of Stat2 causing a defect in Stat2 protein expression (24.McKendry R. John J. Flavell R.A. Kerr I.M. Stark G.R. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 11455-11459Crossref PubMed Scopus (229) Google Scholar, 31.Leung S. Qureshi S.A. Kerr I.M. Darnell J.E. Stark G.R. Mol. Cell. Biol. 1995; 15: 1312-1317Crossref PubMed Google Scholar, 34.Qureshi S.A. Leung S. Kerr I.M. Stark G.R. Darnell J.E. Mol. Cell. Biol. 1996; 16: 288-293Crossref PubMed Scopus (148) Google Scholar). The U6A mutation prevents IFN-α-induced phosphorylation of Stat2 and also prevents IFN-α-induced phosphorylation of Stat1 and Stat3 (Fig.3). The U6R cell line is derived from U6A by stable transfection with a Stat2 expression plasmid. Direct use of U6A for analysis of Stat4 activation is not possible because these cells do not express Stat4 (Fig. 3, bottom panel). To analyze Stat4 phosphorylation in these cells, we stably expressed Stat4 in 2fTGH, U6A, and U6R cells by retrovirus (Fig.4). In parental line 2fTGH, IFN-α induced tyrosine phosphorylation of Stat1 with or without introduction of murine Stat4 (Fig. 4 A, lanes 2 and4). Also, IFN-α induced tyrosine phosphorylation of Stat4 in Stat4-expressing 2fTGH cells (Fig. 4 A, lane 4) but not in non-Stat4-expressing cells (lane 2). This result demonstrates that murine Stat4 can be recruited and activated by the human IFN-α signaling complex, similar to human Stat4. In the U6A cells, which lack Stat2, IFN-α failed to induce Stat1 phosphorylation (Fig. 4 A, lanes 5 and 6). Introduction of murine Stat4 did not affect IFN-α activation of Stat1 nor did Stat4 become phosphorylated in response to IFN-α in the absence of Stat2 (Fig. 4 A). In contrast, in the Stat2-reconstituted U6R cell line, IFN-α did induce Stat1 and Stat4 tyrosine phosphorylation (Fig. 4 A, lane 10). This result suggests that Stat2 participates in the recruitment of both Stat1 and Stat4 to the IFN-α signaling complex. Moreover, Stat2-dependent tyrosine phosphorylation of Stat4 was correlated with activation and phosphorylation of Stat2 in response to IFN-α (Fig.4 B). Because Stat1 recruitment to the IFN-α receptor is dependent on Stat2 activation, we wondered whether Stat1, in addition to Stat2, was required for Stat4 activation by hIFN-α. As shown in Fig.4 B, IFN-α induced tyrosine phosphorylation of Stat4 in both the 2fTGH control and in the Stat1-deficient U3A cell line (Fig.4 B, lanes 2 and 4). In contrast, tyrosine phosphorylation of Stat1 was seen only in the parental line as expected (Fig. 4 B, lane 2). Thus, these data demonstrate that the activation of Stat4 by the hIFN-α receptor requires the activation of Stat2 but not Stat1. Several possible mechanisms could account for the differential species-specific activation of Stat4 by type I interferons. First, we examined the possibility that Stat4 was activated by direct receptor recruitment to specific phosphorylated tyrosine residue within the cytoplasmic domains of either the IFNAR1 or IFNAR2 subunits. Stat4 was recently shown to bind to a phosphorylated tyrosine-containing sequence, YLPSNID, at Tyr800 in the cytoplasmic domain of the IL-12R β2 (18.Naeger L.K. McKinney J. Salvekar A. Hoey T. J. Biol. Chem. 1999; 274: 1875-1878Abstract Full Text Full Text PDF PubMed Scopus (59) Google Scholar). This sequence is conserved between the murine and human IL-12R β2 (35.Presky D.H. Yang H. Minetti L.J. Chua A.O. Nabavi N. Wu C.-Y. Gately M.K. Gubler U. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 14002-14007Crossref PubMed Scopus (581) Google Scholar). However, there is no conservation of any similar sequence within the cytoplasmic domains of either the IFNAR1 or IFNAR2. Further, peptide competition analysis presented here showed that Stat4 does not significantly interact with any of the tyrosine-phosphorylated sequences derived from either the IFNAR1 or IFNAR2 subunit (Fig. 2). Thus, although the cytoplasmic domains of IFNAR1 and IFNAR2 are not well conserved between human and mouse, these differences do not explain the difference in Stat4 activation by the IFN-α receptor. In looking further, we found that Stat4 was activated by IFN-α in a Stat2-dependent manner, similar to the Stat2-dependent activation of Stat1. Thus differences between human and mouse Stat2 could provide a basis for differential Stat4 recruitment between human and mouse. This hypothesis predicts that any receptor that activates Stat2 would also recruit and activate Stat4. However, until recently, Stat2 was known to be activated only by the IFN-α/β pathway, restricting a general test of this hypothesis. A recent report has shown that the urokinase receptor, expressed by human vascular smooth muscle cells, also activates Stat2, and that indeed Stat4 is also activated in response to urokinase signaling (36.Dumler I. Kopmann A. Wagner K. Mayboroda O.A. Jerke U. Dietz R. Haller H. Gulba D.C. J. Biol. Chem. 1999; 274: 24059-24065Abstract Full Text Full Text PDF PubMed Scopus (39) Google Scholar). This observation supports the idea that human Stat2 is involved in Stat4 recruitment and activation. Although the human Stat2 sequence has been known for some time (37.Yan R. Qureshi S. Zhong Z. Wen Z. Darnell Jr., J.E. Nucleic Acids Res. 1995; 23: 459-463Crossref PubMed Scopus (58) Google Scholar), murine Stat2 was only recently cloned and sequenced (38.Paulson M. Pisharody S. Pan L. Guadagno S. Mui A. Levy D.E. J. Biol. Chem. 1999; 274: 25343-25349Abstract Full Text Full Text PDF PubMed Scopus (186) Google Scholar). Interestingly, the overall amino acid sequence identity of murine and human Stat2 was only 69%, with the greatest divergence at the carboxyl terminus, which showed only 29% sequence identity. By comparison, Stats1, 3, 4, 5α, and 6 all share >85% overall sequence identity when aligning the murine sequence to their human counterparts. Although the precise domain within Stat2 that may interact with Stat4 has not been identified, the sequence divergence between murine and human Stat2 suggests a potential explanation for the functional difference in Stat4 activation. We thank Dr. George Stark for the kind gift of cell lines, Dr. Bob Schreiber for helpful discussions, and Steve Horvath for assistance with phosphopeptide synthesis. We thank Tim Hoey for the kind gift of IL-12R peptides." @default.
• W2088087993 created "2016-06-24" @default.
• W2088087993 creator A5001332423 @default.
• W2088087993 creator A5040420168 @default.
• W2088087993 creator A5070145253 @default.
• W2088087993 creator A5091028634 @default.
• W2088087993 date "2000-01-01" @default.
• W2088087993 modified "2023-10-13" @default.
• W2088087993 title "Recruitment of Stat4 to the Human Interferon-α/β Receptor Requires Activated Stat2" @default.
• W2088087993 cites W131140191 @default.
• W2088087993 cites W135486017 @default.
• W2088087993 cites W1497205974 @default.
• W2088087993 cites W1515848954 @default.
• W2088087993 cites W1535156928 @default.
• W2088087993 cites W1604795805 @default.
• W2088087993 cites W1607019337 @default.
• W2088087993 cites W1669690603 @default.
• W2088087993 cites W1747682552 @default.
• W2088087993 cites W1830966545 @default.
• W2088087993 cites W1894525365 @default.
• W2088087993 cites W1958363133 @default.
• W2088087993 cites W1971892123 @default.
• W2088087993 cites W1975588465 @default.
• W2088087993 cites W1986021037 @default.
• W2088087993 cites W2002726220 @default.
• W2088087993 cites W2012295450 @default.
• W2088087993 cites W2012628280 @default.
• W2088087993 cites W2020467454 @default.
• W2088087993 cites W2021702586 @default.
• W2088087993 cites W2038615458 @default.
• W2088087993 cites W2042511952 @default.
• W2088087993 cites W2044325609 @default.
• W2088087993 cites W2045008512 @default.
• W2088087993 cites W2051705414 @default.
• W2088087993 cites W2058593261 @default.
• W2088087993 cites W2070116310 @default.
• W2088087993 cites W2072482570 @default.
• W2088087993 cites W2088988430 @default.
• W2088087993 cites W2091272253 @default.
• W2088087993 cites W2103565638 @default.
• W2088087993 cites W2116641130 @default.
• W2088087993 cites W2135847617 @default.
• W2088087993 cites W2151712105 @default.
• W2088087993 cites W2153398168 @default.
• W2088087993 cites W2155991561 @default.
• W2088087993 cites W2165588484 @default.
• W2088087993 cites W4313331188 @default.
• W2088087993 doi "https://doi.org/10.1074/jbc.275.4.2693" @default.
• W2088087993 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/10644731" @default.
• W2088087993 hasPublicationYear "2000" @default.
• W2088087993 type Work @default.
• W2088087993 sameAs 2088087993 @default.
• W2088087993 citedByCount "101" @default.
• W2088087993 countsByYear W20880879932012 @default.
• W2088087993 countsByYear W20880879932013 @default.
• W2088087993 countsByYear W20880879932014 @default.
• W2088087993 countsByYear W20880879932015 @default.
• W2088087993 countsByYear W20880879932016 @default.
• W2088087993 countsByYear W20880879932017 @default.
• W2088087993 countsByYear W20880879932018 @default.
• W2088087993 countsByYear W20880879932019 @default.
• W2088087993 countsByYear W20880879932020 @default.
• W2088087993 countsByYear W20880879932021 @default.
• W2088087993 countsByYear W20880879932023 @default.
• W2088087993 crossrefType "journal-article" @default.
• W2088087993 hasAuthorship W2088087993A5001332423 @default.
• W2088087993 hasAuthorship W2088087993A5040420168 @default.
• W2088087993 hasAuthorship W2088087993A5070145253 @default.
• W2088087993 hasAuthorship W2088087993A5091028634 @default.
• W2088087993 hasBestOaLocation W20880879931 @default.
• W2088087993 hasConcept C153911025 @default.
• W2088087993 hasConcept C159047783 @default.
• W2088087993 hasConcept C170493617 @default.
• W2088087993 hasConcept C185592680 @default.
• W2088087993 hasConcept C2776178377 @default.
• W2088087993 hasConcept C2776239193 @default.
• W2088087993 hasConcept C2778277574 @default.
• W2088087993 hasConcept C2778923194 @default.
• W2088087993 hasConcept C54355233 @default.
• W2088087993 hasConcept C62478195 @default.
• W2088087993 hasConcept C65439459 @default.
• W2088087993 hasConcept C86803240 @default.
• W2088087993 hasConcept C95444343 @default.
• W2088087993 hasConceptScore W2088087993C153911025 @default.
• W2088087993 hasConceptScore W2088087993C159047783 @default.
• W2088087993 hasConceptScore W2088087993C170493617 @default.
• W2088087993 hasConceptScore W2088087993C185592680 @default.
• W2088087993 hasConceptScore W2088087993C2776178377 @default.
• W2088087993 hasConceptScore W2088087993C2776239193 @default.
• W2088087993 hasConceptScore W2088087993C2778277574 @default.
• W2088087993 hasConceptScore W2088087993C2778923194 @default.
• W2088087993 hasConceptScore W2088087993C54355233 @default.
• W2088087993 hasConceptScore W2088087993C62478195 @default.
• W2088087993 hasConceptScore W2088087993C65439459 @default.
• W2088087993 hasConceptScore W2088087993C86803240 @default.
• W2088087993 hasConceptScore W2088087993C95444343 @default.
• W2088087993 hasIssue "4" @default.
• W2088087993 hasLocation W20880879931 @default.

• next