FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2088938488> ?p ?o ?g. }

• W2088938488 endingPage "48920" @default.
• W2088938488 startingPage "48915" @default.
• W2088938488 abstract "Oxidation of methionine residues to methionine sulfoxide can lead to inactivation of proteins. Methionine sulfoxide reductase (MsrA) has been known for a long time, and its repairing function well characterized. Here we identify a new methionine sulfoxide reductase, which we referred to as MsrB, the gene of which is present in genomes of eubacteria, archaebacteria, and eucaryotes. ThemsrA and msrB genes exhibit no sequence similarity and, in some genomes, are fused. The Escherichia coli MsrB protein (currently predicted to be encoded by an open reading frame of unknown function named yeaA) was used for genetic, enzymatic, and mass spectrometric investigations. Our in vivo study revealed that msrB is required for cadmium resistance of E. coli, a carcinogenic compound that induces oxidative stress. Our in vitrostudies, showed that (i) MsrB and MsrA enzymes reduce free methionine sulfoxide with turn-over rates of 0.6 min−1 and 20 min−1, respectively, (ii) MsrA and MsrB act on oxidized calmodulin, each by repairing four to six of the eight methionine sulfoxide residues initially present, and (iii) simultaneous action of both MsrA and MsrB allowed full reduction of oxidized calmodulin. A possibility is that these two ubiquitous methionine sulfoxide reductases exhibit different substrate specificity. Oxidation of methionine residues to methionine sulfoxide can lead to inactivation of proteins. Methionine sulfoxide reductase (MsrA) has been known for a long time, and its repairing function well characterized. Here we identify a new methionine sulfoxide reductase, which we referred to as MsrB, the gene of which is present in genomes of eubacteria, archaebacteria, and eucaryotes. ThemsrA and msrB genes exhibit no sequence similarity and, in some genomes, are fused. The Escherichia coli MsrB protein (currently predicted to be encoded by an open reading frame of unknown function named yeaA) was used for genetic, enzymatic, and mass spectrometric investigations. Our in vivo study revealed that msrB is required for cadmium resistance of E. coli, a carcinogenic compound that induces oxidative stress. Our in vitrostudies, showed that (i) MsrB and MsrA enzymes reduce free methionine sulfoxide with turn-over rates of 0.6 min−1 and 20 min−1, respectively, (ii) MsrA and MsrB act on oxidized calmodulin, each by repairing four to six of the eight methionine sulfoxide residues initially present, and (iii) simultaneous action of both MsrA and MsrB allowed full reduction of oxidized calmodulin. A possibility is that these two ubiquitous methionine sulfoxide reductases exhibit different substrate specificity. active oxygen species methionine sulfoxide human immunodeficiency virus nucleotide(s) oxidized calmodulin Fourier Transform ion cyclotron resonance All organisms living aerobically are exposed to active oxygen species (AOS)1 produced during respiration. Most macromolecules are targeted by AOS. There is an increasing body of evidence that links oxidative stress to reduced survival rate and various pathological situations (1Stadtman E.R. Science. 1992; 257: 1220-1224Crossref PubMed Scopus (2374) Google Scholar). Therefore, a series of protecting systems helps cells to cope with the presence of AOS. A subset of these systems, including catalase, peroxidase, superoxide dismutase, acts by reducing endogenous levels of AOS. Another second subset includes enzymes to repair AOS damage; such “repairing” enzymes can rescue oxidized lipid, DNA, or proteins. Protein oxidation can lead to conformation changes and, in some cases, loss of function. Amino acids readily prone to AOS oxidation include cysteine, histidine, tryptophan, tyrosine, and methionine, this latter being the most sensitive (2Vogt W. Free Radic. Biol. Med. 1995; 18: 93-105Crossref PubMed Scopus (770) Google Scholar). Methionine oxidation to methionine sulfoxide (MetSO) is reversible. Reduction of MetSO is catalyzed by methionine sulfoxide reductase (MsrA), an enzyme present in all living organisms (3Brot N. Weissbach L. Werth J. Weissbach H. Proc. Natl. Acad. Sci. U. S. A. 1981; 78: 2155-2158Crossref PubMed Scopus (279) Google Scholar, 4Brot N. Weissbach H. Biopolymers. 2001; 55: 288-296Crossref Scopus (80) Google Scholar). MsrA has been known for a long time and has received increasing attention over the last years. Its three-dimensional structure has been described (5Lowther W.T. Brot N. Weissbach H. Matthews B.W. Biochemistry. 2000; 39: 13307-13312Crossref PubMed Scopus (120) Google Scholar, 6Tete-Favier F. Cobessi D. Boschi-Muller S. Azza S. Branlant G. Aubry A. Structure. 2000; 8: 1167-1178Abstract Full Text Full Text PDF PubMed Scopus (83) Google Scholar), and the basis of its catalytic mechanism determined (7Lowther W.T. Brot N. Weissbach H. Honek J.F. Matthews B.W. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 6463-6468Crossref PubMed Scopus (146) Google Scholar, 8Boschi-Muller S. Azza S. Sanglier-Cianferani S. Talfournier F. Van Dorsselear A. Branlant G. J. Biol. Chem. 2000; 275: 35908-35913Abstract Full Text Full Text PDF PubMed Scopus (159) Google Scholar). MsrA has been found to reduce both free MetSO as well as MetSO residues in proteins. A series of proteins, of considerable medical interest, has been identified as substrates of MsrA. These include calmodulin (9Sun H. Gao J. Ferrington D.A. Biesiada H. Williams T. Squier T.C. Biochemistry. 1999; 38: 105-112Crossref PubMed Scopus (147) Google Scholar), HIV protease (10Davis D.A. Newcomb F.M. Moskovitz J. Wingfield P.T. Stahl S.J. Kaufman J. Fales H.M. Levine R.L. Yarchoan R. Biochem. J. 2000; 346: 305-311Crossref PubMed Scopus (60) Google Scholar) or α1-proteinase-inhibitor (11Abrams W.R. Weinbaum G. Weissbach L. Weissbach H. Brot N. Proc. Natl. Acad. Sci. U. S. A. 1981; 78: 7483-7486Crossref PubMed Scopus (89) Google Scholar). In mammals, there is evidence for a connection between MsrA and Alzheimer's disease (12Gabbita S.P. Aksenov M.Y. Lovell M.A. Markesbery W.R. J. Neurochem. 1999; 73: 1660-1666Crossref PubMed Scopus (216) Google Scholar) while MsrA deficiency had previously been linked to smoker's emphysema (11Abrams W.R. Weinbaum G. Weissbach L. Weissbach H. Brot N. Proc. Natl. Acad. Sci. U. S. A. 1981; 78: 7483-7486Crossref PubMed Scopus (89) Google Scholar). In prokaryotes, mutation in msrA renders the cells sensitive to hydrogen peroxide treatment (13Moskovitz J. Rahman M.A. Strassman J. Yancey S.O. Kushner S.R. Brot N. Weissbach H. J. Bacteriol. 1995; 177: 502-507Crossref PubMed Scopus (252) Google Scholar, 14El Hassouni M. Chambost J.P. Expert D. Van Gijsegem F. Barras F. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 887-892Crossref PubMed Scopus (144) Google Scholar). Conversely, in yeast, overproduction of MsrA leads to resistance to AOS (15Moskovitz J. Flescher E. Berlett B.S. Azare J. Poston J.M. Stadman E.R. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 14071-14075Crossref PubMed Scopus (238) Google Scholar). Furthermore,msrA mutations decrease the virulence of many human and plant pathogens (14El Hassouni M. Chambost J.P. Expert D. Van Gijsegem F. Barras F. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 887-892Crossref PubMed Scopus (144) Google Scholar, 16Wizemann T.M. Moskovitz J. Pearce B.J. Cundell D. Arvidson C.G. So M. Weissbach H. Brot N. Masure H.R. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 7985-7990Crossref PubMed Scopus (115) Google Scholar), as expected since such bacteria are submitted to high levels of AOS produced by the invaded hosts defense system. In a few bacteria, MsrA is actually a domain of a polypeptide containing a second domain. We have analyzed the occurrence of this second domain and found it coded for in most sequenced genomes. InEscherichia coli, this gene is named yeaA. Here we report the characterization of YeaA, that we have rebaptised MsrB and find it to be a second methionine sulfoxide reductase that acts both on free MetSO and protein-contained MetSO residues. Unless noted otherwise, chemicals were purchased from Sigma. Thioredoxin reductase was a gift from Dr. C. Williams (University of Michigan, Ann Arbor, MI). Bacteria were grown on Luria-Bertani medium or M9 minimal medium. DNA manipulations were carried out using standard techniques, according to the manufacturer's instructions. Plasmid pET21MsrA was obtained by cloning the msrA gene in the pET21a vector (Novagen). Expression from this vector results in the synthesis of a protein with a His tag on the C terminus. ThemsrA coding region was amplified by polymerase chain reaction (PCR) using chromosomal DNA from E. coli strain MG1655 as a template and the oligonucleotides pFMsrAColi2-(GAATTCGCTAGCGAGCTCAGGAGGTTCCATATGAGTTTATTTGATAAAAAGCATCTGG) and pMsrAHis-C (GATCACTAAGCTTGGATCCTAGTGGTGGTGGTGGTGGTGGTGTGCTTCCGGC GGCAGACAGAC) as primers. The PCR product was inserted in plasmid pET21a between the EcoRI and HindIII sites. Plasmid pBAD24MsrB was obtained by cloning the msrB coding region into pBAD24 plasmid. The msrB coding region was amplified by PCR, using chromosomal DNA from E. coli strain MG1655 as a template and oligonucleotides pFMsrB1(CTGATAGAATTCCATATGGCTAATAAACCTTCGGC) and pBMsrB3 (TACTATTCTAAGCTTGGATCCTCAACCGTTGATTTCTTCGCCG) as primers. The PCR product was inserted in pBAD24 plasmid between the EcoRI andHindIII sites. All plasmid constructs were verified by DNA sequencing. The C-terminal His-tagged form of MsrA was purified. E. coli strain BL21(DE3) cells containing the plasmids pET21MsrA plasmid grown at 37 °C in Luria Bertani containing 100 μg/ml ampicillin. Cells were grown until an A600 value of 0.6, then 1 mm isopropyl-1-thio-β-d-galactopyranoside was added, and growth was continued for another 2 h. Cells were harvested by centrifugation and the pellet stored at −80 °C. The thawed pellet (2 g) was resuspended in 8 ml of buffer M (25 mm Hepes, pH 7.5, 10% (v/v) glycerol) containing 15 mm β-mercaptoethanol and 0.3 m KCl. Resuspended cells were broken by a single pass through a chilled French pressure cell at 6 tons. The resulting crude extract was centrifuged at 30,000 × g for 30 min at 4 °C. The supernatant was loaded on a 5-ml Hi-trap column (Amersham Biosciences) charged with nickel and equilibrated with buffer M plus 0.1 m KCl. Proteins were eluted by a 13-ml gradient from 0.05 to 0.5 mimidazole, and the fractions were analyzed by SDS-polyacrylamide gel electrophoresis. The MsrA-containing fractions were pooled, brought to 0.1 m KCl, and loaded on a 0.5 × 5cm MonoQ column (Amersham Biosciences) equilibrated with buffer M plus 0.1m KCl and 5 mm dithiothreitol. MsrA was eluted with a 7-ml gradient from 0.1 to 0.5 m KCl. Several fractions containing MsrA that were >98% pure as estimated by SDS-PAGE were aliquoted and stored at −80 °C. Typical yields were 20 mg per liter of culture. Protein concentrations were determined by the Bradford method using the Bio-Rad Protein assay kit. MsrB protein was overproduced in DH5α cells containing the plasmid pBAD24MsrB. Cells were grown at 37 °C until anA600 value of 0.6 in 4 liters of Luria Bertani broth containing 100 μg/ml ampicillin. Expression was induced by adding 0.2% arabinose and growth was continued for another 3 h. Cells were harvested by centrifugation, and the pellet (12 g) was resuspended in 48 ml of buffer A (50 mm Tris, pH 7.5, 10% (v/v) glycerol, 5 mm dithiothreitol). Resuspended cells were broken by a single pass through an ice-chilled French pressure cell at 5.5 tons. The crude extract was centrifuged at 30,000 ×g for 30 min at 4 °C. The supernatant was precipitated with 0.1% (v/v) polyethylenimine and centrifuged at 15,000 ×g at 4 °C for 20 min. The resulting supernatant was adjusted to 50 mm KCl and applied on a 30-ml Q-Sepharose (Sigma) column (column XK 16/20 Amersham Biosciences) equilibrated with buffer A plus 0.05 m KCl. A 150-ml gradient, running from 0.05 to 0.5 m KCl, was used for elution. Fractions containing MsrB were detected by immunoblot using anti-MsrB antibodies. The MsrB-containing fractions were pooled and concentrated by ultrafiltration on ultrafree biomax-5K (Millipore). Concentrated proteins were run on a gel filtration column (Superdex 75 HR 10/30 Amersham Biosciences) equilibrated with buffer M supplemented with 50 mm KCl, 5 mm dithiothreitol. MsrB protein was eluted at a molecular mass of 15,000 Da. Purity was estimated to be greater than 98% on SDS-PAGE Coomassie Blue staining. Mass spectrometry on the sample confirmed that MsrB was pure. Calibration of the gel filtration column indicated that the size of MsrB was 15,000 Da as predicted from amino acid sequence. Typical yields were 6 mg per liter of culture. Protein concentration was determined by the Bradford method using the Bio-Rad Protein assay kit. Calmodulin VU1, a recombinant calmodulin able to activate all calmodulin targets was used (17Craig T.A. Waterson D.M. Prendergast F.G. Haiech J. Roberts D.M. J. Biol. Chem. 1987; 262: 3278-3284Abstract Full Text PDF PubMed Google Scholar). VU1 was expressed and purified by column chromatography as previously described (18Roberts D.M. Crea R. Malecha M. Alvarado-Urbina G. Chiarello R.H. Waterson D.M. Biochemistry. 1985; 24: 5090-5098Crossref PubMed Scopus (111) Google Scholar). Purity of the protein was checked by SDS-PAGE and electrospray mass spectrometry. Prior to oxidation, calmodulin was decalcified. One to 10 mg of lyophilized CaM was dissolved in water and precipitated with 3.3% trichloroacetic acid. The pellet was suspended in a minimal volume of Tris 1m, pH9, water added to 1 ml of trichloroacetic acid precipitation was repeated three times, and, the last time, calmodulin-containing pellet was suspended in Hepes 50 mm,pH 7.5. Decalcified calmodulin (100 μm in Hepes 50 mm, pH 7.5) was treated with 50 mmH2O2 for 4 h at room temperature. H2O2 was removed by gel filtration through G25 Sephadex. Calmodulin was then concentrated by ultrafiltration on ultrafree biomax-5K (Millipore). Methionine sulfoxide reductase activity was assayed in 50 mm Tris buffer, pH 7.5, containing the substrate CaMox or MetSO, thioredoxin (5 μm), thioredoxin reductase (87 nm), and NADPH (that was used either at 200 or 400 μm). Reducing equivalents required for MetSO reduction were given by NADPH through the thioredoxin/thioredoxin reductase system (19Moskovitz J. Weissbach H. Brot N. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 2095-2098Crossref PubMed Scopus (196) Google Scholar). Assays were carried out at 37 °C in a final volume of 400 μl. All of the components were mixed together before adding the enzyme. The amount of NADPH oxidized was determined by measuring the absorbance at 340 nm. A unit of activity was defined as 1 nmol of NADPH oxidized per min. The rate of NADPH oxidation was linear with respect to enzyme concentration. Sample preparation was performed as follows. 30 μm CaMox was incubated at 37 °C in the presence of 1 μm of MsrA, MsrB, or both in 50 mm Tris-HCl (pH 7.5) containing thioredoxin (5 μm), thioredoxin reductase (87 nm) and NADPH (400 μm). The reaction was stopped by loading the sample onto a Sephadex G-25 column equilibrated with NH 4+ acetate (pH 6.2). The eluted protein was subsequently lyophilized. Mass spectrometry measurements were made using a Fourier Transform Ion Cyclotron Resonance Mass Spectrometer (Bruker Daltronics, Billerica, MA) equipped with a shielded 9.4T super-conducting magnet (Magnex Scientific Ltd, Abingdon, Oxon, United Kingdom) a cylindrical “infinity” ion cyclotron resonance cell with a diameter of 0.06 m and an external electrospray source (Analytica of Branford, Branford, CT) (20Palmblad M.H.K. Hakansson P. Feng X. Cooper H.J. Giannakopulos A.E. Green P.S. Derrick P.J. Eur. J. Mass. Spectrom. 2000; 6: 267-275Crossref Scopus (68) Google Scholar). Carbon dioxide heated to 200 °C was used as the drying gas in the electrospray source. The background pressure in the ion cyclotron resonance cell was typically below 2 × 10−10millibars. Calmodulin samples were prepared at a concentration of 30 μm in 50:50 water:acetonitrile 1% formic acid and injected into the mass spectrometer using a syringe pump, at a rate of 60 μl h−1. Plasmid pMsrB was obtained as follows. The msrB coding region was amplified from chromosomal DNA from E. coli strain MG1655 using oligonucleotides 5′ coding pFMsrB2 containing anEcoRI site (5′-ACTGATCATGAATTCCAAGCTTTGTTAGTGAATAAAAGGTTG-3′) and 3′-complementary pBMsrB3 containing a SphI site (5′-TAGCTCAGCATGCAACTCAGATCACAATTACGC-3′). Note that pFMsrB2 and pBMsrB3 oligonucleotides are found at 300 nt upstream and 560 nt downstream of the msrB coding region. The resulting PCR product was cloned into pUC18 plasmid, previously cut withEcoRI and SphI enzymes, yielding pMsrB01. ThemsrB gene was interrupted by insertion of anaphA-3 cassette (KanR) (21Menard R. Sansonetti P.J. Parsot C. J. Bacteriol. 1993; 175: 5899-5906Crossref PubMed Scopus (612) Google Scholar) to generate a non-polar mutation as follows. The pMsrB01 plasmid was digested withAgeI, and the extremities blunted with the Klenow fragment of DNA polymerase I. The aphA-3 cassette was obtained afterSmaI digestion of pUC18K plasmid and inserted at theAgeI linearized pMsrB01 plasmid, yielding pMsrB02 plasmid. Note that the AgeI site is located at nt 210 downstream the ATG start codon. The pMsrB02 plasmid was then linearized by usingSphI and EcoRI restriction enzymes and the resulting linear fragment was electroporated into E. coliKM354 (recJ) strain carrying the pTP223 plasmid (bet gam exo) (22Murphy K.C. J. Bacteriol. 1998; 180: 2063-2071Crossref PubMed Google Scholar). KanR clones were selected and checked for AmpS phenotype. PCR was then used to check that recombination had taken place at the msrB locus. Last, the mutation was transferred into the E. coli MG1655 wild type strain by transduction with P1 phage, and the resulting mutant strain was called BE017. Cultures of E. coli were grown overnight in M9 medium. Cells were then pelleted and resuspended in fresh M9 to an A600 of 0.01. Growth was followed by measuring the A600. During the exponential growth phase (A600 of 0.6), cultures were split into two subcultures, one of which received cadmium (final concentration 22 μm). In six of the available genome sequences, msrA-encoded protein is fused to an additional domain of ∼150 residues in size and of unknown function. This additional domain was found to occur in all available genomic sequences, including eubacteria, animals, plants, humans, and some archea, most often as a single gene product. This domain will be referred to as MsrB. The level of conservation within the MsrB family is quite high since, for instance, human and E. colisequences share around 25% identity. The fusion between MsrA and MsrB in some genomes was recently used as a basis to predict physical interactions between the two proteins (23Enright A.J. Iliopoulos I. Kyrpides N.C. Ouzounis C.A. Nature. 1999; 402: 86-90Crossref PubMed Scopus (862) Google Scholar). We investigated this issue by using E. coli MsrB and MsrA proteins as models. Both proteins were purified (see “Experimental Procedures”) mixed, and run on a gel filtration column. Despite use of various running conditions, MsrA and MsrB always eluted at their respective apparent molecular weight (data not shown). Likewise, interaction between MsrA and MsrB failed to be revealed by either cross-linking or yeast two-hybrid assays (data not shown). Taken together, these data rendered a physical interaction between MsrA and MsrB highly unlikely. Another possibility to account for the fusion of MsrA and MsrB was that they are functionally related. Therefore, we tested whether MsrB had sulfoxide reductase activity. MetSO and dimethyl sulfoxide (Me2SO) were used as substrates as well as methionine. The thioredoxin recycling assay, where reducing equivalents are provided by NADPH through the thioredoxin/thioredoxin reductase system, was used (19Moskovitz J. Weissbach H. Brot N. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 2095-2098Crossref PubMed Scopus (196) Google Scholar). Reductase activity was determined by following spectrophotometrically the oxidation of NADPH. NADPH oxidation was observed when MetSO (2.8 nmol NADPH oxidized/min) or Me2SO (5.7 nmol NADPH oxidized/min) were used as substrates. In contrast, no NADPH oxidation was observed with methionine as a substrate. This indicated that MsrB has a sulfoxide reductase activity. To compare the efficiencies of MsrA and MsrB in reducing free MetSO, we undertook steady-state kinetics analysis of these enzymes. Under our assay conditions, MsrB and MsrA exhibited Michaelis-Menten kinetics (Fig.1). Km values were 170 μm and 6.7 mm for MsrA and MsrB, respectively. The value found with MsrA is in good agreement with the previously published value of 120 μm (24Moskovitz J. Poston J.M. Berlett B.S. Nosworthy N.J. Szczepanowski R. Stadtman E.R. J. Biol. Chem. 2000; 275: 14167-14172Abstract Full Text Full Text PDF PubMed Scopus (158) Google Scholar). Turn over numbers were 20 min−1 and 0.6 min−1 for MsrA and MsrB, respectively. Catalytic efficiency (kcat/Km) of MsrA was found to be 1000-fold greater than that of MsrB reflecting the much lower ability of MsrB to reduce free MetSO. These results indicated that MsrB is much less efficient at reducing free MetSO than MsrA. To know whether MsrB could act on peptide-bound MetSO, CaMox was used as a substrate since repair of CaMox by MsrA has been well documented (9Sun H. Gao J. Ferrington D.A. Biesiada H. Williams T. Squier T.C. Biochemistry. 1999; 38: 105-112Crossref PubMed Scopus (147) Google Scholar). Kinetic studies showed that activities of MsrA and MsrB, using CaMox as a substrate, were similar (Fig.2). MsrA exhibited higher initial rate of NADPH oxidation, e.g. 2 nmol of NADPH oxidized/min, than MsrB, e.g. 1.3 nmol of NADPH oxidized/min (Fig. 2). However, the total amount of NADPH oxidized by either MsrA or MsrB was identical. This analysis showed that MsrB can also act on MetSO residues within oxidized proteins. The repair of CaMox by MsrB was further studied by mass spectrometry. Calmodulin was first decalcified and subsequently oxidized in vitro, and the resulting product analyzed by mass electrospray coupled to Fourier Transform ion cyclotron resonance (FTICR) (Fig.3A). The major species (45%) was CaMox containing 8 MetSO (there are eight methionines in the CaM used). Additional abundant species containing 6 and 7 MetSO were also detected, amounting to 24 and 31%, respectively. No other species were detected indicating that only MetSO were generated. Incubation of CaMox with MsrA resulted in reduction of several, but not all of the MetSO residues (Fig. 3B) The most abundant population contained 3 MetSO (41%) though oxiforms containing 1 to 4 MetSO residues were present (Fig. 3B). Such a partial repair of CaMox by MsrA is consistent with previous work by others (9Sun H. Gao J. Ferrington D.A. Biesiada H. Williams T. Squier T.C. Biochemistry. 1999; 38: 105-112Crossref PubMed Scopus (147) Google Scholar). Incubation of CaMox with MsrB led to a pattern similar to that observed with MsrA (Fig.3C). Oxiforms containing from 1 to 4 MetSO were found, with the 3 MetSO-containing species being the most abundant (40%). It is noteworthy that the 1 MetSO-containing oxiform population accounted for 12% of the population repaired by MsrB while it was in very low abundance (4%) when MsrA was used as a reductase. Incubation of CaMox with both MsrA and MsrB yielded three populations. The first exhibited a mass that corresponded to the expected value for fully reduced CaM. This species accounted for 60% of the population. A second species, the mass of which corresponded to reduced CaM with one calcium ion bound, represented about 32% of the population. We could also observe a very low abundance species, the mass of which corresponded to that expected for a reduced calmodulin with two calcium ions bound (6%). It is likely that calcium found in these species came from trace amounts present in instruments or the preparations of MsrA, MsrB, or thioredoxin reductase. The fact that full repair of CaMox required the presence of both MsrA and MsrB suggested that the two enzymes possess complementary properties. To investigate this issue, we submitted CaMox to sequential repair by MsrA and MsrB. CaMox was incubated with MsrB in the presence of both NADPH and the couple thioredoxin/thioredoxin reductase, and the reaction left to proceed until NADPH oxidation stopped (Fig.4A). Arrest of the reaction could be due to limitation of either a chemical required for the reaction or substrate. Subsequent addition in the same mixture of a new batch of CaMox allowed the reaction to resume (Fig. 4A). In contrast, addition of new enzyme did not allow the reaction to resume (Fig. 4A). Taken together, these experiments indicate that the reaction had previously ceased because of substrate limitation. In a new experiment, we left the MsrB-catalyzed reaction to proceed until it reached substrate limitation and then added MsrA. We observed that NADPH oxidation resumed (Fig. 4A). The converse experiment was also performed. CaMox was first reduced by MsrA, the reaction again left to proceed until apparent completion, i.e. substrate limitation, and MsrB was subsequently added to the mixture. Again, we observed that the consumption of NADPH resumed upon addition of the second enzyme (Fig. 4B). MsrB Contributes to Resistance of E. coli Against Cadmium—A strain of E. coli lacking a functional copy ofmsrB was constructed by reverse genetics (see “Experimental Procedures”). No defect in growth rate or colony morphology was observed when grown in LB medium. The expression of an ortholog of msrB has been reported to be induced by cadmium in Enterococcus faecalis (25Laplace J.M. Hartke A. Giard J.C. Auffray Y. Appl. Microbiol. Biotechnol. 2000; 53: 685-689Crossref PubMed Scopus (20) Google Scholar). Therefore, we investigated whether msrB had any relationship with cadmium resistance inE. coli. While wild type E. coli MG1655 strain grew well in the presence of cadmium, MG1655 msrB strain stopped growing (Fig. 5). We should note that in some experiments, cadmium sensitivity was less dramatic. We have no explanation for this but suspect changes in trace elements concentration in the growth medium. In any case, throughout over 10 experiments carried out with simultaneously growing pair of isogenic wild type and mutant, this later always exhibited increased sensitivity to cadmium. In this study, we identified a new methionine sulfoxide reductase, the structural gene of which is conserved throughout almost all free-living organisms with the exception of a few archaebacteria. The function of this enzyme is to repair proteins that have been damaged by exposure to oxidative agents. MsrB was found to act on free MetSO and Me2SO. This argues for MsrB being specific for the −SO functional group. MsrB was also very efficient in reducing MetSO residues in peptides. To demonstrate this, we used calmodulin as a model substrate, since this later had been extensively used for probing the reductase activity of MsrA (for reviews see Refs. 4Brot N. Weissbach H. Biopolymers. 2001; 55: 288-296Crossref Scopus (80) Google Scholar, 26Squier T.C. Bigelow D.J. Front. Biosci. 2000; 5: 504-526Crossref PubMed Google Scholar). Comparison of MsrA and MsrB activities on CaMox suggested that they reduced CaMox with similar efficiencies. Electrospray mass spectrometry coupled to FTICR was then used to characterize the products of MsrA and/or MsrB acting on CaMox. It should be remarked that the analysis of such protein mixtures is quite complex since species with similar molecular masses can overlap (there is only a 6-Da differences between a double oxidation and a one Ca2+ adduct), generating poorly resolved peaks and inaccuracies in mass assignment. The high accuracy (less than 10 ppm) and resolution of FTICR measurements allowed us to characterize oxiforms of calmodulin recovered after treatment with either reductase. A first set of experiments, in which MsrA and MsrB were added separately to CaMox, revealed a similar pattern of products. Neither one was able to fully reduce CaMox, and, in both cases, the most populated oxiform contained 3 MetSO out of 8 initially present. Repair of CaMox by MsrA was extensively studied by Squier and collaborators (9Sun H. Gao J. Ferrington D.A. Biesiada H. Williams T. Squier T.C. Biochemistry. 1999; 38: 105-112Crossref PubMed Scopus (147) Google Scholar, 26Squier T.C. Bigelow D.J. Front. Biosci. 2000; 5: 504-526Crossref PubMed Google Scholar). Overall our results are consistent with those reported by these authors although some differences appeared in the population size of each oxiform. These apparent discrepancies could be accounted for by differences in samples preparation or the origin of the calmodulin used. In particular, these authors used calcium-loaded CaMox while we used decalcified calmodulin. Analysis of the effect of calcium on oxidation and subsequent MsrA/B-mediated repair is under way using calorimetric methods. Full repair of CaMox is an as yet undocumented phenomenon. This was achieved when MsrA and MsrB were added simultaneously. To explain that MsrA was unable to fully repair CaMox, Squier and collaborators put forward the hypothesis that MsrA repairs MetSO residues that are located in hydrophobic regions of CaMox, i.e. those residues that are buried in the native structure. This led support to the model that MsrA acts upon unfolded forms (9Sun H. Gao J. Ferrington D.A. Biesiada H. Williams T. Squier T.C. Biochemistry. 1999; 38: 105-112Crossref PubMed Scopus (147) Google Scholar). As a consequence, we might explain the full repair of CaMox by postulating that MsrB acts upon solvent-exposed MetSO. However, recent results revealed that MsrA exhibits diastereoselectivity and acts selectively onl-Met-S-SO in CaMox (27Sharov V.S. Ferrington D.A. Squier T.C. Schöneich C. FEBS Lett. 1999; 455: 247-250Crossref PubMed Scopus (164) Google Scholar, 28Sharov V.S. Schöneich C. Free Radic. Biol. Med. 2000; 29: 986-994Crossref PubMed Scopus (59) Google Scholar). Hence, another possibility is that MsrB repairs selectively l-Met-R-SO. CaMox would then contain a mixture of both diastereoisomers that would require both types of methionine sulfoxide reductase to be fully reduced. The hypothesis of substrate specificity received additional experimental support by submitting CaMox to sequential action of MsrA and MsrB. Indeed, we observed that CaMox that had previously been reduced by MsrA remained a bona fide substrate for MsrB and vice versa. The simplest interpretation is that each Msr targets different MetSO diastereoisomers within CaMox. Recently, this hypothesis received additional support using purified l-Met-R-SO andl-Met-S-SO and MsrB-purified protein. 2H. Weissbach, personal communication. Despite being functionally related, MsrA and MsrB appear not to share a recent origin since comparison of their amino acid sequences failed to reveal any overall similarity. Moreover, 1D NMR analysis ofE. coli MsrB 3P. Gans, unpublished material. as well as CD spectra of the Mycoplasma genitalium msrBortholog (MG448) suggested that MsrB is unstructured (29Balasubramanian S. Schneider T. Gerstein M. Regan L. Nucleic Acids Res. 2000; 28: 3075-3082Crossref PubMed Scopus (29) Google Scholar). This contrasts with MsrA that is well structured, as recently shown by the resolution of the three-dimensional structures by x-ray crystallography (5Lowther W.T. Brot N. Weissbach H. Matthews B.W. Biochemistry. 2000; 39: 13307-13312Crossref PubMed Scopus (120) Google Scholar, 6Tete-Favier F. Cobessi D. Boschi-Muller S. Azza S. Branlant G. Aubry A. Structure. 2000; 8: 1167-1178Abstract Full Text Full Text PDF PubMed Scopus (83) Google Scholar). Of potential interest, however, is a motif reading CGWP(S/A)F that is present in MsrB sequences. This motif is reminiscent of the signature motif CGFWG, containing the Cys catalytic residue in MsrA (7Lowther W.T. Brot N. Weissbach H. Honek J.F. Matthews B.W. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 6463-6468Crossref PubMed Scopus (146) Google Scholar). Ongoing studies aim at testing the role of the CGWP(S/A)F motif in MsrB activity. Analysis of msrA and msrB genes distribution in all sequenced genomes revealed a great diversity of genetic organizations (Fig. 6). In some genomes,msrA and msrB are located in different positions (e.g. E. coli). In some genomes, they are fused such as to encode a bifunctional MsrA-MsrB polypeptide (e.g. Helicobacter pylori). In Bacillus subtilis, the intermediate situation is to be found since msrA andmsrB genes lie adjacent one to the other, most probably in an operon structure. In Neisseria, they are fused with thedsbE ortholog that encodes a disulfide oxidoreductase. Intriguingly, in this later case, the three-domain protein possess a signal sequence, suggesting that it acts in an extracytoplasmic compartment. Another type of organization is found in Arabidopsis thaliana, in which there are multiple msrA andmsrB, with one gene predicted to encode a polypeptide containing two MsrB domains in tandem. Another remarkable case is provided by human where MsrB was called SelX, a selenocysteine-containing protein (30Lescure A. Gautheret D. Carbon P. Krol A. J. Biol. Chem. 1999; 274: 38147-38154Abstract Full Text Full Text PDF PubMed Scopus (221) Google Scholar). Characterization of these diverse MsrB orthologs will be of interest in revealing the biological importance of these diverse genetic arrangements. It would, for instance, be of interest to know whether increased efficiency in repair was gained by the fusion of msrA and msrB or by the tandem duplication of msrB as found in plants. Phenotypic analysis of an E. coli strain lacking a functional copy of msrB revealed its importance in cadmium resistance. Cadmium is a potent carcinogenic and damages cells in several ways, among which is catalysis of AOS production. Hypersensitivity of E. coli msrB to cadmium is consistent with the finding that expression of the E. faecalis msrBortholog (and not msrA as misquoted by the authors) is induced in the presence of cadmium (25Laplace J.M. Hartke A. Giard J.C. Auffray Y. Appl. Microbiol. Biotechnol. 2000; 53: 685-689Crossref PubMed Scopus (20) Google Scholar). In this context, it is important to remember that msrA mutation confers increased sensitivity to oxidative stress in both E. coli andErwinia chrysanthemi (13Moskovitz J. Rahman M.A. Strassman J. Yancey S.O. Kushner S.R. Brot N. Weissbach H. J. Bacteriol. 1995; 177: 502-507Crossref PubMed Scopus (252) Google Scholar, 14El Hassouni M. Chambost J.P. Expert D. Van Gijsegem F. Barras F. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 887-892Crossref PubMed Scopus (144) Google Scholar). These phenotypic analyses together with the biochemical features of MsrA and MsrB suggest that these methionine sulfoxide reductases have an important function in protecting cells from oxidative damages. Furthermore, a crucial role for msrB in cell physiology was recently advanced by a systematic alteration of Mycobacterium open reading frame that identified the msrB ortholog as an essential gene (31Hutchison C.A. Peterson S.N. Gill S.R. Cline R.T. White O. Fraser C.M. Smith H.O. Venter J.C. Science. 1999; 286: 2165-2169Crossref PubMed Scopus (725) Google Scholar). Although most proteins contain solvent-exposed methionine that are potential targets for oxidation, one can expect that only a subset of cell proteins will be fully inactivated by methionine oxidation. Hence, importance of the Msr repair pathway might be appreciated by identifying those proteins that contain structural and/or functionally important Met residues. Alternatively, insight might be provided by proteomic approaches aimed at describing proteins networks. A systematic search for protein/protein interactions by the yeast two-hybrid screen was recently carried out in H. pylori(32Rain J.C. Selig L. De Reuse H. Battaglia V. Reverdy C. Simon S. Lenzen G. Petel F. Wojcik J. Schachter V. Chemama Y. Labigne A. Legrain P. Nature. 2001; 409: 211-215Crossref PubMed Scopus (900) Google Scholar). Interestingly, the H. pylori bi-functional MsrA/MsrB protein (Fig. 6) was found to interact with ClpX, a chaperone that assists folding of abnormal proteins or associates with the ClpP protease for degradation of those misfolded proteins. Hence, a possibility is that MsrA/B repairs oxidized ClpX. Alternatively, MsrA/B and ClpX might form a complex such that a given oxidized protein might either get repaired by MsrA/B or be directed to ClpP-mediated degradation. Our ongoing studies aim at identifying in vivosubstrates of MsrA and MsrB to define the repair pathway of MetSO-containing proteins. We are grateful to C. Williams (University of Michigan, Ann Arbor, MI) for kindly providing us with thioredoxin reductase. Thanks are due to members of the Erwinia group, to P. Gans (Institute Biologie Structurale, Grenoble, France), to P. Moreau (Laboratoire Chimie Bacterienne, Marseille, France) for fruitful discussions, to J. Sturgis (Laboratoire Ingéniérie Systems Membranaires, Marseille, France) for help in preparing the manuscript and to R. Toci (LCB) for help in Cam purification." @default.
• W2088938488 created "2016-06-24" @default.
• W2088938488 creator A5000792885 @default.
• W2088938488 creator A5003846685 @default.
• W2088938488 creator A5017511524 @default.
• W2088938488 creator A5060147118 @default.
• W2088938488 creator A5080437553 @default.
• W2088938488 creator A5084079251 @default.
• W2088938488 creator A5087847908 @default.
• W2088938488 date "2001-12-01" @default.
• W2088938488 modified "2023-10-18" @default.
• W2088938488 title "Repair of Oxidized Proteins" @default.
• W2088938488 cites W1481302364 @default.
• W2088938488 cites W1884874540 @default.
• W2088938488 cites W1965310787 @default.
• W2088938488 cites W1965507089 @default.
• W2088938488 cites W1968411230 @default.
• W2088938488 cites W1972663428 @default.
• W2088938488 cites W1973318532 @default.
• W2088938488 cites W1987543269 @default.
• W2088938488 cites W1998493256 @default.
• W2088938488 cites W1998763047 @default.
• W2088938488 cites W2003678940 @default.
• W2088938488 cites W2006903305 @default.
• W2088938488 cites W2014967055 @default.
• W2088938488 cites W2021773540 @default.
• W2088938488 cites W2027933081 @default.
• W2088938488 cites W2036036635 @default.
• W2088938488 cites W2037116841 @default.
• W2088938488 cites W2040941311 @default.
• W2088938488 cites W2041079052 @default.
• W2088938488 cites W2044823713 @default.
• W2088938488 cites W2045415864 @default.
• W2088938488 cites W2046260259 @default.
• W2088938488 cites W2048966030 @default.
• W2088938488 cites W2089457861 @default.
• W2088938488 cites W2107508146 @default.
• W2088938488 cites W2110735860 @default.
• W2088938488 cites W2132065606 @default.
• W2088938488 cites W2133918998 @default.
• W2088938488 cites W2146312020 @default.
• W2088938488 cites W2161767156 @default.
• W2088938488 cites W2164698321 @default.
• W2088938488 cites W2169569915 @default.
• W2088938488 doi "https://doi.org/10.1074/jbc.m105509200" @default.
• W2088938488 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/11677230" @default.
• W2088938488 hasPublicationYear "2001" @default.
• W2088938488 type Work @default.
• W2088938488 sameAs 2088938488 @default.
• W2088938488 citedByCount "328" @default.
• W2088938488 countsByYear W20889384882012 @default.
• W2088938488 countsByYear W20889384882013 @default.
• W2088938488 countsByYear W20889384882014 @default.
• W2088938488 countsByYear W20889384882015 @default.
• W2088938488 countsByYear W20889384882016 @default.
• W2088938488 countsByYear W20889384882017 @default.
• W2088938488 countsByYear W20889384882018 @default.
• W2088938488 countsByYear W20889384882019 @default.
• W2088938488 countsByYear W20889384882020 @default.
• W2088938488 countsByYear W20889384882021 @default.
• W2088938488 countsByYear W20889384882022 @default.
• W2088938488 countsByYear W20889384882023 @default.
• W2088938488 crossrefType "journal-article" @default.
• W2088938488 hasAuthorship W2088938488A5000792885 @default.
• W2088938488 hasAuthorship W2088938488A5003846685 @default.
• W2088938488 hasAuthorship W2088938488A5017511524 @default.
• W2088938488 hasAuthorship W2088938488A5060147118 @default.
• W2088938488 hasAuthorship W2088938488A5080437553 @default.
• W2088938488 hasAuthorship W2088938488A5084079251 @default.
• W2088938488 hasAuthorship W2088938488A5087847908 @default.
• W2088938488 hasBestOaLocation W20889384881 @default.
• W2088938488 hasConcept C12554922 @default.
• W2088938488 hasConcept C185592680 @default.
• W2088938488 hasConcept C55493867 @default.
• W2088938488 hasConcept C70721500 @default.
• W2088938488 hasConcept C86803240 @default.
• W2088938488 hasConceptScore W2088938488C12554922 @default.
• W2088938488 hasConceptScore W2088938488C185592680 @default.
• W2088938488 hasConceptScore W2088938488C55493867 @default.
• W2088938488 hasConceptScore W2088938488C70721500 @default.
• W2088938488 hasConceptScore W2088938488C86803240 @default.
• W2088938488 hasIssue "52" @default.
• W2088938488 hasLocation W20889384881 @default.
• W2088938488 hasLocation W20889384882 @default.
• W2088938488 hasLocation W20889384883 @default.
• W2088938488 hasLocation W20889384884 @default.
• W2088938488 hasLocation W20889384885 @default.
• W2088938488 hasOpenAccess W2088938488 @default.
• W2088938488 hasPrimaryLocation W20889384881 @default.
• W2088938488 hasRelatedWork W1531601525 @default.
• W2088938488 hasRelatedWork W2319480705 @default.
• W2088938488 hasRelatedWork W2384464875 @default.
• W2088938488 hasRelatedWork W2398689458 @default.
• W2088938488 hasRelatedWork W2606230654 @default.
• W2088938488 hasRelatedWork W2607424097 @default.
• W2088938488 hasRelatedWork W2748952813 @default.
• W2088938488 hasRelatedWork W2899084033 @default.
• W2088938488 hasRelatedWork W2948807893 @default.

• next