FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2089063033> ?p ?o ?g. }

• W2089063033 endingPage "20910" @default.
• W2089063033 startingPage "20903" @default.
• W2089063033 abstract "The Na+/Ca2+exchanger (NCX) and the plasma membrane Ca2+-ATPase export Ca2+ from the cytosol to the extracellular space. Three NCX genes (NCX1, NCX2, and NCX3), encoding proteins with very similar properties, are expressed at different levels in tissues. Essentially, no information is available on the mechanisms that regulate their expression. Specific antibodies have been prepared and used to explore the expression of NCX1 and NCX2 in rat cerebellum. The expression of NCX2 became strongly up-regulated during development, whereas comparatively minor effects were seen for NCX1. This was also observed in cultured granule cells induced to mature in physiological concentrations of potassium. By contrast, higher K+ concentrations, which induce partial depolarization of the plasma membrane and promote the influx of Ca2+, caused the complete disappearance of NCX2. Reverse transcription-polymerase chain reaction analysis showed that the process occurred at the transcriptional level and depended on the activation of the Ca2+ calmodulin-dependent protein phosphatase, calcineurin. The NCX1 andNCX3 genes were also affected by the depolarizing treatment: the transcription of the latter became up-regulated, and the pattern of expression of the splice variants of the former changed. The effects on the NCX1 and NCX3 genes were calcineurin-independent. The Na+/Ca2+exchanger (NCX) and the plasma membrane Ca2+-ATPase export Ca2+ from the cytosol to the extracellular space. Three NCX genes (NCX1, NCX2, and NCX3), encoding proteins with very similar properties, are expressed at different levels in tissues. Essentially, no information is available on the mechanisms that regulate their expression. Specific antibodies have been prepared and used to explore the expression of NCX1 and NCX2 in rat cerebellum. The expression of NCX2 became strongly up-regulated during development, whereas comparatively minor effects were seen for NCX1. This was also observed in cultured granule cells induced to mature in physiological concentrations of potassium. By contrast, higher K+ concentrations, which induce partial depolarization of the plasma membrane and promote the influx of Ca2+, caused the complete disappearance of NCX2. Reverse transcription-polymerase chain reaction analysis showed that the process occurred at the transcriptional level and depended on the activation of the Ca2+ calmodulin-dependent protein phosphatase, calcineurin. The NCX1 andNCX3 genes were also affected by the depolarizing treatment: the transcription of the latter became up-regulated, and the pattern of expression of the splice variants of the former changed. The effects on the NCX1 and NCX3 genes were calcineurin-independent. NCX2, NCX3, exchanger types 1, 2, 3, cDNA reverse transcriptase polymerase chain reaction polyacrylamide gel electrophoresis calmodulin-dependent kinase-kinase glyceraldehyde-3-phosphate dehydrogenase plasma membrane Ca2+ pump Hormonal and electrical stimuli promote the penetration of Ca2+ into cells to activate cellular responses. Ca2+ must then be continuously extruded, because its uncontrolled increase in the cytosol would lead to cell death. Two systems, a pump (1.Carafoli E. FASEB J. 1994; 8: 993-1002Crossref PubMed Scopus (360) Google Scholar) and a Na+/Ca2+ exchanger (2.Philipson K.D. Nicoll D.A. Curr. Opin. Cell Biol. 1992; 4: 678-683Crossref PubMed Scopus (45) Google Scholar), eject Ca2+. The latter system, which is particularly active in heart and neurons, uses the Na+ gradient generated by the Na+/K+-ATPase to remove Ca2+ from the cytosol; under normal conditions 3 Na+ ions are exchanged for 1 Ca2+. The cDNA of exchanger type 1 (NCX1)1 has been cloned from mammalian (3.Nicoll D.A. Longoni S. Philipson K.D. Science. 1990; 250: 562-565Crossref PubMed Scopus (627) Google Scholar, 4.Aceto J.F. Condrescu M. Kroupis C. Nelson H. Nelson N. Nicoll D. Philipson K.D. Reeves J.P. Arch. Biochem. Biophys. 1992; 298: 553-560Crossref PubMed Scopus (67) Google Scholar, 5.Komuro I. Wenninger K.E. Philipson K.D. Izumo S. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 4769-4773Crossref PubMed Scopus (128) Google Scholar, 6.Low W. Kasir J. Rahamimoff H. FEBS Lett. 1993; 316: 63-67Crossref PubMed Scopus (69) Google Scholar, 7.Tsuruya Y. Bersohn M.M. Li Z. Nicoll D.A. Philipson K.D. Biochim. Biophys. Acta. 1994; 1196: 97-99Crossref PubMed Scopus (25) Google Scholar, 8.Kim I. Lee C.O. Ann. N. Y. Acad. Sci. 1996; 779: 126-128Crossref PubMed Scopus (8) Google Scholar), amphibian (9.Iwata T. Kraev A. Guerini D. Carafoli E. Ann. N. Y. Acad. Sci. 1996; 779: 37-45Crossref PubMed Scopus (23) Google Scholar), and invertebrate (10.Ruknudin A. Valdivia C. Kofuji P. Lederer W.J. Schulze D.H. Am. J. Physiol. 1997; 273: C257-C265Crossref PubMed Google Scholar, 11.Schwarzer A. Kim T.S.Y. Hagen V. Molday R.S. Bauer P.J. Biochemistry. 1997; 36: 13667-13676Crossref PubMed Scopus (34) Google Scholar) tissues. A comparison of the sequences shows a high level of conservation. The mature NCX1 is a glycosylated protein (12.Hryshko L.V. Nicoll D.A. Weiss J.N. Philipson K.D. Biochim. Biophys. Acta. 1993; 1151: 35-42Crossref PubMed Scopus (62) Google Scholar) of 970 amino acids, the first 32 of which are post-translationally cleaved off (13.Furman I. Cook O. Kasir J. Low W. Rahamimoff H. J. Biol. Chem. 1995; 270: 19120-19127Abstract Full Text Full Text PDF PubMed Scopus (23) Google Scholar, 14.Loo T.W. Ho C. Clarke D.M. J. Biol. Chem. 1995; 270: 19345-19350Abstract Full Text Full Text PDF PubMed Scopus (19) Google Scholar, 15.Sahin Toth M. Nicoll D.A. Frank J.S. Philipson K.D. Friedlander M. Biochem. Biophys. Res. Commun. 1995; 212: 968-974Crossref PubMed Scopus (25) Google Scholar). The original membrane topography model based on hydropathy analysis predicted 11 transmembrane domains, separated by small loops and by a large intracellular loop (>500 amino acids) between transmembrane domains 5 and 6. A more recent model based on cysteine accessibility studies has revised the number of predicted transmembrane domains down to 9 (16.Nicoll D.A. Ottolia M. Lu L. Lu Y. Philipson K.D. J. Biol. Chem. 1999; 274: 910-917Abstract Full Text Full Text PDF PubMed Scopus (174) Google Scholar), eliminating 2 from the C-terminal half of the exchanger. Although the large intracellular loop is not strictly necessary for the activity of the exchanger, it contains important regulatory elements (17.Levitsky D.O. Nicoll D.A. Philipson K.D. J. Biol. Chem. 1994; 269: 22847-22852Abstract Full Text PDF PubMed Google Scholar, 18.Matsuoka S. Nicoll D.A. Hryshko L.V. Levitsky D.O. Weiss J.N. Philipson K.D. J. Gen. Physiol. 1995; 105: 403-420Crossref PubMed Scopus (204) Google Scholar, 19.Matsuoka S. Nicoll D.A. Reilly R.F. Hilgemann D.W. Philipson K.D. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 3870-3874Crossref PubMed Scopus (200) Google Scholar). Its C-terminal portion is subjected to alternative splicing (20.Kofuji P. Lederer W.J. Schulze D.H. J. Biol. Chem. 1994; 269: 5145-5149Abstract Full Text PDF PubMed Google Scholar), which also occurs at the 5′-untranslated region of the gene (21.Lee S.L., Yu, A.S. Lytton J. J. Biol. Chem. 1994; 269: 14849-14852Abstract Full Text PDF PubMed Google Scholar, 22.Barnes K.V. Cheng G. Dawson M.M. Menick D.R. J. Biol. Chem. 1997; 272: 11510-11517Abstract Full Text Full Text PDF PubMed Scopus (52) Google Scholar, 23.Scheller T. Kraev A. Skinner S. Carafoli E. J. Biol. Chem. 1998; 273: 7643-7649Abstract Full Text Full Text PDF PubMed Scopus (28) Google Scholar). Numerous splicing variants have been described for NCX1. The amount of the major variant present in neurons (the AD isoform) is altered by protein kinase A (24.He S. Ruknudin A. Bambrick L.L. Lederer W.J. Schulze D.H. J. Neurosci. 1998; 18: 4833-4841Crossref PubMed Google Scholar). Although α-adrenergic stimulation led to the increase of NCX1 mRNA in cultured cardiac myocytes (25.Menick D.R. Barnes K.V. Dawson M.M. Kent R.L. Cooper G.T. J. Cardiovasc. Fail. 1996; 2: S69-S76Abstract Full Text PDF PubMed Scopus (14) Google Scholar), glucocorticoids and protein kinase A down-regulated it in vascular smooth muscle cells. Protein kinase C had the same effect in endothelial cells (26.Smith L. Smith J.B. J. Biol. Chem. 1994; 269: 27527-27531Abstract Full Text PDF PubMed Google Scholar, 27.Smith L. Porzig H. Lee H.W. Smith J.B. Am. J. Physiol. 1995; 269: C457-C463Crossref PubMed Google Scholar). Changes in the expression of theNCX1 gene have also been observed during cardiac development (28.Boerth S. Zimmer D. Artman M. Circ. Res. 1994; 74: 354-359Crossref PubMed Google Scholar) and pressure overload (29.Kent R. Rozich J. McCollam P. McDermott D. Thacker U. Menick D. McDermott P. Cooper G.t. Am. J. Physiol. 1993; 265: H1024-H1029Crossref PubMed Google Scholar). Two additional exchanger genes encoding proteins with high homology to NCX1 have also been cloned: NCX2 (30.Li Z. Matsuoka S. Hryshko L.V. Nicoll D.A. Bersohn M.M. Burke E.P. Lipton R.P. Philipson K.D. J. Biol. Chem. 1994; 269: 17434-17439Abstract Full Text PDF PubMed Google Scholar) and NCX3(31.Nicoll D.A. Quednau B.D. Qui Z. Xia Y.R. Lusis A.J. Philipson K.D. J. Biol. Chem. 1996; 271: 24914-24921Abstract Full Text Full Text PDF PubMed Scopus (309) Google Scholar). Whereas NCX1 is expressed at high levels in heart, and is thus normally referred to as the “cardiac form” of the protein even if also present in other tissues, significant amounts ofNCX2 and NCX3 mRNAs have only been detected by Northern blots in brain and skeletal muscles. However, minor amounts were detected also in other tissues using more sensitive RT-PCR methods. Some splice variants have been detected for NCX3but none so far for NCX2. Although the exchanger proteins have not been satisfactorily purified, comparisons of the biochemical properties of the NCX1, NCX2, and NCX3 exchangers have been made on membrane preparations and on overexpressing cells. Because no significant differences were detected (32.Linck B. Qiu Z. He Z. Tong Q. Hilgemann D.W. Philipson K.D. Am. J. Physiol. 1998; 274: C415-C423Crossref PubMed Google Scholar), the rationale for the existence of three separate NCXgenes is obscure. Brain cells, in particular neurons, contain large amounts of all three basic NCX isoforms and of their splice variants and are thus good models for study. In this research, their expression was investigated during the development of rat cerebellum and of cultured cerebellar granule neurons. The work has shown that Ca2+ and calcineurin are critical to the expression of the exchanger genes, supporting the idea that one of the major differences among the NCX genes is the regulation of their transcription. The pTM3 vector and the vvT7 virus were gifts from Dr. B. Moss (National Institutes of Health, Bethesda, MD). Cyclosporin A and FK506 were a kind gift of Dr. Mauro Zurini (Novartis, Basle, Switzerland). Dulbecco's modified Eagle medium (DMEM or DME/F12) and other tissue culture supplements were from Sigma or Life Technologies. Poly-l-lysine and 3-(4, 5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide were from Sigma. 45Ca2+, [α-32P]dCTP, and [14C]ATP were from Amersham Pharmacia Biotech. Nitrocellulose filters for Western blotting and Nytran for Northern blotting were from Schleicher & Schuell. Nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate and goat anti-rabbit alkaline phosphatase conjugate were from Promega (Madison, WI). Chemiluminescence substrates CDP-starTM and NitroblockII were from Tropix (Madison, WI). Oligonucleotides were purchased from MGW-Biotech (Ebersberg, Germany). Ampli-Taq Gold polymerase was from Perkin-Elmer. HeLa cells were cultured in Dulbecco's modified Eagle medium supplemented with 5–10% fetal calf serum and 50 μg/ml gentamicin in 5.5% CO2 at 37 °C. Transient expression of NCX1 was achieved by infecting cells with t7 polymerase containing vaccinia virus at a multiplicity of infection of 20 followed by transfection of the plasmid DNA (33.Iwata T. Galli C. Dainese P. Guerini D. Carafoli E. Cell Calcium. 1995; 17: 263-269Crossref PubMed Scopus (22) Google Scholar). Granule cells were dissociated from the cerebella of 7-day-old Wistar rats as described (34.Gallo V. Kingsbury A. Balázs R. Jørgensen O.S. J. Neurosci. 1987; 7: 2203-2213Crossref PubMed Google Scholar). They were plated in Dulbecco's modified Eagle medium (Hepes modification, Sigma) supplemented with heat-inactivated 10% fetal calf serum (Sigma), 100 μg/ml gentamicin, 7 μm p-aminobenzoic acid, 100 μg/ml pyruvate, and 100 microunits/ml insulin on poly-l-lysine-treated plates at a density of 2–3 × 105 cells/cm2 in the presence of 5.3 or 25 mm KCl. After 24 h, 10 μm cytosine arabinofuranoside was added to inhibit mitotic cell growth. Neuronal survival was estimated by measuring the amount of colored formazan in the cells by the reduction of 3-(4, 5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (35.Carmichael J. DeGraff W.G. Gazdar A.F. Minna J.D. Mitchell J.B. Cancer Res. 1987; 47: 943-946PubMed Google Scholar). The extent of contaminating astrocytes was estimated by immunocytochemistry using a monoclonal antibody specific for the glial fibrillary acidic protein (GFAP, Roche Molecular Biochemicals). Immunocytochemistry was performed as described earlier (36.Foletti D. Guerini D. Carafoli E. FASEB J. 1995; 9: 670-680Crossref PubMed Scopus (38) Google Scholar). Total RNA was prepared from granule cells according to the method of Chomczynski and Sacchi (37.Chomczynski P. Sacchi N. Anal. Biochem. 1987; 162: 156-159Crossref PubMed Scopus (63084) Google Scholar). cDNA was synthesized using a random primer (First-strand cDNA synthesis kit, Amersham Pharmacia Biotech) according to the manufacturer's protocol. PCR was performed using the following oligonucleotides: NCX1-F (rat NCX1, 1760–1782), atgttatcattccctataaaacc; NCX1-R (rat NCX1, 2117–2136), ctcctctttgctggtcagtg; NCX2-F (rat NCX2; 1453–1472), ctgcgtgtgggcgatgctc; NCX2-R (rat NCX2; 1965–1983), gacctcgaggcgacagttc; NCX3-F (rat NCX3, 2534–2555), gacagtagaaggaacagccaag; NCX3-R (rat NCX3; 2808–2828), tttagggtgttcacccaatac; G3PDH-F (rat G3PDH, 371–391), ccaaaaggggtcatcatctcc; G3PDH-R (rat G3PDH, 994–1015), gtaggccatgaggtccaccac; Fos-F (rat fos, 660–680), aagtctgcgttgcagaccgag; Fos-R (rat fos, 1040–1020), gtctgctgcatagaaggaacc; PMCA4CII (rat PMCA4CII, 3622–3647), gaggaggtgtaacggcagaag. The conditions for the PCR reactions were as suggested by Perkin-Elmer for the Taq Gold polymerase. The identity of the PCR-generated fragments was verified by sequencing. The G3PDH fragment encompassed cDNA nucleotides 371–1015 (38.Tso J.Y. Sun X.H. Kao T.H. Reece K.S. Wu R. Nucleic Acids Res. 1985; 13: 2485-2502Crossref PubMed Scopus (1759) Google Scholar). RNA was denatured by formaldehyde and formamide and fractionated on a 1% agarose gel containing 20 mm MOPS-NaOH, 8 mm sodium acetate, 1 mm EDTA, pH 7.0, and 6% formaldehyde. After separation, RNA was transferred to Nytran filters by capillary elution in 10× SSC buffer, prehybridized, and hybridized in 5× Denhardt's solution, 5× SSPE, 0.1% SDS, 0.1 mg/ml denatured salmon sperm DNA, 0.2–1 × 106 cpm/ml labeled DNA, and 50% formamide at 42 °C overnight. Nytran filters were washed in 0.1× SSC, 0.1% SDS twice at room temperature for 15 min, once at 55 °C for 30 min, and once at 65 °C for 20 min prior to the exposure to x-ray films or to PhosphorImager screens. The gel sample buffer contained 6m urea, 5% SDS, 4% dithiothreitol, 50 mmTris-HCl, pH 8.0, and 5 mm EDTA. After electrophoresis, proteins were blotted onto a nitrocellulose sheet (39.Towbin H. Staehlin T. Gordon J. Proc. Natl. Acad. Sci. U. S. A. 1979; 76: 4350-4354Crossref PubMed Scopus (44841) Google Scholar). The membrane was blocked at room temperature in Tris-buffered saline (25 mm Tris-HCl, 500 mm NaCl) with 3% gelatin and then incubated for 60–90 min with exchanger polyclonal antibodies (diluted 1/500 or as indicated) in TBST (Tris-buffered saline containing 0.05% Tween 20 and 1% gelatin). After three washes with TBST, the membrane was incubated with a secondary antibody conjugated to alkaline phosphatase (Promega) for 1 h followed by washing. The staining reaction was carried out either with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate according to the ProtoBlot System (Promega) or with chemiluminiscence substrate CDP-starTM (Tropix) according to the manufacturer's instructions. Granule cells were cultured under different conditions for 4 days at a density of 2.5 × 106 cells/well in a 6-well plate. The medium was replaced with methionine-free minimum essential medium supplemented with [35S]methionine (150 μCi/ml) and incubated overnight. The cells were rinsed with phosphate-buffered saline, and crude membrane proteins were prepared. The labeled cells (corresponding to about 5,000,000 cpm) were solubilized in 10 mm Tris-HCl, pH 8.0, 1 mm EDTA, 0.5% SDS. NET buffer (50 mmTris-HCl, pH 7.5, 150 mm NaCl, 0.25% gelatin, 0.1% Nonidet P-40, 1 mm EDTA) was added to dilute SDS to a final concentration of 0.2%. Triton X-100 and sodium deoxycholate were added to final concentrations of 0.3 and 0.5%, respectively. The mixture was incubated for 30 min at 4 °C. After centrifugation at 15,000 ×g, the supernatant was incubated with the primary antibody (5 μl of serum) at 4 °C on a rocking plate for at least 1 h. To recover the immunoprecipitates, protein A-coupled Sepharose CL-4B (20 μl pre-equilibrated in NET buffer) was added to the mixture and incubated at 4 °C for at least 30 min under gentle rocking. The protein A-Sepharose-primary antibody complex was recovered by centrifugation (1–2 min in a microcentrifuge) and washed four times with 20 volumes of NET buffer, twice with NPT buffer (50 mmTris-HCl, pH 7.5, 150 mm NaCl, 0.1% Nonidet P-40), and once with 50 mm Tris-HCl, pH 7.5, 150 mm NaCl. The material bound to protein A-Sepharose was released by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) sample buffer. The immunoprecipitates were analyzed by SDS-PAGE and exposed to a PhosphorImager plate or x-ray films. Cells were resuspended at a density of 5–10 × 106 cells/ml in 10 mmTris-HCl, pH 8.0, 1 mm EDTA, 5 μg/ml leupeptin, 5 μg/ml aprotinin, 5 μg/ml pepstatin, 75 μg/ml phenylmethylsulfonyl fluoride, and 1 mm dithiothreitol and subjected to three cycles of freeze-thaw. The particulate fraction was sedimented at 15,000 × g for 15 min. The resulting protein pellet was resuspended in 4 mm Tris-HCl, pH 8.0, 10% sucrose and frozen at −70 °C. Cerebella were dissected from rat brains and homogenized in 5 mm Tris-HCl, pH 7.5, 320 mmsucrose, 5 μg/ml each pepstatin, antipain, and leupeptin with a loose Potter homogenizer. A crude synaptosomal membrane fraction was obtained by centrifuging the post-nuclear supernatant at 12,000 ×g for 10 min at 4 °C. The supernatant was then centrifuged at 100,000 × g for 1 h at 4 °C. The material precipitated at 100,000 × g was defined as the microsomal fraction. Granule cells (1.25 × 106/well) were plated on poly-lysine-coated, 12-well plates and cultured in the presence of 25 mm KCl or 25 mm KCl and 100 nm FK506 for 7 days. The cells were washed twice with 140 mm NaCl, 2 mmMgCl2, 1 mm ouabain, 25 μmnystatin, 20 mm MOPS-Tris, pH 7.4, and incubated for 15 min in the same buffer at 37 °C. After two washes with 140 mm NaCl, 20 mm MOPS-Tris, pH 7.4, 2 mm MgCl2, Ca2+ uptake was initiated by overlaying the cells with a buffer containing 140 mmKCl, 50 μm CaCl2(45Ca2+ 2–4.106 cpm/ml), 1 mm ouabain, 20 mm MOPS-Tris, pH 7.4 (uptake buffer). Control experiments were carried out by substituting 140 mm NaCl for KCl in the uptake buffer. The reaction was stopped at different time intervals with a buffer containing 10 mm LaCl3, 100 mm MgCl2, 20 mm MOPS-Tris, pH 7.4. The amount of Ca2+taken up by the cells was determined after their lysis in 2% SDS, 10 mm Tris-HCl, pH 8.0. Portions of the NCX1 (amino acids 566–691 (3.Nicoll D.A. Longoni S. Philipson K.D. Science. 1990; 250: 562-565Crossref PubMed Scopus (627) Google Scholar)) and the NCX2 (amino acids 486–661 (30.Li Z. Matsuoka S. Hryshko L.V. Nicoll D.A. Bersohn M.M. Burke E.P. Lipton R.P. Philipson K.D. J. Biol. Chem. 1994; 269: 17434-17439Abstract Full Text PDF PubMed Google Scholar)) sequences located in the large cytosolic loop were chosen to raise isoform-specific antibodies (a portion of the sequence of NCX3 located in this region was also chosen). The corresponding cDNA fragments were amplified from rat brain RNA by RT-PCR using the following oligonucleotides: NCX1-F (1760–1782), atgttatcattccctataaaacc; NCX1-R (2117–2136), ctcctctttgctggtcagtg; NCX2-F (1453–1472), ctgcgtgtgggcgatgctc; NCX2-R (1965–1983), gacctcgaggcgacagttc. The fragments were cloned into the expression vector pRSET. The expression of the Histidine-tagged fusion peptides was performed according to the procedure suggested by Invitrogen (Leek, The Netherlands). The fusion proteins encompassed 36 amino acid residues deriving from the vector. The NCX1 and NCX2 peptides were purified on a nitrilo-triacetic acid (Ni2+-NTA) column under denaturing conditions, yielding highly purified products (>95% according to Coomassie Brilliant Blue-stained gels). The polypeptides were utilized to immunize rabbits, using standard procedures (40.Stauffer T. Guerini D. Carafoli E. J. Biol. Chem. 1995; 270: 12184-12190Abstract Full Text Full Text PDF PubMed Scopus (246) Google Scholar). The antibodies were affinity-purified on an antigen-coupled Sepharose column as described earlier (40.Stauffer T. Guerini D. Carafoli E. J. Biol. Chem. 1995; 270: 12184-12190Abstract Full Text Full Text PDF PubMed Scopus (246) Google Scholar). Antibodies specific for the NCX1 and NCX2 isoforms were prepared using peptides encompassing the region subjected to alternative splicing (Fig.1 A) as epitopes, because this region shows a low degree of sequence conservation in the three isoforms: The identity of the peptides was below 44% (Fig.1 B). Fig. 1 B also lists a peptide derived from the main loop of NCX3. It had been planned originally to generate antibodies specific for NCX3 as well, choosing for this purpose a domain of low sequence conservation; however, none of the injected rabbits produced an adequate NCX3 antiserum. The NCX1-specific antiserum recognized the exchanger in dog cardiac sarcolemma (bands at about 110, 160, and 70 kDa) or the NCX1 expressed in HeLa cells (Fig.1 C). These three bands are typical for NCX1; the 70-kDa band is a proteolytic product (33.Iwata T. Galli C. Dainese P. Guerini D. Carafoli E. Cell Calcium. 1995; 17: 263-269Crossref PubMed Scopus (22) Google Scholar), the 110-kDa band is the full-length protein, and the 160-kDa band is an internally locked variant of the exchanger that migrates with abnormal mobility (41.Santacruz-Tolosa L. Ottolia M. Nicoll D.A. Philipson K.D. J. Biol. Chem. 1999; 275: 182-188Abstract Full Text Full Text PDF Scopus (76) Google Scholar). The amount of the internally locked version of the exchanger varies with the preparation and cell type and was not visible in overexpressing cells; this may have been a consequence of a different membrane composition of Hela as compared with muscle cells. No exchanger-specific bands were recognized by the NCX2 antiserum in these membranes. The NCX2 affinity-purified antibodies recognized instead a strong band at 102 kDa, which was the expected mass of NCX2 in brain membranes. Further experiments showed a very good correlation between the amount of NCX2-specific mRNA and the 102-kDa immunoreactive band. Blots with the NCX1 and NCX2 peptides used to immunize the rabbits and with the peptide derived from NCX3 indicated that the reaction of the NCX1 and NCX2 antibodies was isoform-specific (not shown), i.e. none of them recognized NCX3. Analysis of the cerebellum from developing rats showed that the expression of NCX2 increased markedly during post-natal development, whereas only slight changes were observed for NCX1 (Fig.2 A). To simplify the study, experiments were then performed on cultured granule cells. Under appropriate conditions, these cells survive for a relatively long time, and their cultures contain more than 95% neurons (Fig. 2 B). In the presence of physiological concentrations of KCl (5.3 mm), the cells matured to full neurons, but their numbers steadily decreased during the first days of culture, with only a few surviving after 7 days (Fig. 2 B, top). The experiment in Fig. 2 C shows that, in analogy to what was observed in whole cerebellum, the NCX2 protein became strongly up-regulated during the first days in culture in the 5.3 mm KCl medium. By contrast, as had been the case for the cerebellum, no evident changes were observed in the expression of NCX1. The long-term survival of granule cells in culture requires the chronic depolarization of the plasma membrane by higher concentrations of KCl (Fig. 2 B, bottom) (34.Gallo V. Kingsbury A. Balázs R. Jørgensen O.S. J. Neurosci. 1987; 7: 2203-2213Crossref PubMed Google Scholar, 42.Guerini D. Garcia Martin E. Zecca A. Guidi F. Carafoli E. Acta Physiol. Scand. Suppl. 1998; 643: 265-273PubMed Google Scholar). Recent studies have shown that under these conditions the expression of some of the Ca2+ transporting proteins, specifically, plasma membrane Ca2+ pumps and plasma membrane and internal Ca2+ channels, underwent significant changes (43.Bessho Y. Nawa H. Nakanishi S. Neuron. 1994; 12: 87-95Abstract Full Text PDF PubMed Scopus (151) Google Scholar, 44.Genazzani A.A. Carafoli E. Guerini D. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 5797-5801Crossref PubMed Scopus (154) Google Scholar, 45.Guerini D. Garcia Martin E. Gerber A. Volbracht C. Leist M. Merino C.G. Carafoli E. J. Biol. Chem. 1999; 274: 1667-1676Abstract Full Text Full Text PDF PubMed Scopus (97) Google Scholar). As preliminarily indicated in a recent review (46.Carafoli E. Genazzani A. Guerini D. Biochem. Biophys. Res. Commun. 1999; 266 (623): 624Crossref PubMed Scopus (66) Google Scholar), the Na+/Ca2+ exchanger was also affected by these conditions. Fig. 2D shows that a drastic reduction of the NCX2 protein occurred; After 5 days in 25 mm KCl, hardly any of the protein could be detected (Fig. 2 D), whereas only marginal effects were observed for NCX1. The expression of NCX2 was very sensitive to the depolarizing treatment; an increase of KCl in the medium from 5.3 to 15 mm was sufficient to almost completely down-regulate it (Fig. 2 E). RT-PCR with isoform-specific oligonucleotides was used to detect NCXtranscripts, in particular their alternatively spliced variants (20.Kofuji P. Lederer W.J. Schulze D.H. J. Biol. Chem. 1994; 269: 5145-5149Abstract Full Text PDF PubMed Google Scholar,47.Quednau B.D. Nicoll D.A. Philipson K.D. Am. J. Physiol. 1997; 272: C1250-C1261Crossref PubMed Google Scholar). In the case of NCX1, sequencing demonstrated that seven different splice isoforms were present after 3 days of culturing in non-depolarizing KCl concentrations (Fig.3 A, lane M). In the case ofNCX1, up to four different PCR fragments were visible in gels (Fig. 3, lane 1). In both the cerebellum and the cells, the AD spliced variant was predominant (Fig. 3 A, comparelanes 1–4 with lanes 5 and 6). In cells cultured in 25 mm KCl for 3 to 5 days, the amounts of the AD and ADF isoforms increased, and this increase was accompanied by the disappearance of the larger variants (Fig. 3 A). At variance with NCX1, the RT-PCR experiment revealed a large, depolarization-dependent down-regulation of theNCX2 transcript (Fig. 3 B1), which was confirmed by Northern blotting (Fig. 3 C). In contrast, the NCX3transcript became up-regulated by the depolarizing conditions (Fig. 3 B2). The depolarization of granule cells by 25 mm KCl causes a sustained, albeit limited, increase of intracellular Ca2+ (45.Guerini D. Garcia Martin E. Gerber A. Volbracht C. Leist M. Merino C.G. Carafoli E. J. Biol. Chem. 1999; 274: 1667-1676Abstract Full Text Full Text PDF PubMed Scopus (97) Google Scholar). This is because of the increased potential across the neuronal plasma membrane (from −70 to −40 mV) and the consequent opening of voltage-dependent Ca2+ channels. After 5 days in culture, the increase was about 3-fold (from about 50 to about 150 nm). Two experiments were carried out to verify whether the depolarization effects on NCX2 expression were the direct results of the increased Ca2+ influx. Cells were incubated in the presence of the L-type channel agonist BayK 8644 (Fig.4 A), or the influx of Ca2+ was increased by manipulating the extracellular calcium concentration (Fig. 4 B). The agonist failed to influence the level of NCX2 protein at the physiological concentration of KCl (5.3 mm) but reproducibly reduced its level when the KCl concentration in the culturing medium was raised to 10 mm (Fig. 4 A). Under these conditions, no effect on the level of NCX1 protein was observed. Similarly, increasing the extracellular concentration of Ca2+ had a dramatic effect on the expression of NCX2 even at non-depolarizing KCl concentrations. When the extracellular Ca2+ concentration was raised to 3.6 mm, the level of NCX2 protein decreased very markedly, even in 5.3 m KCl, and disappeared almost completely at 5 mm Ca2+ (Fig. 4 B). Again, the effect was specific for NCX2, i.e. it was not observed with NCX1. Prior to investigating the role of calcineurin, attempts were made to establish whether the Ca2+ effects on NCX2 expression could be mediated by calmodulin kinases. Unfortunately, the most widely used inhibitors of these enzymes, among them KN-92 and KN-93, proved highly toxic to granule cells, i.e. the great majority of the cells died after a few hours of incubation with these inhibitors. The time of survival was too short to reliably explore a possible function of calmodulin kinases. To investigate the possible involvement of the Ca2+-calmodulin-stimulated phosphatase, calcineurin experiments were carried o" @default.
• W2089063033 created "2016-06-24" @default.
• W2089063033 creator A5010030643 @default.
• W2089063033 creator A5049476793 @default.
• W2089063033 creator A5075889094 @default.
• W2089063033 date "2000-07-01" @default.
• W2089063033 modified "2023-10-10" @default.
• W2089063033 title "Calcineurin Controls the Transcription of Na+/Ca2+ Exchanger Isoforms in Developing Cerebellar Neurons" @default.
• W2089063033 cites W1493817377 @default.
• W2089063033 cites W1496297920 @default.
• W2089063033 cites W1507203601 @default.
• W2089063033 cites W1509963147 @default.
• W2089063033 cites W1513222164 @default.
• W2089063033 cites W1550032915 @default.
• W2089063033 cites W1562796888 @default.
• W2089063033 cites W1588036636 @default.
• W2089063033 cites W1589672361 @default.
• W2089063033 cites W1919966300 @default.
• W2089063033 cites W1953600165 @default.
• W2089063033 cites W1966880718 @default.
• W2089063033 cites W1977810408 @default.
• W2089063033 cites W1980830385 @default.
• W2089063033 cites W1990678233 @default.
• W2089063033 cites W1991163286 @default.
• W2089063033 cites W1991518355 @default.
• W2089063033 cites W1994047269 @default.
• W2089063033 cites W1997261857 @default.
• W2089063033 cites W1997677285 @default.
• W2089063033 cites W1998156255 @default.
• W2089063033 cites W2005597217 @default.
• W2089063033 cites W2007346353 @default.
• W2089063033 cites W2014034794 @default.
• W2089063033 cites W2017763545 @default.
• W2089063033 cites W2026696517 @default.
• W2089063033 cites W2032475687 @default.
• W2089063033 cites W2043138277 @default.
• W2089063033 cites W2046924202 @default.
• W2089063033 cites W2049134173 @default.
• W2089063033 cites W2049299592 @default.
• W2089063033 cites W2050785330 @default.
• W2089063033 cites W2059201211 @default.
• W2089063033 cites W2060053293 @default.
• W2089063033 cites W2063577168 @default.
• W2089063033 cites W2067334833 @default.
• W2089063033 cites W2068615953 @default.
• W2089063033 cites W2077097199 @default.
• W2089063033 cites W2077870164 @default.
• W2089063033 cites W2088264073 @default.
• W2089063033 cites W2091258587 @default.
• W2089063033 cites W2092473345 @default.
• W2089063033 cites W2101108802 @default.
• W2089063033 cites W2119811365 @default.
• W2089063033 cites W2139909492 @default.
• W2089063033 cites W2140856582 @default.
• W2089063033 cites W2151444391 @default.
• W2089063033 cites W2188376552 @default.
• W2089063033 cites W2340062477 @default.
• W2089063033 cites W2410925128 @default.
• W2089063033 cites W2413247909 @default.
• W2089063033 cites W4294216491 @default.
• W2089063033 cites W2079701474 @default.
• W2089063033 doi "https://doi.org/10.1074/jbc.m000995200" @default.
• W2089063033 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/10767288" @default.
• W2089063033 hasPublicationYear "2000" @default.
• W2089063033 type Work @default.
• W2089063033 sameAs 2089063033 @default.
• W2089063033 citedByCount "90" @default.
• W2089063033 countsByYear W20890630332012 @default.
• W2089063033 countsByYear W20890630332013 @default.
• W2089063033 countsByYear W20890630332014 @default.
• W2089063033 countsByYear W20890630332015 @default.
• W2089063033 countsByYear W20890630332016 @default.
• W2089063033 countsByYear W20890630332017 @default.
• W2089063033 countsByYear W20890630332018 @default.
• W2089063033 countsByYear W20890630332022 @default.
• W2089063033 crossrefType "journal-article" @default.
• W2089063033 hasAuthorship W2089063033A5010030643 @default.
• W2089063033 hasAuthorship W2089063033A5049476793 @default.
• W2089063033 hasAuthorship W2089063033A5075889094 @default.
• W2089063033 hasBestOaLocation W20890630331 @default.
• W2089063033 hasConcept C104317684 @default.
• W2089063033 hasConcept C126322002 @default.
• W2089063033 hasConcept C128057223 @default.
• W2089063033 hasConcept C138885662 @default.
• W2089063033 hasConcept C169760540 @default.
• W2089063033 hasConcept C179926584 @default.
• W2089063033 hasConcept C185592680 @default.
• W2089063033 hasConcept C2911091166 @default.
• W2089063033 hasConcept C41895202 @default.
• W2089063033 hasConcept C53345823 @default.
• W2089063033 hasConcept C55493867 @default.
• W2089063033 hasConcept C71924100 @default.
• W2089063033 hasConcept C86339819 @default.
• W2089063033 hasConcept C86803240 @default.
• W2089063033 hasConcept C95444343 @default.
• W2089063033 hasConceptScore W2089063033C104317684 @default.
• W2089063033 hasConceptScore W2089063033C126322002 @default.
• W2089063033 hasConceptScore W2089063033C128057223 @default.

• next