FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2090313936> ?p ?o ?g. }

• W2090313936 endingPage "24565" @default.
• W2090313936 startingPage "24553" @default.
• W2090313936 abstract "Although we have previously demonstrated the functional significance of excitatory amino acid transporters as well as glutamate (Glu) receptors (GluRs) expressed by chondrocytes, little attention has been paid to the possible expression of the cystine/Glu antiporter responsible for the bi-directional transmembrane transport of Glu in chondrocytes to date. In organotypic cultured mouse embryonic metatarsals isolated before vascularization, the chondral mineralization was significantly decreased in the presence of Glu at a high concentration. Apoptotic cells were detected within the late proliferating and prehypertrophic chondrocytic layers in metatarsals cultured in the presence of Glu. A group III metabotropic GluR (mGluR) antagonist partially, but significantly, prevented the inhibition of mineralization by Glu in metatarsals without affecting the number of apoptotic cells. Both decreased mineralization and apoptosis by Glu were significantly prevented by the addition of the cystine/Glu antiporter inhibitor homocysteic acid, as well as reduced glutathione (GSH) and cystine. Expression of mRNA for xCT and 4F2hc subunits, which are components of the cystine/Glu antiporter, was seen in both cultured mouse metatarsals and rat costal chondrocytes. In chondrocytes cultured with Glu, a significant decrease was seen in intracellular GSH levels, together with increases in the number of apoptotic cells and the level of intracellular reactive oxygen species. These results suggest that Glu could regulate chondrogenic differentiation toward mineralization through a mechanism associated with apoptosis mediated by the depletion of intracellular GSH after the retrograde operation of the cystine/Glu antiporter, in addition to the activation of group III mGluR, in chondrocytes. Although we have previously demonstrated the functional significance of excitatory amino acid transporters as well as glutamate (Glu) receptors (GluRs) expressed by chondrocytes, little attention has been paid to the possible expression of the cystine/Glu antiporter responsible for the bi-directional transmembrane transport of Glu in chondrocytes to date. In organotypic cultured mouse embryonic metatarsals isolated before vascularization, the chondral mineralization was significantly decreased in the presence of Glu at a high concentration. Apoptotic cells were detected within the late proliferating and prehypertrophic chondrocytic layers in metatarsals cultured in the presence of Glu. A group III metabotropic GluR (mGluR) antagonist partially, but significantly, prevented the inhibition of mineralization by Glu in metatarsals without affecting the number of apoptotic cells. Both decreased mineralization and apoptosis by Glu were significantly prevented by the addition of the cystine/Glu antiporter inhibitor homocysteic acid, as well as reduced glutathione (GSH) and cystine. Expression of mRNA for xCT and 4F2hc subunits, which are components of the cystine/Glu antiporter, was seen in both cultured mouse metatarsals and rat costal chondrocytes. In chondrocytes cultured with Glu, a significant decrease was seen in intracellular GSH levels, together with increases in the number of apoptotic cells and the level of intracellular reactive oxygen species. These results suggest that Glu could regulate chondrogenic differentiation toward mineralization through a mechanism associated with apoptosis mediated by the depletion of intracellular GSH after the retrograde operation of the cystine/Glu antiporter, in addition to the activation of group III mGluR, in chondrocytes. In the vertebrate central nervous system, glutamate (Glu) is one of the most abundant free amino acids with a neurotransmitter role involving signaling machineries that include Glu receptors (GluRs) 3The abbreviations used are: GluR, Glu receptor; ALP, alkaline phosphatase; AMPA, dl-α-amino-3-hydroxy-5-methylisoxasole-4-propionate; CPPG, (R,S)-α-cyclopropyl-4-phosphonophenylglycine; DCFDA, dihydrodichlorofluorescein diacetate; EAAT, excitatory amino acid transporter; l-AP4, l-(1)-2-amino-4-phosphonobutyrate; mGluR, metabotropic GluR; OA, osteoarthritis; PTH, parathyroid hormone; RA, rheumatoid arthritis; ROS, reactive oxygen species; runx2, runt-related gene 2; TUNEL, terminal deoxynucleotidyl transferase deoxyuridine triphosphate nick end labeling; DMEM, Dulbecco's modified Eagle's medium; MEM, minimal essential medium; RT, reverse transcriptase; OA, osteoarthritis; PBS, phosphate-buffered saline; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide. 3The abbreviations used are: GluR, Glu receptor; ALP, alkaline phosphatase; AMPA, dl-α-amino-3-hydroxy-5-methylisoxasole-4-propionate; CPPG, (R,S)-α-cyclopropyl-4-phosphonophenylglycine; DCFDA, dihydrodichlorofluorescein diacetate; EAAT, excitatory amino acid transporter; l-AP4, l-(1)-2-amino-4-phosphonobutyrate; mGluR, metabotropic GluR; OA, osteoarthritis; PTH, parathyroid hormone; RA, rheumatoid arthritis; ROS, reactive oxygen species; runx2, runt-related gene 2; TUNEL, terminal deoxynucleotidyl transferase deoxyuridine triphosphate nick end labeling; DMEM, Dulbecco's modified Eagle's medium; MEM, minimal essential medium; RT, reverse transcriptase; OA, osteoarthritis; PBS, phosphate-buffered saline; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide. and Glu transporters (1Hollmann M. O'Shea-Greenfield A. Rogers S.W. Heinemann S. Nature. 1989; 342: 643-648Crossref PubMed Scopus (774) Google Scholar, 2Yoneda Y. Kuramoto N. Kitayama T. Hinoi E. Prog. Neurobiol. 2001; 63: 697-719Crossref PubMed Scopus (57) Google Scholar). In the glutamatergic synapses, Glu is condensed into synaptic vesicles through vesicular Glu transporters for subsequent exocytotic release into synaptic clefts upon stimulation. Glutamate is supposed to mediate the excitatory neurotransmission through GluRs categorized into two major groups. One is ionotropic Glu-gated ion channels (iGluRs) that are further classified into dl-α-amino-3-hydroxy-5-methylisoxasole-4-propionate (AMPA), kainite, and N-methyl-d-aspartate subtypes, whereas the other is G-protein-coupled metabotropic receptors (mGluRs) classified into the three different subtypes, group I (mGluR1 and mGluR5), group II (mGluR2 and mGluR3), and group III (mGluR4, mGluR6, mGluR7, and mGluR8) (1Hollmann M. O'Shea-Greenfield A. Rogers S.W. Heinemann S. Nature. 1989; 342: 643-648Crossref PubMed Scopus (774) Google Scholar, 2Yoneda Y. Kuramoto N. Kitayama T. Hinoi E. Prog. Neurobiol. 2001; 63: 697-719Crossref PubMed Scopus (57) Google Scholar). The group I subtype stimulates the hydrolysis of membrane phospholipids in association with Gq/11 protein, whereas both the group II and III subtypes inhibit the formation of cAMP with the aid of Gi/o protein.However, several independent lines of evidence indicate that Glu may act as a “cytokine” rather than a “neurotransmitter” to affect a variety of cellular activities in different tissues (3Skerry T.M. Genever P.G. Trends Pharmacol. Sci. 2001; 22: 174-181Abstract Full Text Full Text PDF PubMed Scopus (264) Google Scholar, 4Hinoi E. Takarada T. Ueshima T. Tsuchihashi Y. Yoneda Y. Eur. J. Biochem. 2004; 271: 1-13Crossref PubMed Scopus (180) Google Scholar). For example, recent studies have shown that Glu may be one of the endogenous paracrine (autocrine) factors used for intercellular communications through particular GluRs in cartilage (5Wang L. Hinoi E. Takemori A. Yoneda Y. Biol. Pharm. Bull. 2005; 28: 990-993Crossref PubMed Scopus (24) Google Scholar, 6Wang L. Hinoi E. Takemori A. Takarada T. Yoneda Y. Br. J. Pharmacol. 2005; 146: 732-743Crossref PubMed Scopus (34) Google Scholar, 7Hinoi E. Wang L. Takemori A. Yoneda Y. Biochem. Pharmacol. 2005; 70: 70-81Crossref PubMed Scopus (27) Google Scholar) and bone (8Chenu C. Serre C.M. Raynal C. Burt-pichat B. Delmas P.D. Bone. 1998; 22: 295-299Crossref PubMed Scopus (204) Google Scholar, 9Genever P.G. Skerry T.M. FASEB J. 2001; 15: 1586-1588Crossref PubMed Scopus (76) Google Scholar). In cultured rat costal chondrocytes where constitutive expression is seen with mRNA for the GluR3 subunit of the iGluR subtype AMPA receptors, the addition of AMPA markedly stimulates the release of endogenous Glu in a Ca2+-dependent manner (5Wang L. Hinoi E. Takemori A. Yoneda Y. Biol. Pharm. Bull. 2005; 28: 990-993Crossref PubMed Scopus (24) Google Scholar). Moreover, in cultured mouse embryonic metatarsals isolated before vascularization, chondral mineralization was almost completely abolished in the presence of the group III mGluR agonist l-(1)-2-amino-4-phosphonobutyrate (l-AP4) in a manner sensitive to an antagonist, without inducing any apoptotic cell death (6Wang L. Hinoi E. Takemori A. Takarada T. Yoneda Y. Br. J. Pharmacol. 2005; 146: 732-743Crossref PubMed Scopus (34) Google Scholar).On the other hand, Glu transporters are required for the termination of signal transduction mediated by Glu as well as for the prevention of neurotoxicity mediated by this endogenous excitotoxin in the central nervous system. These Glu transporters are classified into 5 different isoforms, including Glu aspartate transporter (EAAT1; excitatory amino acid transporter 1), Glu transporter-1 (EAAT2), excitatory amino acid carrier 1 (EAAT3), EAAT4 and EAAT5 so far (10Danbolt N.C. Prog. Neurobiol. 2001; 65: 1-105Crossref PubMed Scopus (3710) Google Scholar, 11Storck T. Schulte S. Hofmann K. Stoffel W. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 10955-10959Crossref PubMed Scopus (1092) Google Scholar). In addition to these Glu transporters, the sodium-independent and chloride-dependent high affinity Glu uptake carrier, cystine/Glu antiporter, has been identified in a variety of tissues (12Bannai S. J. Biol. Chem. 1986; 261: 2256-2263Abstract Full Text PDF PubMed Google Scholar, 13Sato H. Tamba M. Ishii T. Bannai S. J. Biol. Chem. 1999; 274: 11455-11458Abstract Full Text Full Text PDF PubMed Scopus (711) Google Scholar). This antiporter is a heterodimeric complex between the ubiquitous CD98 heavy chain, also referred to as 4F2hc, and the xCT light chain responsible for the determination of substrate specificity. The view that extracellular cystine is incorporated into the cytoplasm through the bi-directional cystine/Glu antiporter as a substrate for the biosynthesis of intracellular glutathione (GSH) is prevailing (14Kato S. Negishi K. Mawatari K. Kuo C.H. Neuroscience. 1992; 48: 903-914Crossref PubMed Scopus (122) Google Scholar, 15Sato H. Fujiwara K. Sagara J. Bannai S. Biochem. J. 1995; 310: 547-551Crossref PubMed Scopus (100) Google Scholar). Although we have demonstrated that extracellular Glu could be brought into intracellular locations through particular EAAT isoforms expressed by the rodent chondrocytes (7Hinoi E. Wang L. Takemori A. Yoneda Y. Biochem. Pharmacol. 2005; 70: 70-81Crossref PubMed Scopus (27) Google Scholar), little attention has been paid to the possible expression and functionality of the cystine/Glu antiporter in chondrocytes.In this study we have investigated the role of the cystine/Glu antiporter in chondral differentiation and cell survival in cultures of primary chondrocytes, prepared from adult rat costicartilage, and in murine embryonic metatarsals, isolated before vascularization. In these systems, cells differentiate from resting to proliferating, prehypertrophic, hypertrophic, and calcified chondrocytes without the involvement of osteoblasts, osteoclasts, and capillary invasion (16Klement B.J. Spooner B.S. J. Exp. Zool. 1993; 265: 285-294Crossref PubMed Scopus (14) Google Scholar, 17MacLean H.E. Guo J. Knight M.C. Zhang P. Cobrinik D. Kronenberg H.M. J. Clin. Investig. 2004; 113: 1334-1343Crossref PubMed Scopus (73) Google Scholar).EXPERIMENTAL PROCEDURESMaterials—A Quickprep Micro mRNA Purification Kit, a First-strand cDNA Synthesis kit, and a DYEnamic ET Terminator Cycle Sequencing Kit were purchased from Amersham Biosciences, and a Protein Assay Kit was purchased from Bio-Rad. Rabbit polyclonal antibody against the xCT subunit was from TransGenic (Kumamoto, Japan) and an anti-rabbit IgG antibody was supplied by DAKO A/S (Glostrup Denmark). An In Situ Cell Death Detection Kit was purchased from Roche Diagnostics GmbH and Taq DNA polymerase was obtained from Takara (Tokyo, Japan). (RS)-α-Cyclopropyl-4-phosphonophenylglycine (CPPG) was supplied by Tocris Cookson (Bristol, United Kingdom). DMEM and MEM were purchased from Invitrogen. Total Glutathione Quantification Kit was obtained from Dojindo (Osaka, Japan). Dihydrodichlorofluorescein diacetate (DCFDA) was provided by Molecular Probes. Other chemicals used were all of the highest purity commercially available.Embryonic Metatarsal Rudiment Organ Culture—The three central metatarsal rudiments were isolated from ddY mice embryos at 15.5 days post-gestation. Each of three metatarsals was individually placed in a well of a 24-well plate containing 1 ml of organ culture medium: MEM supplemented with 50 μg/ml ascorbic acid, 1 mm β-glycerophosphate, and 0.25% fetal bovine serum in either the presence or absence of different agents. These explants were grown at 37 °C in a humidified 5% CO2 incubator for 5 days unless otherwise indicated. On the day of the experiments, the total length of each bone rudiment and the length of each middle mineralized part determined by alizarin red staining, were measured for subsequent calculation of the mineralization ratios based on the length under an Olympus IMT-2-21 dissecting microscope. Similar results were obtained when mineralization ratios were calculated based on the areas in place of the lengths.Histological Analysis—On day 5 cultured metatarsal rudiments were harvested and fixed with 10% formalin neutral buffer solution, followed by the decalcification with 20% EDTA and subsequent immersion in 30% sucrose overnight at 4 °C. Metatarsals were then dissected for sections with a thickness of 5 μm in a cryostat for histological analyses. Sections were stained with alizarin red, hematoxylin and eosin, and Alcian blue under standard procedures, respectively. The activity of alkaline phosphatase (ALP) was determined by the enzymatic histochemistry. In brief, mounted sections were preserved in PBS at room temperature, and then staining was developed by the incubation in ALP buffer (0.01 m Tris-HCl (pH 9.5), 0.1 m NaCl, 0.05 m MgCl2) supplemented with 100-fold diluted solution of nitro blue tetrazolium chloride/5-bromo-4-chloro-3-indolyl phosphate as a substrate for ALP for 1.5 h at 37 °C, followed by several rinses in phosphate buffer. Sections were finally mounted in 50% glycerol, and photographs of sections were taken using an Olympus microscope.Terminal Deoxynucleotidyl Transferase Deoxyuridine Triphosphate Nick End Labeling (TUNEL) Assay—TUNEL staining was performed to detect apoptotic cells based on labeling of DNA strand breaks. Metatarsals cultured for 5 days were fixed with 10% formalin neutral buffer solution, followed by the decalcification with 20% EDTA and subsequent immersion in 30% sucrose overnight at 4 °C. Metatarsals were then dissected for frozen sections with a thickness of 5 μm in a cryostat. Mounted sections of metatarsals were then subjected to the TUNEL assay with a TUNEL detection kit according to the manufacturer's instructions.In Situ Hybridization Analysis—On day 5 cultured metatarsal rudiments were harvested, followed by the fixation with 10% formalin and subsequent decalcification with 20% EDTA for in situ hybridization as previously described (6Wang L. Hinoi E. Takemori A. Takarada T. Yoneda Y. Br. J. Pharmacol. 2005; 146: 732-743Crossref PubMed Scopus (34) Google Scholar). In brief, tibiae were dissected for frozen sections with a thickness of 5 μm in a cryostat. Sections mounted on slide glasses were fixed with 4% paraformaldehyde, and successively treated with 0.2 m HCl and 10 μg/ml proteinase K. Sections were then subjected to the acetylation in 0.1 m triethanolamine, 0.25% acetic anhydride. After pre-hybridization, sections were covered with digoxigenin-labeled cRNA probes at 65 °C for 16 h. Sections were then washed, and treated with 4 μg/ml RNase A. Sections were then incubated with anti-digoxigenin-AP Fab fragments at 4 °C for 16 h. After being washed, sections were treated with nitro blue tetrazolium chloride/5-bromo-4-chloro-3-indolyl phosphate for different periods.Determination of Intracellular Reactive Oxygen Species (ROS)—The estimation of intracellular ROS was done using DCFDA as a probe as described previously (18Moriguchi N. Hinoi E. Tsuchihashi Y. Fujimori S. Iemata M. Takarada T. Yoneda Y. Histol. Histopathol. 2006; 21: 969-977PubMed Google Scholar). Chondrocytes were cultured for 5 days, followed by the addition of 1 mm Glu 12 h before the end of culturing. Moreover, metatarsals cultured in the presence of 1 mm Glu for 5 days were also used as samples. Samples were rinsed with PBS twice and then incubated in respective serum-free media containing 10 μm DCFDA at 37 °C for 30 min in a 5% CO2 incubator. In principle, DCFDA diffuses readily into cells, followed by the hydrolysis of ester groups by intracellular esterases and subsequent release of the dichloro derivative. This derivative is then oxidized to the fluorescent parent dye by intracellular ROS. Cells or metatarsals were then washed with PBS twice, followed by the determination of intracellular ROS under a confocal laser-scanning microscope (LSM 510; Carl Zeiss) with excitation at 485 nm and emission at 525 nm, respectively.RT-PCR Analysis—cDNA was synthesized with the oligo(dT) primer and reverse transcriptase from extracted total RNA. PCR amplification was performed using specific primers (Table 1), and PCR products were subcloned into a TA cloning vector for the determination of DNA sequences by ABI Prism 310 Genetic Analyzer (PerkinElmer Life Sciences) using a cycle sequencing kit. Semi-quantitative PCR analyses were performed below 30 cycles, where a linear response was achieved, using primers for the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase.TABLE 1Primers used for detection of cystine/Glu antiporter subunits and chondral markersGenesUpstream (5′-3′)Downstream (5′-3′)Estimated base pairMarkers collagen IIGGAAAGTCTGGGGAAAGAGGCAGTCCCTGGGTTACCAGAA457 sox9AGGAAGCTGGCAGACCAGTACCCTCTCGCTTCAGATCAAC407 runx2CGCATTCCTCATCCCAGTATTATGGAGTGCTGCTGGTCTG581 aggrecanCTTTCCTGCAGAAGTCACACATCCTCTACTCCAGAG1872 PPARγTATGGAGTTCATGCTTGTGACGGGAAGGACTTTATGTATG315 GAPDHGGTGAAGGTCGGTGTGAACGGATTGATGCCAAAGTTGTCATGGATGACC502Antiporters xCTCCTGGCATTTGGACGCTACATTCAGAATTGCTGTGAGCTTGC182 4F2hcCTCCCAGGAAGATTTTAAAGACCTTCTTTCATTTTGGTGGCTACAATGTCAG141 Open table in a new tab Immunohistochemistry—Sections were prepared from tibia of newborn mice at 1 day after birth (P1), fixed with 4% paraformaldehyde in PBS for 20 min, washed with PBS, treated with 0.3% hydrogen peroxide (H2O2) in methanol for 30 min, and washed with 70% ethanol for 5 min, respectively. After being washed with PBS, sections were subjected to blocking with PBS containing normal goat serum or bovine serum albumin and 0.1% Triton X-100 at room temperature for 1 h. Sections were then reacted with an antibody against xCT diluted with the same blocking buffer at room temperature overnight, followed by the reaction with a biotinylated anti-rabbit IgG antibody at room temperature for 30 min and subsequent incubation with VECTASTAIN Elite ABC Reagent at room temperature for 1 h. Finally, immunostaining was done using 0.05% diaminobenzidine and 0.03% H2O2. Simultaneous experiments were done in the absence of the primary antibody to confirm the expression of the respective immunoreactive proteins.Primary Culture of Rat Costal Chondrocytes—Cartilages were isolated from adult female Wistar rat ribs, followed by the incubation at 37 °C for 10 min in calcium- and magnesium-free PBS containing 0.1% EDTA and subsequent digestion with collagenase in DMEM at 37 °C for 2.5 h. Cells were collected in DMEM containing 10% fetal bovine serum and antibiotics, and then centrifuged at 500 × g for 5 min. The pellets were suspended in DMEM containing 10% fetal bovine serum. Cells were plated at a density of 4 × 104 cells/cm2, followed by culturing at 37 °C under 5% CO2 for additional 6 days. Culture medium was exchanged to DMEM supplemented with 10% fetal bovine serum and 50 μg/ml ascorbic acid for subsequent cultivation for different periods of up to 28 days. Medium was changed every 2 to 3 days.Alcian Blue Staining—Chondrocytes were placed in 24-well plates and cultured for different periods of time up to 21 days. Cells were rinsed with PBS twice and then stained for 30 min with 1% Alcian blue 8GS dissolved in 3% acetic acid. Cells were washed with 3% acetic acid for 30 s three times, and then stained cells were dissolved in 0.1% SDS for subsequent quantification of the absorbance at 650 nm.Determination of ALP Activity—Chondrocytes were placed at a density of 4 × 104 cells/cm2 in 24-well plates and cultured for different periods of up to 28 days. Cells were washed twice with cold PBS, and then sonicated in 0.1 m Tris-HCl buffer (pH 7.5) containing 0.1% Triton X-100. Assay buffer composed of 0.05 m 2-amino-2-methylpropanol, 2 mm MgCl2, and 10 mm p-nitrophenylphosphoric acid was added at a volume of 200 μl into 10-μl cell suspensions, followed by the reaction for 30 min at 37 °C and subsequent immediate determination of the absorbance of p-nitrophenol at 405 nm.Cell Viability—Cell survival analysis was performed by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide (MTT) reduction assay to access the mitochondrial activity. Cultured chondrocytes were washed once with PBS and incubated with 0.5 mg/ml MTT in PBS for 1 h at 37 °C, followed by the addition of 0.04 m HCl in isopropyl alcohol to the well and subsequent shaking of the mixture for 10 min to dissolve the formazan. The dissolved suspension was subjected to an enzyme-linked immunosorbent assay reader and the absorbance at a wave-length of 550 nm was measured.Hoechst Staining—Chondrocytes were placed in 24-well plates and cultured for a period of up to 3 days, followed by the addition of Glu 48 h before the end of culturing. Cells were rinsed with PBS twice and then stained for 15 min with 10 μg/ml Hoechst 33342 dissolved in DMEM. Cells were cultured with DMEM, and then observed with an Olympus IMT-2-21 dissecting microscope.Determination of Intracellular Total GSH—Cells were rinsed with PBS twice, and then collected in 500 μl of PBS. One hundred μl of cell suspension was next treated with 5 μl of 10% 5-sulfosalicylic acid and homogenized at 4 °C, followed by centrifugation at 20,000 × g for 10 min. The supernatant fractions were analyzed with a total glutathione quantification kit according to the manufacturer's instructions.Data Analysis—Results are all expressed as the mean ± S.E. and the statistical significance was determined by the two-tailed and unpaired Student's t test or the one-way analysis of variance with Bonferroni/Dunnett post hoc test.RESULTSEffects of Glu on Chondral Mineralization in Cultured Mouse Metatarsals—To evaluate the possible role of Glu in cartilage, metatarsals before vascularization were isolated from embryonic mice at 15.5 days after gestation and cultured in either the presence or absence of Glu at a concentration range from 1 to 1,000 μm for 5 consecutive days, followed by alizarin red staining and subsequent measurement of the total length and the mineralization ratio of rudiments. Sustained exposure to Glu at a concentration of over 500 μm markedly decreased the length of middle mineralized parts in cultured metatarsal without profoundly affecting the total length of cartilage rudiments when determined by phase-contrast microscopy (Fig. 1a, upper panel) and alizarin red staining (Fig. 1a, lower panel). Quantitative analysis confirmed a significant decrease in the mineralization ratio, with the total length being unchanged, following sustained exposure to Glu at concentrations above 500 μm for 5 days (Fig. 1b). To next investigate the possible involvement of particular EAAT isoforms in the chondral mineralization, mouse metatarsals were cultured in either the presence or absence of different EAAT substrates for 5 days, followed by measurement of the total length and the mineralization ratio. No significant inhibition was seen in either the mineralization ratio (Fig. 1c, upper panel) or the total length (Fig. 1c, lower panel) in metatarsals cultured in the presence of d-aspartate, l-aspartate, or d-Glu at 500 μm.To further investigate the effect of Glu on chondral mineralization, mouse metatarsals were cultured in either the presence or absence of Glu at a concentration of 500 μm or 1 mm for different periods up to 7 days, followed by measurement of the mineralization ratio. Sustained exposure to Glu at 0.5 to 1 mm for 3 to 7 days from the initiation of cultivation resulted in significant inhibition of the mineralization in cultured metatarsals, whereas the mineralization ratio was not significantly changed following the incubation with Glu at 0.5 to 1 mm for 2 days (Fig. 2a). Glutamate was added at 0.5 or 1 mm on different days from 0 to 3 days to metatarsals, followed by incubation for up to 5 days and subsequent measurement of the mineralization ratio. The mineralization ratio was significantly decreased following sustained exposure to 0.5 mm Glu from 0 to 5 days and 1 to 5 days (Fig. 2b), whereas Glu did not significantly affect the mineralization ratio at 0.5 mm when exposed after 2 days until the day of alizarin red staining. The mineralization ratio was significantly decreased when metatarsals were treated with Glu at 1 mm from 0 to 5 days and 1 to 5 days in addition to 2 to 5 days. However, no significant alteration was seen with the mineralization ratio in metatarsals cultured in the presence of Glu at 0.5 to 1 mm from 3 to 5 days.FIGURE 2Inhibition of chondral mineralization by Glu in cultured metatarsals. a, metatarsals were cultured in the presence of Glu at 0.5 or 1 mm for different durations up to 7 days, followed by determination of mineralization ratios. b, glutamate was added at 0.5 or 1 mm on different days from 0 to 3 days in cultured metatarsals, followed by the additional culture for 5 days and subsequent determination of the mineralization ratio. c, metatarsals were digested with 0.3% collagenase at 37 °C for 30 min, followed by cultivation in the presence of Glu at 0.5 or 1 mm for 5 days and subsequent determination of the total area and the mineralization ratio. Values are the mean ± S.E. in separate experiments shown in each figure. *, p < 0.05; **, p < 0.01, significantly different from each control value obtained in metatarsals cultured in the absence of Glu.View Large Image Figure ViewerDownload Hi-res image Download (PPT)An attempt was next made to evaluate the possible involvement of perichondrium and/or bone collar in the decreased mineralization by Glu. Metatarsals were isolated from mouse embryos at 15.5 days post-gestation, followed by digestion with 0.3% collagenase at 37 °C for 30 min to remove perichondrium and bone collar as described previously (19Haaijman A. Karperien M. Lanske B. Hendriks J. Lowik C. Bronckers A. Burger E. Bone. 1999; 25: 397-404Crossref PubMed Scopus (45) Google Scholar) and subsequent cultivation in the presence of Glu at 0.5 and 1 mm for 5 days. Because the collagenase digestion induced obviously abnormal shapes in metatarsals, the mineralization ratio was calculated by the measurement of areas of the total rudiment and the middle mineralized part in place of the length. As seen in control unstripped metatarsals, the mineralization ratio was significantly inhibited by Glu at a concentration of over 0.5 mm even in cultured metatarsals treated with collagenase (Fig. 2c, lower panel), whereas no significant alteration was found in the total relative area in metatarsals cultured in the presence of Glu irrespective of the collagenase digestion (Fig. 2c, upper panel).Histological Analysis in Cultured Mouse Metatarsals—To further investigate the effect of Glu on chondral mineralization, several histological analyses were conducted on sections prepared from metatarsals cultured in the presence of Glu. Mouse metatarsals were cultured in the presence of Glu at 1 mm for 5 days, followed by the dissection of frozen sections at 5 μm for the histological analysis by staining with hematoxylin and eosin and Alcian blue, in addition to ALP and TUNEL. Sustained exposure to Glu apparently decreased the number of chondrocytes embedded within a calcified matrix (calcified chondrocytes), with a concomitant induction of abnormal cell shapes in both late proliferating and hypertrophic zones when determined by hematoxylin and eosin (Fig. 3a, left panels) and Alcian blue (Fig. 3a, middle left panels) staining. The ALP staining pattern was markedly altered in metatarsals cultured in the presence of Glu for 5 days (Fig. 3a, middle right panels), whereas apoptotic cells positive to TUNEL staining were clearly detected within late proliferating and prehypertrophic chondrocytic layers in cultured metatarsals exposed to 1 mm Glu for 5 days (Fig. 3a, right panels).FIGURE 3Morphological analysis in cultured mouse metatarsals. Metatarsals were cultured in either the presence or absence of 1 mm Glu for 5 days, followed by fixation with formalin and subsequent dissection of frozen sections in a cryostat for histological and TUNEL staining (a) and in situ hybridization (b). c, metatarsals were cultured in the presence of Glu at a concentration range from 10 μm to 1 mm for 5 days, followed by fixation with formalin and subsequent dissection of frozen sections for TU" @default.
• W2090313936 created "2016-06-24" @default.
• W2090313936 creator A5005404495 @default.
• W2090313936 creator A5008780348 @default.
• W2090313936 creator A5025834236 @default.
• W2090313936 creator A5073474984 @default.
• W2090313936 creator A5090476193 @default.
• W2090313936 date "2006-08-01" @default.
• W2090313936 modified "2023-09-29" @default.
• W2090313936 title "Glutamate Inhibits Chondral Mineralization through Apoptotic Cell Death Mediated by Retrograde Operation of the Cystine/Glutamate Antiporter" @default.
• W2090313936 cites W1579591510 @default.
• W2090313936 cites W1599662080 @default.
• W2090313936 cites W1685047815 @default.
• W2090313936 cites W1964617786 @default.
• W2090313936 cites W1976955003 @default.
• W2090313936 cites W1978943277 @default.
• W2090313936 cites W1979467473 @default.
• W2090313936 cites W1983197885 @default.
• W2090313936 cites W2000493723 @default.
• W2090313936 cites W2007127627 @default.
• W2090313936 cites W2009183764 @default.
• W2090313936 cites W2011654786 @default.
• W2090313936 cites W2013067874 @default.
• W2090313936 cites W2023552997 @default.
• W2090313936 cites W2026120398 @default.
• W2090313936 cites W2037981984 @default.
• W2090313936 cites W2044167629 @default.
• W2090313936 cites W2047910499 @default.
• W2090313936 cites W2048976632 @default.
• W2090313936 cites W2079011919 @default.
• W2090313936 cites W2089939109 @default.
• W2090313936 cites W2090331565 @default.
• W2090313936 cites W2092916498 @default.
• W2090313936 cites W2095168835 @default.
• W2090313936 cites W2096606144 @default.
• W2090313936 cites W2122957183 @default.
• W2090313936 cites W2124963943 @default.
• W2090313936 cites W2138921119 @default.
• W2090313936 cites W2170335058 @default.
• W2090313936 cites W4210979710 @default.
• W2090313936 cites W4231646015 @default.
• W2090313936 cites W4233484287 @default.
• W2090313936 doi "https://doi.org/10.1074/jbc.m600939200" @default.
• W2090313936 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/16790444" @default.
• W2090313936 hasPublicationYear "2006" @default.
• W2090313936 type Work @default.
• W2090313936 sameAs 2090313936 @default.
• W2090313936 citedByCount "40" @default.
• W2090313936 countsByYear W20903139362012 @default.
• W2090313936 countsByYear W20903139362013 @default.
• W2090313936 countsByYear W20903139362014 @default.
• W2090313936 countsByYear W20903139362015 @default.
• W2090313936 countsByYear W20903139362016 @default.
• W2090313936 countsByYear W20903139362017 @default.
• W2090313936 countsByYear W20903139362018 @default.
• W2090313936 countsByYear W20903139362019 @default.
• W2090313936 crossrefType "journal-article" @default.
• W2090313936 hasAuthorship W2090313936A5005404495 @default.
• W2090313936 hasAuthorship W2090313936A5008780348 @default.
• W2090313936 hasAuthorship W2090313936A5025834236 @default.
• W2090313936 hasAuthorship W2090313936A5073474984 @default.
• W2090313936 hasAuthorship W2090313936A5090476193 @default.
• W2090313936 hasBestOaLocation W20903139361 @default.
• W2090313936 hasConcept C111696902 @default.
• W2090313936 hasConcept C170493617 @default.
• W2090313936 hasConcept C178790620 @default.
• W2090313936 hasConcept C181199279 @default.
• W2090313936 hasConcept C185592680 @default.
• W2090313936 hasConcept C190283241 @default.
• W2090313936 hasConcept C2777608289 @default.
• W2090313936 hasConcept C2779201268 @default.
• W2090313936 hasConcept C31573885 @default.
• W2090313936 hasConcept C41625074 @default.
• W2090313936 hasConcept C537208039 @default.
• W2090313936 hasConcept C55493867 @default.
• W2090313936 hasConcept C57181701 @default.
• W2090313936 hasConcept C61174792 @default.
• W2090313936 hasConcept C86803240 @default.
• W2090313936 hasConcept C95444343 @default.
• W2090313936 hasConceptScore W2090313936C111696902 @default.
• W2090313936 hasConceptScore W2090313936C170493617 @default.
• W2090313936 hasConceptScore W2090313936C178790620 @default.
• W2090313936 hasConceptScore W2090313936C181199279 @default.
• W2090313936 hasConceptScore W2090313936C185592680 @default.
• W2090313936 hasConceptScore W2090313936C190283241 @default.
• W2090313936 hasConceptScore W2090313936C2777608289 @default.
• W2090313936 hasConceptScore W2090313936C2779201268 @default.
• W2090313936 hasConceptScore W2090313936C31573885 @default.
• W2090313936 hasConceptScore W2090313936C41625074 @default.
• W2090313936 hasConceptScore W2090313936C537208039 @default.
• W2090313936 hasConceptScore W2090313936C55493867 @default.
• W2090313936 hasConceptScore W2090313936C57181701 @default.
• W2090313936 hasConceptScore W2090313936C61174792 @default.
• W2090313936 hasConceptScore W2090313936C86803240 @default.
• W2090313936 hasConceptScore W2090313936C95444343 @default.
• W2090313936 hasIssue "34" @default.
• W2090313936 hasLocation W20903139361 @default.
• W2090313936 hasOpenAccess W2090313936 @default.

• next