Matches in SemOpenAlex for { <https://semopenalex.org/work/W2090825838> ?p ?o ?g. }
Showing items 1 to 98 of
98
with 100 items per page.
- W2090825838 endingPage "38" @default.
- W2090825838 startingPage "35" @default.
- W2090825838 abstract "Progressive muscular dystrophy is a leading neuromuscular disorder without any effective treatments and a common genetic cause of mortality among teenagers. A challenge exists in the screening of subtle mutations in 79 exons and little is known about the genotype-phenotype correlation.Here we adopted multiplex ligation-dependent probe amplification and Sanger sequencing to detect the dystrophin gene in 407 patients and 76 mothers.Sixty-three percent (257/407) of the patients harbored a deletion or duplication mutation, with a de novo mutation frequency of 39.5% in 76 affected patients, and approximately 43.7% of the deletions occurred from exon 45 to 52. To those patients suspected with single exon deletion, combined with Sanger sequencing, five subtle mutations were identified: c.8608C>T, c.2302C>T, c.7148dupT, c.10855C>T and c.2071-2093del AGGGAACAGATCCTGGTAAAGCA; the last three mutations were novel. Furthermore, after genotype-phenotype analysis, the severity of DMD/BMD was associated with the frame shift mutation but not with the deletion, the duplication or the number of deleted exons.The majority of patients have a deletion/duplication mutation in the dystrophin gene, with a hot deletion mutation region from exon 45 to 52. Combined with Sanger sequencing, multiplex ligation-dependent probe amplification is capable of detecting part of subtle mutations." @default.
- W2090825838 created "2016-06-24" @default.
- W2090825838 creator A5000913631 @default.
- W2090825838 creator A5008253139 @default.
- W2090825838 creator A5014687439 @default.
- W2090825838 creator A5026972187 @default.
- W2090825838 creator A5061053379 @default.
- W2090825838 creator A5062223840 @default.
- W2090825838 creator A5069311365 @default.
- W2090825838 creator A5091082571 @default.
- W2090825838 creator A5091310382 @default.
- W2090825838 date "2013-08-01" @default.
- W2090825838 modified "2023-10-18" @default.
- W2090825838 title "Molecular analysis of the dystrophin gene in 407 Chinese patients with Duchenne/Becker muscular dystrophy by the combination of multiplex ligation-dependent probe amplification and Sanger sequencing" @default.
- W2090825838 cites W1533667631 @default.
- W2090825838 cites W1966340852 @default.
- W2090825838 cites W1978186963 @default.
- W2090825838 cites W2014850372 @default.
- W2090825838 cites W2026380769 @default.
- W2090825838 cites W2042368510 @default.
- W2090825838 cites W2063779681 @default.
- W2090825838 cites W2113926943 @default.
- W2090825838 cites W2131974724 @default.
- W2090825838 cites W2158156749 @default.
- W2090825838 cites W2164481873 @default.
- W2090825838 cites W3094222424 @default.
- W2090825838 doi "https://doi.org/10.1016/j.cca.2013.04.006" @default.
- W2090825838 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/23588064" @default.
- W2090825838 hasPublicationYear "2013" @default.
- W2090825838 type Work @default.
- W2090825838 sameAs 2090825838 @default.
- W2090825838 citedByCount "21" @default.
- W2090825838 countsByYear W20908258382013 @default.
- W2090825838 countsByYear W20908258382014 @default.
- W2090825838 countsByYear W20908258382015 @default.
- W2090825838 countsByYear W20908258382016 @default.
- W2090825838 countsByYear W20908258382017 @default.
- W2090825838 countsByYear W20908258382018 @default.
- W2090825838 countsByYear W20908258382019 @default.
- W2090825838 countsByYear W20908258382020 @default.
- W2090825838 countsByYear W20908258382021 @default.
- W2090825838 countsByYear W20908258382022 @default.
- W2090825838 countsByYear W20908258382023 @default.
- W2090825838 crossrefType "journal-article" @default.
- W2090825838 hasAuthorship W2090825838A5000913631 @default.
- W2090825838 hasAuthorship W2090825838A5008253139 @default.
- W2090825838 hasAuthorship W2090825838A5014687439 @default.
- W2090825838 hasAuthorship W2090825838A5026972187 @default.
- W2090825838 hasAuthorship W2090825838A5061053379 @default.
- W2090825838 hasAuthorship W2090825838A5062223840 @default.
- W2090825838 hasAuthorship W2090825838A5069311365 @default.
- W2090825838 hasAuthorship W2090825838A5091082571 @default.
- W2090825838 hasAuthorship W2090825838A5091310382 @default.
- W2090825838 hasConcept C104317684 @default.
- W2090825838 hasConcept C120599132 @default.
- W2090825838 hasConcept C153911025 @default.
- W2090825838 hasConcept C2778943923 @default.
- W2090825838 hasConcept C2779030066 @default.
- W2090825838 hasConcept C2780394045 @default.
- W2090825838 hasConcept C36823959 @default.
- W2090825838 hasConcept C501734568 @default.
- W2090825838 hasConcept C54355233 @default.
- W2090825838 hasConcept C7602840 @default.
- W2090825838 hasConcept C76818968 @default.
- W2090825838 hasConcept C86803240 @default.
- W2090825838 hasConceptScore W2090825838C104317684 @default.
- W2090825838 hasConceptScore W2090825838C120599132 @default.
- W2090825838 hasConceptScore W2090825838C153911025 @default.
- W2090825838 hasConceptScore W2090825838C2778943923 @default.
- W2090825838 hasConceptScore W2090825838C2779030066 @default.
- W2090825838 hasConceptScore W2090825838C2780394045 @default.
- W2090825838 hasConceptScore W2090825838C36823959 @default.
- W2090825838 hasConceptScore W2090825838C501734568 @default.
- W2090825838 hasConceptScore W2090825838C54355233 @default.
- W2090825838 hasConceptScore W2090825838C7602840 @default.
- W2090825838 hasConceptScore W2090825838C76818968 @default.
- W2090825838 hasConceptScore W2090825838C86803240 @default.
- W2090825838 hasLocation W20908258381 @default.
- W2090825838 hasLocation W20908258382 @default.
- W2090825838 hasOpenAccess W2090825838 @default.
- W2090825838 hasPrimaryLocation W20908258381 @default.
- W2090825838 hasRelatedWork W2054665634 @default.
- W2090825838 hasRelatedWork W2071382247 @default.
- W2090825838 hasRelatedWork W2090825838 @default.
- W2090825838 hasRelatedWork W2363096087 @default.
- W2090825838 hasRelatedWork W2365179609 @default.
- W2090825838 hasRelatedWork W2892119104 @default.
- W2090825838 hasRelatedWork W2948363540 @default.
- W2090825838 hasRelatedWork W3030799730 @default.
- W2090825838 hasRelatedWork W3032500056 @default.
- W2090825838 hasRelatedWork W4283585713 @default.
- W2090825838 hasVolume "423" @default.
- W2090825838 isParatext "false" @default.
- W2090825838 isRetracted "false" @default.
- W2090825838 magId "2090825838" @default.
- W2090825838 workType "article" @default.