FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2091240925> ?p ?o ?g. }

• W2091240925 endingPage "17001" @default.
• W2091240925 startingPage "16989" @default.
• W2091240925 abstract "Mechanisms regulating the nuclear localization of glycogen synthase kinase-3β (GSK3β) remained enigmatic despite the crucial regulation by nuclear GSK3β of important cellular functions. These include regulation of gene expression, cell cycle progression, and apoptosis, achieved by the phosphorylation by GSK3 of nuclear substrates (e.g. numerous transcription factors). We resolved this mechanism by identifying a bipartite nuclear localization sequence (NLS) that is necessary for the nuclear accumulation of GSK3β and is sufficient to drive yellow fluorescent protein into the nucleus. Despite the NLS, most GSK3β is cytosolic, sequestered in protein complexes that, although still mobile in the cytosol, block the NLS. Conditions promoting nuclear translocation of GSK3β release it from cytosolic complexes, allowing the NLS to direct nuclear import. Using this information to prepare a nucleus-excluded active GSK3 construct, we found that the antiapoptotic effect of GSK3β in tumor necrosis factor-induced apoptosis is mediated by cytosolic, not nuclear, GSK3β. Identification of a GSK3β NLS allows new strategies to decipher and manipulate its subcellular actions regulating gene expression and apoptosis and its involvement in diseases. Mechanisms regulating the nuclear localization of glycogen synthase kinase-3β (GSK3β) remained enigmatic despite the crucial regulation by nuclear GSK3β of important cellular functions. These include regulation of gene expression, cell cycle progression, and apoptosis, achieved by the phosphorylation by GSK3 of nuclear substrates (e.g. numerous transcription factors). We resolved this mechanism by identifying a bipartite nuclear localization sequence (NLS) that is necessary for the nuclear accumulation of GSK3β and is sufficient to drive yellow fluorescent protein into the nucleus. Despite the NLS, most GSK3β is cytosolic, sequestered in protein complexes that, although still mobile in the cytosol, block the NLS. Conditions promoting nuclear translocation of GSK3β release it from cytosolic complexes, allowing the NLS to direct nuclear import. Using this information to prepare a nucleus-excluded active GSK3 construct, we found that the antiapoptotic effect of GSK3β in tumor necrosis factor-induced apoptosis is mediated by cytosolic, not nuclear, GSK3β. Identification of a GSK3β NLS allows new strategies to decipher and manipulate its subcellular actions regulating gene expression and apoptosis and its involvement in diseases. Cells have the inherent ability to rapidly and concurrently modulate the actions of many proteins in response to environmental and biological cues. A large part of these coordinated cellular responses are due to posttranslational modifications of key regulatory proteins. This requires the appropriate localization of the modifying enzymes, particularly protein kinases, since phosphorylation is the predominant mechanism for Protein posttranslational modification. Dynamic fluxes in the nuclear level of the serine/threonine kinase glycogen synthase kinase-3β (GSK3β) 2The abbreviations used are: GSK, glycogen synthase kinase; CREB, cyclic AMP-response element-binding protein; EGS, ethylene glycolbis(succinimidylsuccinate); FRAP, fluorescence recovery after photobleaching; MEF, mouse embryonic fibroblast; NES, nuclear export sequence; NLS, nuclear localization sequence; PBS, phosphate-buffered saline; TNF, tumor necrosis factor; YFP, yellow fluorescent protein; HA, hemagglutinin; BSA, bovine serum albumin. occur during key cellular events. Nuclear GSK3β levels markedly increase when cells enter the S-phase of the cell cycle, followed by a loss of nuclear GSK3β as the cell cycle progresses (1Diehl J.A. Cheng M. Roussel M.F. Sherr C.J. Genes Dev. 1998; 12: 3499-3511Crossref PubMed Scopus (1868) Google Scholar). Nuclear GSK3β levels decrease in response to stimulation by proliferative growth factors, whereas insults that induce apoptosis can cause accumulation of GSK3β in the nucleus prior to the activation of the caspase cascade (2Bijur G.N. Jope R.S. J. Biol. Chem. 2001; 276: 37436-37442Abstract Full Text Full Text PDF PubMed Scopus (194) Google Scholar). Additionally, GSK3β in the nucleus is highly active relative to cytosolic GSK3β (3Bijur G.N. Jope R.S. Neuroreport. 2003; 14: 2415-2419Crossref PubMed Scopus (192) Google Scholar). Fluxes in GSK3β in the nucleus at critical periods may be related to the well documented capacity of nuclear GSK3β to regulate many transcription factors, such as nuclear factor-κB (NF-κB), cyclic AMP response element-binding protein (CREB), Snail, p53, AP-1, Myc, and others, that exert widespread effects on cellular functions by regulating the expression of many genes (4Hoeflich K.P. Luo J. Rubie E.A. Tsao M.-S. Jin O. Woodgett J.R. Nature. 2000; 406: 86-90Crossref PubMed Scopus (1228) Google Scholar, 5Grimes C.A. Jope R.S. Prog. Neurobiol. 2001; 65: 391-426Crossref PubMed Scopus (1319) Google Scholar, 6Zhou B.P. Deng J. Xia W. Xu J. Li Y.M. Gunduz M. Hung M.C. Nat. Cell Biol. 2004; 6: 931-940Crossref PubMed Scopus (1341) Google Scholar, 7Jope R.S. Johnson G.V.W. Trends Biochem. Sci. 2004; 29: 95-102Abstract Full Text Full Text PDF PubMed Scopus (1334) Google Scholar). Thus, cellular phenotype and survival can be influenced by the level of GSK3β in the nucleus. Despite these crucial cellular events involving nuclear GSK3β, a longstanding problem remains unresolved, deciphering the mechanism of its nuclear import. There are two isoforms of GSK3, GSK3β and GSK3α, and these are involved in modulating a large and diverse number of cellular functions, including metabolism, development, cellular architecture, gene expression, and survival (7Jope R.S. Johnson G.V.W. Trends Biochem. Sci. 2004; 29: 95-102Abstract Full Text Full Text PDF PubMed Scopus (1334) Google Scholar, 8Frame S. Cohen P. Biochem. J. 2001; 359: 1-16Crossref PubMed Scopus (1282) Google Scholar, 9Woodgett J.R. Curr. Drug Targets Immune Endocr. Metabol. Disord. 2003; 3: 281-290Crossref PubMed Scopus (80) Google Scholar). GSK3β is constitutively active, but several mechanisms contribute to controlling its actions. Inhibitory phosphorylation by Akt and other kinases occurs on serine 9 of GSK3β. Conversely, phosphorylation of GSK3β on tyrosine 216 increases its activity (8Frame S. Cohen P. Biochem. J. 2001; 359: 1-16Crossref PubMed Scopus (1282) Google Scholar, 10Grimes C.A. Jope R.S. J. Neurochem. 2001; 78: 1219-1232Crossref PubMed Scopus (343) Google Scholar). GSK3β is also regulated by protein complex formation, especially well known in the cytosolic Wnt signaling pathway, where GSK3β associated with a large protein complex phosphorylates β-catenin to promote its degradation (11Ciani L. Salinas P.C. Nat. Rev. Neurosci. 2005; 6: 351-362Crossref PubMed Scopus (525) Google Scholar). Phosphorylation of substrates by GSK3β is also usually controlled by the phosphorylation state of the substrate, because most substrates of GSK3β must be “primed,” prephosphorylated at a residue four amino acids C-terminal to the GSK3β target site. A mutation in the primed substrate binding pocket of GSK3β, R96A, that blocks its binding to primed substrates is widely used to identify primed substrates of GSK3β (12Frame S. Cohen P. Biondi R.M. Mol. Cell. 2001; 7: 1321-1327Abstract Full Text Full Text PDF PubMed Scopus (577) Google Scholar). In addition to these three regulatory mechanisms, the subcellular distribution of GSK3β regulates its actions by controlling its accessibility to substrates, such as those in the nucleus (7Jope R.S. Johnson G.V.W. Trends Biochem. Sci. 2004; 29: 95-102Abstract Full Text Full Text PDF PubMed Scopus (1334) Google Scholar). Nuclear levels of proteins are balanced by export and import mechanisms. The nuclear export of GSK3β is inhibited by leptomycin B, indicating that at least a portion of GSK3β nuclear export is CRM1-dependent (2Bijur G.N. Jope R.S. J. Biol. Chem. 2001; 276: 37436-37442Abstract Full Text Full Text PDF PubMed Scopus (194) Google Scholar). Nuclear export of GSK3β is partially mediated by FRAT-1, which binds GSK3β in the nucleus followed by export of the complex via the nuclear export sequence (NES) in FRAT-1 (13Franca-Koh J. Yeo M. Fraser E. Young N. Dale T.C. J. Biol. Chem. 2002; 277: 43844-43848Abstract Full Text Full Text PDF PubMed Scopus (72) Google Scholar). To counter export, we hypothesized that GSK3β may contain an NLS; however, examination of the primary amino acid sequence did not reveal a consensus NLS, nor was one identified using the CUBIC NLS prediction algorithm (14Nair R. Carter P. Rost B. Nucleic Acids Res. 2003; 31: 397-399Crossref PubMed Scopus (132) Google Scholar). Therefore, we examined regions in GSK3β rich in basic amino acids (lysine and arginine), a general requirement for an NLS. This enabled us to identify an NLS motif in GSK3β that is necessary for nuclear import of GSK3β and is sufficient to drive the nuclear import of yellow fluorescent protein (YFP). Further experiments revealed that the subcellular distribution of GSK3β is regulated by the NLS, by the N-terminal tail of GSK3β, and by cytosolic protein complexes that are capable of blocking the NLS function by sequestering GSK3β in the cytosol. Finally, the controversial intracellular site of action of GSK3β that inhibits tumor necrosis factor (TNF)-induced cytotoxicity was resolved by showing that this was mediated by NLS-deficient GSK3β in the cytosol. Cell Culture—HEK293, mouse embryonic fibroblasts (MEFs), and HeLa cells were grown in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum (Invitrogen), 2 mm l-glutamine, 100 units/ml penicillin, 100 μg/ml streptomycin, and 15 mm HEPES (Cellgro, Herndon, VA) in humidified, 37 °C chambers with 5% CO2. Immunoblotting—Cells were washed twice with phosphate-buffered saline (PBS) and were lysed with lysis buffer (20 mm Tris, pH 7.5, 150 mm NaCl, 2 mm EDTA, 2 mm EGTA, 0.5% Nonidet P-40, 1 mm sodium orthovanadate, 100 μm phenylmethanesulfonyl fluoride, 0.1 μm okadaic acid, 50 mm sodium fluoride, and 10 μg/ml each of leupeptin, aprotinin, and pepstatin). The lysates were sonicated and centrifuged at 20,800 × g for 15 min. Protein concentrations were determined by the bicinchoninic acid method (Pierce). Samples were mixed with Laemmli sample buffer (2% SDS) and placed in a boiling water bath for 5 min, and proteins were resolved in SDS-polyacrylamide gels, transferred to nitrocellulose, and incubated with antibodies to phospho-Ser9-GSK3β (Cell Signaling, Danvers, MA), total GSK3β, total poly(ADP-ribose) polymerase (BD PharMingen/Transduction Laboratories, San Diego, CA), total GSK3α/β (Upstate Biotechnology, Inc., Lake Placid, NY), or HA tag (Covance, Berkeley, CA). Immunoblots were developed using horseradish peroxidase-conjugated goat anti-mouse or goat anti-rabbit IgG, followed by detection with enhanced chemiluminescence, and the protein bands were quantitated with a densitometer. Subcellular Fractionation—Nuclear and cytosolic fractions were prepared as previously described (2Bijur G.N. Jope R.S. J. Biol. Chem. 2001; 276: 37436-37442Abstract Full Text Full Text PDF PubMed Scopus (194) Google Scholar) with minor modifications. Cells were washed twice with PBS and then harvested in 200 μl of lysis buffer (10 mm Tris, pH 7.5, 10 mm NaCl, 3 mm MgCl2, 0.05% Nonidet P-40, 1 mm EGTA, 1 mm sodium orthovanadate, 100 μm phenylmethanesulfonyl fluoride, 0.1 μm okadaic acid, 50 mm sodium fluoride, and 10 μg/ml each of leupeptin, aprotinin, and pepstatin). Cells were centrifuged at 2700 × g for 10 min at 4 °C. The supernatant was centrifuged at 20,800 × g for 15 min at 4 °C to obtain the cytosolic fraction. The pellet containing nuclei was washed twice in 200 μl of wash buffer (5 mm HEPES, pH 7.4, 3 mm MgCl2, 1 mm EGTA, 250 mm sucrose, 0.1% BSA, with protease and phosphatase inhibitors). The pellet was then resuspended in wash buffer and layered on top of 1 ml of 1 m sucrose (with protease and phosphatase inhibitors), and centrifuged at 2700 × g for 10 min at 4 °C. The nuclear pellet was washed in lysis buffer containing 0.05% Nonidet P-40. The nuclear proteins were extracted by resuspending the pellet in nuclear extraction buffer (20 mm HEPES, pH 7.9, 300 mm NaCl, 1.5 mm MgCl2, 0.2 mm EDTA, 0.1 mm β-glycerophosphate, 1 mm sodium orthovanadate, 100 μm phenylmethanesulfonyl fluoride, 0.1 μm okadaic acid, 50 mm sodium fluoride, and 10 μg/ml each of leupeptin, aprotinin, and pepstatin) and incubating on ice for 30 min. After extraction, the nuclear samples were centrifuged at 20,800 × g for 15 min at 4 °C, and the supernatant was retained as the nuclear extract. Cloning, Site-directed Mutagenesis, and Transfection—Site-directed mutagenesis was performed on GSK3β-HA in pcDNA3.1+ (generously provided by Dr. J. M. Woodgett, University of Toronto) using the GeneEditor site-directed mutagenesis system (Promega, Madison, WI) following the manufacturer's protocol. Primers used for mutagenesis were as follows: for lysines 85 and 86 to alanine, GAGAACTGGTCGCCATCGCGGCAGTATTGCAGGACAAGAG; for arginine 102 to glycine and lysine 103 to alanine, GAGCTCCAGATCATGGGAGCGCTAGATCACTGTAAC; for lysines 122 and 123 to alanine, CTACTCCAGTGGTGAGGCGGCAGATGAGGTCTATC. The arginine 96 to alanine and serine 9 to alanine mutants were a kind gift from Dr. G. V. W. Johnson (University of Alabama at Birmingham). To generate Δ9-GSK3β-HA (deletion of the nine N-terminal amino acids), wild-type GSK3β-HA was used as a PCR template with the following primers: 5′-TCTAGCTAGCATGTTTGCGGAGAGCTGCAAGC and 5′-TAAACTATGCGGCCGCTCCGTCGGGACTGTACTAG. The truncated product was inserted into pcDNA3.1+ using NotI and NheI restriction enzymes. DNA encoding the GSK3β NLS was synthesized to contain a 5′ EcoRV compatible end and a 3′ overhang compatible with XbaI, a TAG stop codon, and a 5′ phosphorylation, in addition to the coding region for the NLS (sequence available upon request). The eYFP vector was digested with EcoRV and XbaI, and the NLS was ligated in to generate the YFP-NLS fusion. All DNA was synthesized and PAGE-purified by Integrated DNA Technologies (Coralville, IA). The coding regions of all constructs were verified by sequencing at the University of Alabama at Birmingham center for AIDS research DNA sequencing core facility. Cells were transfected 24 h after plating using Fugene 6 (Roche Applied Science) at a ratio of 4 μl of Fugene to 1 μg of DNA following the manufacturer's protocol. To achieve equal expression levels, all constructs were used at equal amounts except K85A,K86A-GSK3β-HA, which required twice as much DNA to reach an equal expression level. Immunoprecipitation—Immunoprecipitations were performed using sheep anti-mouse IgG Dynabeads (Dynal Biotech, Oslo, Norway). The Dynabeads, 10 μl of slurry per sample, were washed twice in PBS plus 0.1% BSA; all washes were performed using a magnetic particle separator. The beads were incubated with 1 μg of anti-GSK3β antibody or 1 μl of anti-HA antibody in PBS/BSA at 4 °C with end-over-end mixing overnight. The beads were then washed twice in PBS/BSA followed by the addition of cell lysate (200 μg of protein). The beads plus lysate were incubated at 4 °C for 2 h with end-over-end mixing. The beads were then washed three times with PBS/BSA. GSK3β Activity Measurement—GSK3β was immunoprecipitated, and the beads were washed a final time in kinase buffer (20 mm Tris, pH 7.5, 5 mm MgCl2, 1 mm dithiothreitol). The beads were then resuspended in 30 μl of kinase buffer containing 250 μm ATP, 1.4 μCi of [γ-32P]ATP, and 50 μm phosphoglycogen synthase peptide (Upstate Biotechnology). The samples were incubated at 30 °C for 30 min, the reaction tubes were centrifuged for 1 min, and triplicate 9-μl aliquots of each sample were spotted on P81 filter paper circles. The filter paper was allowed to dry and then washed three times in 0.5% phosphoric acid for a total time of 1 h, followed by a 10-min wash in 95% ethanol. The filter paper was then air-dried and counted in a liquid scintillation counter. Activity was normalized to the amount of GSK3β immunoprecipitated, which was determined by immunoblotting. Immunofluorescence—Cells were plated on poly-d-lysine-coated coverslips in 35-mm dishes. After transfection (24 h), cells were fixed in 2% paraformaldehyde at 37 °C for 20 min. Cells were washed twice in PBS followed by permeabilization with 0.1% Triton X-100 in PBS for 5 min at room temperature. The cells were then blocked in 3% BSA, PBS for 1 h at room temperature. Cells were stained with Alexa-488-HA antibody (1:2500 in 3% BSA/PBS; Covance) and incubated with rocking at 4 °C overnight. The coverslips were washed with PBS and then incubated with 100 ng/ml Hoechst 33342 for 15 min at room temperature. The coverslips were washed for several hours in PBS, with frequent changes of the PBS. The coverslips were mounted on slides and examined by fluorescence microscopy (Nikon) with a ×40 oil immersion objective. Images were captured using Image Pro-plus software. Fluorescence Recovery after Photobleaching (FRAP) and Confocal Microscopy—FRAP analysis was performed in live cells expressing GSK3β-eYFP using the FRAP module on a Leica SP2 laser-scanning confocal microscope with a Leica DMRXE upright microscope using a ×100 oil immersion objective. Prebleach and postbleach images were captured using a 514-nm laser at 20% power with image acquisition at 800 MHz. For bleaching, an area of 13 μm2 was illuminated with the 514-nm laser at 100% power for 6 frames (∼0.7 s/frame). The mobile fraction Mf was calculated using the equation Mf = (F∞ – F0)/(Fi – F0) (15Axelrod D. Koppel D.E. Schlessinger J. Elson E. Webb W.W. Biophys. J. 1976; 16: 1055-1069Abstract Full Text PDF PubMed Scopus (2042) Google Scholar, 16Lippincott-Schwartz J. Snapp E. Kenworthy A. Nat. Rev. Mol. Cell Biol. 2001; 2: 444-456Crossref PubMed Scopus (986) Google Scholar), where F∞ is the fluorescence intensity in the bleached region after recovery, F0 is the fluorescence in the bleached region immediately after the bleach, and Ff is the intensity before the bleach. All values were corrected for loss of fluorescence during acquisition using a region outside of the bleached region. Standard confocal microscopy was performed on live cells using a Leica SP1 laser-scanning confocal with an inverted microscope and ×100 oil immersion objective. All confocal analyses were performed at the University of Alabama at Birmingham high resolution imaging core facility. Flow Cytometry—Annexin-V-PE staining was performed according to the manufacturer's protocol (BD PharMingen). Stained cells were analyzed using a BD LSRII flow cytometer and BD FACSdiva software. Flow cytometry was performed at the University of Alabama at Birmingham center for AIDS research flow cytometry core facility. Cell Death Assay—Cell death in MEFs was measured as described previously with minor modifications (4Hoeflich K.P. Luo J. Rubie E.A. Tsao M.-S. Jin O. Woodgett J.R. Nature. 2000; 406: 86-90Crossref PubMed Scopus (1228) Google Scholar). Cells in 60-mm dishes were co-transfected with the indicated construct and LacZ at a ratio of 2:1. After transfection (24 h), cells were trypsinized and counted, and 20,000 cells/well were plated in a 48-well plate. Cells were grown an additional 24 h, followed by treatment with TNF. Following treatment, β-galactosidase activity was measured and compared with the untreated control for each construct as a measure of cell viability. In Situ Cross-linking—Following the indicated treatments, cells were washed twice in 37°C PBS, followed by the addition of the cross-linker, 2 mm ethylene glycolbis(succinimidylsuccinate) (EGS) (Pierce) in PBS, pH 7.4. Cells were incubated at 37 °C for 30 min, the reaction was then quenched by the addition of 50 mm Tris, pH 8.0, and samples were incubated at 37 °C for 10 min. Cells were washed in PBS and harvested, and subcellular fractions were prepared. Nuclei were lysed using lysis buffer containing 0.5% Nonidet P-40. Statistical Analysis—Statistical analysis was performed using one-way analysis of variance with Dunnett's post hoc multiple comparisons test or Student's t test using In Stat software. Identification and Mutagenesis of the Putative NLS in GSK3β—GSK3β contains a region of 38 amino acids consisting of residues 85–123 that is rich in lysine and arginine (32%), which we hypothesized may encompass an NLS (Fig. 1A). An important feature of an NLS is that it must be externally exposed so that it can bind to nuclear import proteins. The crystal structure of GSK3β (17Dajani R. Fraser E. Roe S.M. Young N. Good V. Dale T.C. Pearl L.H. Cell. 2001; 105: 721-732Abstract Full Text Full Text PDF PubMed Scopus (588) Google Scholar) shows that this putative NLS domain forms an external loop, indicating that it is easily accessible to proteins involved in the intracellular transport of GSK3β (Fig. 1B). To begin to test if this region contains an NLS, several of the basic amino acids were mutated to alanine or glycine. These mutated constructs of GSK3β containing HA tags included K85A,K86A-GSK3β-HA, R96A-GSK3β-HA, R102G,K103A-GSK3β-HA, and K122A,K123A-GSK3β-HA. Each GSK3β construct included an HA tag because this slows electrophoretic mobility of the protein on SDS-polyacrylamide gels, allowing the expressed GSK3β constructs to be distinguished from endogenous GSK3β on Western blots. Each GSK3β construct was expressed in HEK293 cells, and Western blot analysis demonstrated that expression levels were equivalent to expressed wild-type GSK3β-HA and that the expression of GSK3β constructs did not alter the level of endogenous GSK3β (Fig. 1C). Additionally, the phosphorylation status at serine 9 and tyrosine 216 of each GSK3β construct was examined using site-specific phosphorylation-dependent antibodies. The serine 9 phosphorylation level of wild-type GSK3β-HA and each of the mutants paralleled expression levels of each construct with the exception of K85A,K86A-GSK3β-HA, which exhibited relatively less serine 9 phosphorylation (Fig. 1D). Similarly, the tyrosine 216 phosphorylation of wild-type GSK3β-HA and each of the mutants was approximately equivalent with the exception of K85A,K86A-GSK3β, which displayed no detectable phosphorylation at tyrosine 216 (Fig. 1D). This is in accordance with previous evidence that mutation of the Lys85 residue results in a kinase-dead protein (18He X. Saint-Jeannet J.P. Woodgett J.R. Varmus H.E. Dawid I.B. Nature. 1995; 374: 617-622Crossref PubMed Scopus (448) Google Scholar) and that phosphorylation of GSK3β at tyrosine 216 is due to autophosphorylation (19Cole A. Frame S. Cohen P. Biochem. J. 2004; 377: 249-255Crossref PubMed Scopus (258) Google Scholar). To test if these mutations affected GSK3β activity, the kinase activity of each mutant was measured using a phosphoglycogen synthase peptide as a primed substrate. Each construct was expressed in HEK293 cells and immunoprecipitated with an HA antibody. K85A,K86A-GSK3β-HA had essentially no activity toward phosphoglycogen synthase (Fig. 1E), consistent with evidence that mutation of the Lys85 residue eliminates kinase activity (18He X. Saint-Jeannet J.P. Woodgett J.R. Varmus H.E. Dawid I.B. Nature. 1995; 374: 617-622Crossref PubMed Scopus (448) Google Scholar). Similarly, R96A-GSK3β-HA had little activity toward phosphoglycogen synthase, consistent with reports that Arg96 is required for GSK3β to bind and phosphorylate primed substrates (12Frame S. Cohen P. Biondi R.M. Mol. Cell. 2001; 7: 1321-1327Abstract Full Text Full Text PDF PubMed Scopus (577) Google Scholar). However, R96A-GSK3β retained catalytic activity toward the unprimed substrate recombinant Tau (not shown), as reported previously (20Cho J.H. Johnson G.V.W. J. Biol. Chem. 2003; 278: 187-193Abstract Full Text Full Text PDF PubMed Scopus (212) Google Scholar). Using phosphoglycogen synthase as the substrate, R102G,K103A-GSK3β-HA and K122A, K123A-GSK3β-HA retained ∼70 and 85%, respectively, of the wild-type GSK3β activity. Amino Acids 85–103 Contain Residues Required for Nuclear Localization of GSK3β—To test if the nuclear localization of GSK3β was dependent on the lysines and arginines within the 85–123 putative NLS region, each construct was expressed in HEK293 cells in parallel with wild-type GSK3β-HA, and their distributions between the nucleus and cytosol were compared after subcellular fractionation. Cytosolic and nuclear fractions were immunoblotted for CREB as a nuclear marker and α-tubulin as a cytosolic marker, and no CREB was detected in the cytosolic fractions and no α-tubulin was detected in the nuclear fractions, verifying efficient isolation of these fractions (Fig. 2A). Wild-type GSK3β-HA was localized in both the nucleus and the cytosol (Fig. 2B). In marked contrast, K85A,K86A-GSK3β-HA was completely excluded from the nucleus. Similarly, R96A-GSK3β-HA and R102G,K103A-GSK3β-HA also were excluded from the nucleus. However, K122A,K123A-GSK3β-HA was distributed in both the nucleus and the cytosol to the same extent as wild-type GSK3β-HA, indicating that Lys122 and Lys123 are not required for the nuclear import of GSK3β. These results indicated that a sequence extending from Lys85 to Lys103, but not to Lys123, may constitute an NLS for GSK3β. To test if the subcellular localization of GSK3β constructs was independent of cell type, immunofluorescent microscopy and immunoblotting were used to examine the localization of each mutant in HeLa cells. Consistent with the results from HEK293 cells, K85A,K86A-GSK3β-HA, R96A-GSK3β-HA, and R102G,K103A-GSK3β-HA were largely excluded from the nucleus, whereas K122A,K123A-GSK3β and wild-type GSK3β-HA were readily detectable in the nucleus (Fig. 2, C–E). These data confirm the conclusion that mutations of Lys85 and Lys86, Arg96, or Arg102 and Lys103 impair the nuclear localization of GSK3β. To verify that these mutations in GSK3β impair nuclear import, rather than facilitate nuclear export, the subcellular localization of GSK3β was measured in HeLa cells treated with leptomycin B to inhibit CRM-1-dependent nuclear export, which has been reported to cause nuclear accumulation of endogenous GSK3β (2Bijur G.N. Jope R.S. J. Biol. Chem. 2001; 276: 37436-37442Abstract Full Text Full Text PDF PubMed Scopus (194) Google Scholar). This result was confirmed, since endogenous GSK3β accumulated in the nucleus of HeLa cells treated with leptomycin B for 5 h (Fig. 2F). However, little nuclear accumulation of expressed wild-type GSK3β or K122A,K123A-GSK3β-HA occurred following treatment with leptomycin B, suggesting that overexpression may circumvent the CRM-1 export mechanism. Nevertheless, even with leptomycin B treatment, little, if any, K85A,K86A-GSK3β-HA, R96A-GSK3β-HA, or R102G, K103A-GSK3β-HA was detected in the nucleus (Fig. 2G), indicating that these mutations impede nuclear import. Amino Acids 85–103 Are Sufficient for Nuclear Localization—The previous findings demonstrated that the region of GSK3β consisting of amino acids 85–103 may be an NLS. In order to test if this domain meets the criteria for an NLS of being sufficient to induce nuclear localization, a YFP fusion protein was constructed containing residues 85–103 of GSK3β on the C terminus (YFP-NLS). Expressed wild-type YFP visualized in live cells was present diffusely throughout the cells (Fig. 3A). In contrast, YFP-NLS preferentially accumulated in the nucleus. Measurements of the nuclear and cytosolic distributions of YFP and YFP-NLS demonstrated that the NLS was sufficient to drive the majority of the YFP-NLS into the nucleus in virtually all cells (Fig. 3B). Taken together with the data shown in Fig. 2, these results confirm that the region of GSK3β consisting of amino acids 85–103 is a bona fide bipartite NLS. GSK3 or its homologue is found in most eukaryotes. To determine if the NLS of human GSK3β is conserved, the sequences of several GSK3 homologues were compared. Alignment of the GSK3 sequences from several species demonstrated that the region containing the NLS, and particularly the identified critical basic residues, is highly conserved (Fig. 3C). The N Terminus of GSK3 Contributes to Regulating Nuclear GSK3β—The crystal structure and biochemical evidence indicate that the N terminus of GSK3β interacts with the primed substrate binding site through an intramolecular interaction (12Frame S. Cohen P. Biondi R.M. Mol. Cell. 2001; 7: 1321-1327Abstract Full Text Full Text PDF PubMed Scopus (577) Google Scholar, 17Dajani R. Fraser E. Roe S.M. Young N. Good V. Dale T.C. Pearl L.H. Cell. 2001; 105: 721-732Abstract Full Text Full Text PDF PubMed Scopus (588) Google Scholar). The primed binding site and the NLS overlap, indicating that the N terminus of GSK3β can interact with the NLS. Therefore, we considered the possibility that the N terminus of GSK3β might contribute to modulating the function of the NLS. To test this, two mutants of GSK3β were used: conversion of serine 9 to alanine (S9A-GSK3β-HA) to test if serine 9 phosphorylation is regulatory and truncation of the first 9 amino acids (Δ9-GSK3β-HA) to test if the N-terminal tail contributes to the function of the NLS. Wild-type GSK3β and each mutant were expressed in HeLa cells and immunoblots using anti-HA demonstrated equivalent expression levels of all three, and phospho-Ser9-GSK3β immunoblots verified the absence of serine 9 in the two mutant constructs (Fig. 4A). HeLa (Fig. 4B) or HEK293 (Fig. 4C) cells expressing wild-type GSK3β-HA, S9A-GSK3β-HA, or Δ9-GSK3β-HA were separated into cytosolic and nuclear fractions, and these were immunoblotted for GSK3β-HA. The levels of wild-type GSK3β-HA and S9A-GSK3β-HA were equivalent in the nucleus, but the level of Δ9-GSK3β-HA in the nucleus was 40% lower than wild-type GSK3β-HA. Localization in HeLa cells was also examined by immunocytochemistry, and this corroborated the biochemical finding of impaired nuclear localizat" @default.
• W2091240925 created "2016-06-24" @default.
• W2091240925 creator A5037199856 @default.
• W2091240925 creator A5076735606 @default.
• W2091240925 date "2007-06-01" @default.
• W2091240925 modified "2023-10-10" @default.
• W2091240925 title "Resolution of the Nuclear Localization Mechanism of Glycogen Synthase Kinase-3" @default.
• W2091240925 cites W1485363052 @default.
• W2091240925 cites W1603850560 @default.
• W2091240925 cites W1975815687 @default.
• W2091240925 cites W1994242450 @default.
• W2091240925 cites W2007937520 @default.
• W2091240925 cites W2011401291 @default.
• W2091240925 cites W2015839591 @default.
• W2091240925 cites W2017934591 @default.
• W2091240925 cites W2038073573 @default.
• W2091240925 cites W2053265248 @default.
• W2091240925 cites W2053692735 @default.
• W2091240925 cites W2054427773 @default.
• W2091240925 cites W2055116915 @default.
• W2091240925 cites W2055303877 @default.
• W2091240925 cites W2059624730 @default.
• W2091240925 cites W2060497474 @default.
• W2091240925 cites W2061170173 @default.
• W2091240925 cites W2064913654 @default.
• W2091240925 cites W2079718442 @default.
• W2091240925 cites W2083308747 @default.
• W2091240925 cites W2091014617 @default.
• W2091240925 cites W2092828528 @default.
• W2091240925 cites W2101968184 @default.
• W2091240925 cites W2108958930 @default.
• W2091240925 cites W2116435209 @default.
• W2091240925 cites W2120657906 @default.
• W2091240925 cites W2121745326 @default.
• W2091240925 cites W2125904354 @default.
• W2091240925 cites W2137312910 @default.
• W2091240925 cites W2142493853 @default.
• W2091240925 cites W2150843773 @default.
• W2091240925 cites W2161025693 @default.
• W2091240925 cites W2166599679 @default.
• W2091240925 cites W4256264762 @default.
• W2091240925 doi "https://doi.org/10.1074/jbc.m700610200" @default.
• W2091240925 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/1948884" @default.
• W2091240925 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/17438332" @default.
• W2091240925 hasPublicationYear "2007" @default.
• W2091240925 type Work @default.
• W2091240925 sameAs 2091240925 @default.
• W2091240925 citedByCount "111" @default.
• W2091240925 countsByYear W20912409252012 @default.
• W2091240925 countsByYear W20912409252013 @default.
• W2091240925 countsByYear W20912409252014 @default.
• W2091240925 countsByYear W20912409252015 @default.
• W2091240925 countsByYear W20912409252016 @default.
• W2091240925 countsByYear W20912409252017 @default.
• W2091240925 countsByYear W20912409252018 @default.
• W2091240925 countsByYear W20912409252019 @default.
• W2091240925 countsByYear W20912409252020 @default.
• W2091240925 countsByYear W20912409252021 @default.
• W2091240925 countsByYear W20912409252022 @default.
• W2091240925 countsByYear W20912409252023 @default.
• W2091240925 crossrefType "journal-article" @default.
• W2091240925 hasAuthorship W2091240925A5037199856 @default.
• W2091240925 hasAuthorship W2091240925A5076735606 @default.
• W2091240925 hasBestOaLocation W20912409251 @default.
• W2091240925 hasConcept C104629339 @default.
• W2091240925 hasConcept C112243037 @default.
• W2091240925 hasConcept C121332964 @default.
• W2091240925 hasConcept C12554922 @default.
• W2091240925 hasConcept C138268822 @default.
• W2091240925 hasConcept C154945302 @default.
• W2091240925 hasConcept C181199279 @default.
• W2091240925 hasConcept C182996813 @default.
• W2091240925 hasConcept C184235292 @default.
• W2091240925 hasConcept C185592680 @default.
• W2091240925 hasConcept C192118531 @default.
• W2091240925 hasConcept C2777499176 @default.
• W2091240925 hasConcept C41008148 @default.
• W2091240925 hasConcept C55493867 @default.
• W2091240925 hasConcept C62520636 @default.
• W2091240925 hasConcept C86803240 @default.
• W2091240925 hasConcept C89611455 @default.
• W2091240925 hasConcept C95444343 @default.
• W2091240925 hasConceptScore W2091240925C104629339 @default.
• W2091240925 hasConceptScore W2091240925C112243037 @default.
• W2091240925 hasConceptScore W2091240925C121332964 @default.
• W2091240925 hasConceptScore W2091240925C12554922 @default.
• W2091240925 hasConceptScore W2091240925C138268822 @default.
• W2091240925 hasConceptScore W2091240925C154945302 @default.
• W2091240925 hasConceptScore W2091240925C181199279 @default.
• W2091240925 hasConceptScore W2091240925C182996813 @default.
• W2091240925 hasConceptScore W2091240925C184235292 @default.
• W2091240925 hasConceptScore W2091240925C185592680 @default.
• W2091240925 hasConceptScore W2091240925C192118531 @default.
• W2091240925 hasConceptScore W2091240925C2777499176 @default.
• W2091240925 hasConceptScore W2091240925C41008148 @default.
• W2091240925 hasConceptScore W2091240925C55493867 @default.
• W2091240925 hasConceptScore W2091240925C62520636 @default.
• W2091240925 hasConceptScore W2091240925C86803240 @default.

• next