FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2091253809> ?p ?o ?g. }

• W2091253809 endingPage "2013" @default.
• W2091253809 startingPage "2004" @default.
• W2091253809 abstract "Article15 April 1997free access Aiolos, a lymphoid restricted transcription factor that interacts with Ikaros to regulate lymphocyte differentiation Bruce Morgan Bruce Morgan Cutaneous Biology Research Center, Mass General Hospital, Harvard Medical School, Charlestown, MA, 02129 UK Search for more papers by this author Lei Sun Lei Sun Cutaneous Biology Research Center, Mass General Hospital, Harvard Medical School, Charlestown, MA, 02129 UK Search for more papers by this author Nicole Avitahl Nicole Avitahl Cutaneous Biology Research Center, Mass General Hospital, Harvard Medical School, Charlestown, MA, 02129 UK Search for more papers by this author Konstantinos Andrikopoulos Konstantinos Andrikopoulos Cutaneous Biology Research Center, Mass General Hospital, Harvard Medical School, Charlestown, MA, 02129 UK Search for more papers by this author Tohru Ikeda Tohru Ikeda School of Dentistry, Showa University, Tokyo, Japan Search for more papers by this author Ellen Gonzales Ellen Gonzales Cutaneous Biology Research Center, Mass General Hospital, Harvard Medical School, Charlestown, MA, 02129 UK Search for more papers by this author Paul Wu Paul Wu Cutaneous Biology Research Center, Mass General Hospital, Harvard Medical School, Charlestown, MA, 02129 UK Search for more papers by this author Steve Neben Steve Neben Hemopoiesis Unit, Genetics Institute, Cambridge, MA, 02138 USA Search for more papers by this author Katia Georgopoulos Corresponding Author Katia Georgopoulos Cutaneous Biology Research Center, Mass General Hospital, Harvard Medical School, Charlestown, MA, 02129 UK Search for more papers by this author Bruce Morgan Bruce Morgan Cutaneous Biology Research Center, Mass General Hospital, Harvard Medical School, Charlestown, MA, 02129 UK Search for more papers by this author Lei Sun Lei Sun Cutaneous Biology Research Center, Mass General Hospital, Harvard Medical School, Charlestown, MA, 02129 UK Search for more papers by this author Nicole Avitahl Nicole Avitahl Cutaneous Biology Research Center, Mass General Hospital, Harvard Medical School, Charlestown, MA, 02129 UK Search for more papers by this author Konstantinos Andrikopoulos Konstantinos Andrikopoulos Cutaneous Biology Research Center, Mass General Hospital, Harvard Medical School, Charlestown, MA, 02129 UK Search for more papers by this author Tohru Ikeda Tohru Ikeda School of Dentistry, Showa University, Tokyo, Japan Search for more papers by this author Ellen Gonzales Ellen Gonzales Cutaneous Biology Research Center, Mass General Hospital, Harvard Medical School, Charlestown, MA, 02129 UK Search for more papers by this author Paul Wu Paul Wu Cutaneous Biology Research Center, Mass General Hospital, Harvard Medical School, Charlestown, MA, 02129 UK Search for more papers by this author Steve Neben Steve Neben Hemopoiesis Unit, Genetics Institute, Cambridge, MA, 02138 USA Search for more papers by this author Katia Georgopoulos Corresponding Author Katia Georgopoulos Cutaneous Biology Research Center, Mass General Hospital, Harvard Medical School, Charlestown, MA, 02129 UK Search for more papers by this author Author Information Bruce Morgan1, Lei Sun1, Nicole Avitahl1, Konstantinos Andrikopoulos1, Tohru Ikeda2, Ellen Gonzales1, Paul Wu1, Steve Neben3 and Katia Georgopoulos 1 1Cutaneous Biology Research Center, Mass General Hospital, Harvard Medical School, Charlestown, MA, 02129 UK 2School of Dentistry, Showa University, Tokyo, Japan 3Hemopoiesis Unit, Genetics Institute, Cambridge, MA, 02138 USA The EMBO Journal (1997)16:2004-2013https://doi.org/10.1093/emboj/16.8.2004 PDFDownload PDF of article text and main figures. ToolsAdd to favoritesDownload CitationsTrack CitationsPermissions ShareFacebookTwitterLinked InMendeleyWechatReddit Figures & Info Development of the lymphoid system is dependent on the activity of zinc finger transcription factors encoded by the Ikaros gene. Differences between the phenotypes resulting from a dominant-negative and a null mutation in this gene suggest that Ikaros proteins act in concert with another factor with which they form heterodimers. Here we report the cloning of Aiolos, a gene which encodes an Ikaros homologue that heterodimerizes with Ikaros proteins. In contrast to Ikaros_which is expressed from the pluripotent stem cell to the mature lymphocyte_Aiolos is first detected in more committed progenitors with a lymphoid potential and is strongly up-regulated as these differentiate into pre-T and pre-B cell precursors. The expression patterns of Aiolos and Ikaros, the relative transcriptional activity of their homo- and heteromeric complexes, and the dominant interfering effect of mutant Ikaros isoforms on Aiolos activity all strongly suggest that Aiolos acts in concert with Ikaros during lymphocyte development. We therefore propose that increasing levels of Ikaros and Aiolos homo- and heteromeric complexes in differentiating lymphocytes are essential for normal progression to a mature and immunocompetent state. Introduction The Ikaros gene encodes, by alternate splicing, a family of zinc finger transcription factors which are essential for the development of the lymphoid system (Georgopoulos et al., 1992, 1994; Hahm et al., 1994; Molnar and Georgopoulos, 1994). Ikaros is first detected in pluripotent hemopoietic stem cells and its expression is maintained at high levels in maturing lymphocytes. Mice homozygous for a deletion of the Ikaros DNA-binding domain lack committed lymphoid progenitors as well as mature T and B lymphocytes and natural killer cells (Georgopoulos et al., 1994). In addition to this apparent role in the early development of lymphoid progenitors, Ikaros is also required for later events during T cell maturation (Winandy et al., 1995). Mice heterozygous for this Ikaros mutation generate abnormal T cells. They develop lymphoproliferative disorders and ultimately die of T-cell leukemias and lymphomas. The Ikaros protein isoforms all share a common C-terminal domain containing two zinc fingers to which different combinations of N-terminal zinc fingers are appended. The N-terminal zinc fingers are required for sequence-specific DNA binding while the C-terminal zinc fingers mediate homo- and heterodimerization among the Ikaros isoforms (Molnar and Georgopoulos, 1994; Sun et al., 1996). Homo- and heterodimerization of isoforms with a DNA-binding domain greatly increases both their affinity for DNA and their transcriptional activity (Sun et al., 1996). Mutations that disrupt the C-terminal zinc fingers prevent Ikaros proteins from engaging in higher-order DNA interactions and from activating transcription (Sun et al., 1996). In addition, heterodimers which include one Ikaros isoform that lacks a DNA-binding domain are transcriptionally inert. Hence, such isoforms can interfere with the activity of Ikaros isoforms that contain a DNA-binding domain in a dominant-negative fashion. The last translated exon of the Ikaros gene shared by all of the Ikaros isoforms was targeted by deletion in the mouse germ line (Wang et al., 1996). This exon encodes the C-terminal dimerization domain of the Ikaros proteins as well as an activation domain that mediates their effects in transcription (Sun et al., 1996). Mice homozygous for this mutation display a phenotype that is less severe than that caused by deletion of the Ikaros DNA-binding domain. In the Ikaros C-terminal-mutant mice, fetal hemopoietic stem cells or their immediate progeny fail to enter the T and B lymphoid pathways. Throughout fetal life_and for a few days after birth_the thymus of these mice is devoid of a lymphoid compartment. In addition, pro-B and pre-B cells are not detected in the fetal liver of the Ikaros mutant embryos. However, during the first week after birth, increasing numbers of thymocyte precursors are seen in the thymus. These give rise to conventional αβ and some γδ T cells, but not to natural killer cells or any significant numbers of dendritic antigen-presenting cells (APCs). B cells and their earliest described precursors are also absent from the spleen, the peritoneum and bone marrow. In addition, mice heterozygous for this Ikaros mutation are not obviously abnormal. Given that the functionally inactive proteins generated by the Ikaros C-terminal mutant locus are unstable and rapidly degraded in cells in which they are produced, this mutation is considered a null for Ikaros activity (Wang et al., 1996). Therefore, the complete lack of adult T lymphocytes in mice homozygous for the Ikaros DNA binding deletion can be explained by a dominant interfering effect of the encoded mutant Ikaros isoform on another protein. This factor must work in concert with Ikaros to specify at least T cell identity in the late fetal and postnatal hemopoietic system. Since the zinc fingers in the Ikaros C-terminal domain display strong homology to the C-terminal zinc fingers of the Drosophila suppressor protein Hunchback (Tautz et al., 1987), it appears that this domain existed prior to the expansion of the vertebrate genome and may also be included in other proteins. These proteins would have the potential to interact with Ikaros proteins when co-expressed and may act in concert during lymphocyte differentiation. Such interactors would be candidate targets for the dominant-negative activity of the truncated Ikaros isoforms. To investigate this possibility, we used degenerate oligonucleotides to amplify the C-terminal zinc finger domain from the mouse genome. Aiolos was identified as a homolog of Ikaros whose expression is restricted to the lymphoid lineage. The Aiolos protein shows extensive homology to the largest Ikaros isoform, Ik-1, throughout the DNA binding and C-terminal domains. Aiolos homomeric complexes are potent transcriptional activators while heteromers between Aiolos and different Ikaros isoforms range in activity from slightly less potent to transcriptionally inert. Unlike Ikaros, Aiolos is not expressed in fetal hemopoietic sites or in the early fetal thymus. Aiolos mRNA is detected in the late fetal thymus and in the adult lymphoid organs. Within adult hemopoietic progenitors, Aiolos is not expressed in pluripotent stem cells but is detected at low levels in multipotent progenitors. Its expression is dramatically up-regulated as these progenitors become more restricted into the T and B lymphoid pathways. We propose that Aiolos and Ikaros act in concert during lymphocyte development in the late fetal and postnatal hemopoietic system. In the absence of Ikaros, partial overlap in function between the two genes may allow for T cell, but not B cell, specification by Aiolos. Results Functional domains are conserved between Aiolos and Ikaros PCR with degenerate primers from the domain conserved between Ikaros and Hunchback identified several genes in the mouse genome which encode a pair of zinc fingers similar to those that mediate dimerization of the Ikaros proteins. Of these, the Aiolos gene exhibits the greatest similarity to Ikaros and its expression is restricted in the hemopoietic system. cDNAs derived from this gene contain an open reading frame encoding a 58 kDa protein similar in size and structure to the Ik-1 isoform (Figure 1). Western analysis of thymic nuclear extracts with antisera raised against Aiolos identifies a single protein that migrates at a similar rate to that of the Ik-1 isoform (Figure 1B). The two proteins share an overall 70% similarity. Four blocks of sequence are particularly well conserved. The first encodes the zinc finger modules contained in the Ik-1 isoform which mediate DNA binding of the Ikaros protein (Molnar and Georgopoulos, 1994). The second block of conservation has not been characterized functionally. The third block of conservation is a domain required for transcriptional activation by Ikaros. The final block of conservation corresponds to the zinc fingers which mediate dimerization and were the basis of the screen. The 5′ region of the open reading frame is only weakly conserved. Figure 1.(A) Deduced amino acid sequence of Aiolos compared with the Ik-1 isoform. The Aiolos cDNA contains an open reading frame of 1521 nucleotides from which the amino acid sequence shown above was deduced. This sequence is compared with that of the largest Ikaros isoform, Ik-1 (shown below). The paired cysteine and histidine residues of the six zinc finger motifs are boxed. The conserved activation domain is shaded (290–344). Identical residues are indicated by bars, conservative substitutions are indicated by dots. (B) Western analysis of thymocyte nuclear extracts from Ikaros null (−/−) or wild-type (+/+) mice. Extracts from wild-type mice probed with an Ikaros antibody (raised to a protein that consists of exons 2, 4, 5, 6; also Molnar and Georgopoulos, 1994) show the expected 57 and 48 kDa species (solid arrowheads) derived from the Ikaros gene by alternative splicing (left panel). A faint cross-reacting species migrating slightly more slowly than the larger Ikaros isoform is observed in extracts from the mutant mice (open arrowhead) and reflects cross-reaction of the anti-Ikaros antibody with the Aiolos protein. At this same position, Aiolos protein (open arrowhead) is detected in identical extracts from both wild-type and Ikaros mutant thymocytes probed with an antibody (right panel) raised against an Aiolos-specific peptide (amino acids 296–450). Aiolos migrates slightly more slowly than Ik-1, with an apparent size of 58 kDa. Download figure Download PowerPoint Two highly conserved C-terminal zinc finger motifs mediate interactions between Aiolos and Ikaros proteins The C-terminal zinc fingers which mediate dimerization of the Ikaros proteins and were the basis of the screen are well conserved between the two proteins (Figure 1). The ability of the Aiolos C-terminal zinc finger domain to engage in protein interactions was tested in a yeast two-hybrid assay (Fields and Song, 1989; Zervos et al., 1993). In this system, the Aiolos C-terminal domain (Aio 500) interacted strongly with itself and with the equivalent Ikaros domain (Figure 2B; Aio 500 and Ik 500). It also interacted in a similar fashion with the full-length Aiolos and Ikaros proteins expressed by the recombinant pJG prey vectors (Figure 2B, Aio and Ik-1). This Aiolos zinc finger domain, however, did not interact with mutant Ikaros proteins which contain amino acid substitutions in their C-terminal zinc fingers that disrupt their ability to dimerize (Figure 2B, Ik-1 M1, M2 and M1 + M2; see also Sun et al., 1996). In a similar fashion, the equivalent Ikaros bait (Ik 500) interacted with recombinant prey proteins that contained either the C-terminal domain of Aiolos or Ikaros or the full-length proteins (Figure 2C, Aio 500, Aio 800, Aio, Ik 500 and Ik-1). In this assay, the affinities of Aiolos for itself or Ikaros are similar and indistinguishable to that of Ikaros for itself. Hence, formation of heterodimers between these two proteins would be expected when they are co-expressed. Figure 2.Aiolos can interact with self and with the Ikaros proteins through its two C-terminal zinc fingers. (A) Schematic representation of Aiolos and Ikaros baits and preys used in the yeast two-hybrid system. The structures of the Aiolos and Ik-1 proteins are shown diagrammatically. The zinc fingers required for DNA binding are indicated as vertical white rectangles, while the fingers required for dimerization are indicated as vertical black rectangles. Aiolos and Ikaros domains used in the yeast two-hybrid assay are shown with arrows. (B and C) Indicate interactions between Aiolos and Ikaros proteins. (B) A domain in Aiolos that contains the last two Krüppel-like zinc fingers (Aio 500) interacts with itself either as an isolated domain (Aio 500, Aio 800) or in the context of the full-length protein (Aio). Similar interactions are observed with the analogous Ikaros domain alone or in the context of the full-length protein (Ik 500 and Ik-1). Mutations in the Ikaros zinc finger motifs (Ik-1 M1, M2 and M1+M2) abrogate such Aiolos–Ikaros protein interactions. In contrast to the C-terminal fingers, the N-terminal finger motifs (Ik-N) are not capable of mediating such protein interactions. pJG is the prey vector used as a negative control. (C) When the Ikaros dimerization domain is used as bait, identical results are observed with this battery of prey constructs. The kinetics by which these colonies turn blue on indicator plates suggests that the affinities of Aiolos for itself and for Ikaros are similar. Download figure Download PowerPoint In vivo physical interactions between the Aiolos and Ikaros proteins Complexes between endogenous Aiolos and Ikaros proteins can be detected in lymphocytes by co-immunoprecipitation. Immunoprecipitation of nuclear extracts from thymocytes with an affinity-purified antibody directed against Aiolos co-precipitates Ikaros proteins (Figure 3A, lane 2). Interactions between these proteins is mediated by their C-terminal zinc fingers. When co-transfected into fibroblast cells with epitope-tagged (Brizzard et al., 1994) Aiolos, Ikaros protein is co-precipitated with an antibody to the tagged Aiolos protein (Figure 3A, lane 3). Point mutations in the zinc finger domain which prevent Ikaros protein interactions (Sun et al., 1996) also prevent co-precipitation of Aiolos and Ikaros proteins in this assay (Figure 3A, lane 4). Figure 3.Interactions between Aiolos and Ikaros proteins are detected within the cell nucleus. (A) Aiolos and Ikaros form complexes in lymphocytes. Nuclear extracts prepared from primary lymphocytes were immunoprecipitated with an affinity-purified antibody to Aiolos which does not cross-react with Ikaros (see Figure 1B). The immunoprecipitate was fractionated on an SDS-acrylamide gel and detected with an antibody to Ikaros. The total nuclear extract contains three bands which react to the Ikaros antibody (lane 1). Two of these bands, corresponding to the 57 and 48 kDa Ikaros isoforms are co-precipitated by the Aiolos antibody. This interaction is also observed in transfected cells. Aiolos–(Flag) and Ikaros proteins expressed in the epithelial cell line 293T were immunoprecipitated using an antibody to the Flag epitope. Immunoprecipitates were run on a 10% SDS gel and analyzed by Western blotting with an Ikaros antibody (lanes 3–5). The positions of Ikaros and Aiolos–Flag are indicated by the upper and lower arrows, respectively. Ikaros–Aiolos complexes were immunoprecipitated by the Flag antibody (lane 3), but the dimerization mutant IkM (Sun et al., 1996) was not precipitated when co-expressed with Aiolos (lane 4). No Ikaros was observed in immunoprecipitates from untransfected controls (lane 5). To confirm the levels of Ikaros and Aiolos protein produced in the transfected cells, Western analyses on total protein were performed with the Ikaros (lanes 6–8) and Flag (lanes 9–11) antibodies. Similar amounts of Ik-1 (lane 6) or IkM (lane 7) and Aiolos proteins (lanes 9 and 10) were produced in both transfected populations. No immunoreactivity was observed in untransfected cells (lanes 8 and 11). These results confirm that Aiolos and Ikaros form stable heterodimers in solution via their C-terminal zinc finger motifs. (B) NIH 3T3 fibroblasts were transfected with Aiolos–Flag, Ik-1 and Ik-6 expression vectors either alone or together. Cells were stained with anti-Ikaros and with anti-Flag antibodies (Sun et al., 1996). When transfected alone, Aiolos and Ik-1 proteins show punctate nuclear staining (panels 1 and 2) while Ik-6 is detected throughout the cytoplasm (panel 3). When Aiolos is co-transfected with Ik-6, the Ik-6 protein is found in the nucleus (panel 4). Note that in cells transfected with both proteins (Ik-1 and Aiolos) Ikaros detected with FITC-conjugated secondary antibody and Aiolos detected with rhodamine-conjugated secondary antibody are found in similar locations within the nucleus (panels 5 and 7). When superimposed, the red and green signals generate a yellow signal confirming the co-localization of these proteins (panel 6). Endogenous Ikaros detected in thymocytes also displays this punctate pattern of nuclear staining (panel 8), as does endogenous Aiolos (panel 9). Download figure Download PowerPoint The interaction between these proteins can also be observed directly (Figure 3B). Unlike most Ikaros isoforms, the Ik-6 isoform lacks a DNA-binding domain and is normally found in the cytoplasm (Figure 3B, panel 3). When co-expressed with Aiolos, Ik-6 is detected in the nucleus (Figure 3B, panel 4). Immunofluorescence reveals a punctate pattern of nuclear staining for both Ikaros and Aiolos proteins (Figure 3B, panels 5–7). This pattern is similar to that of RING finger proteins like PML and members of the polycomb group (Messmer et al., 1992; Borden et al., 1995). When Aiolos is co-expressed with an Ikaros isoform that is localized to the nucleus, both proteins are detected within the same nuclear speckles. Hence, Aiolos dimerizes with Ikaros proteins and localizes to the same discrete regions within the nucleus. The nuclear speckle staining of endogenous Aiolos proteins is also detected in thymocytes and peripheral T and B cells (Figure 3B, panel 9 and data not shown). A very similar pattern is observed with Ikaros proteins in these primary lymphocytes (Figure 3B, panel 8). Conserved function of the N-terminal zinc finger DNA-binding domain in Aiolos and Ikaros proteins A second block of conservation spans the N-terminal zinc finger domain of Ikaros which mediates its DNA binding (Molnar and Georgopoulos, 1994). Contacts between DNA and the α-helical region in the C-terminal half of Krüppel-like zinc fingers are important in determining the sequence specificity of these interactions (Lee et al., 1989; Pavletich and Pabo, 1993). These regions are perfectly conserved between Aiolos and Ikaros (Figure 1) and both proteins are capable of binding the same DNA sequences with similar affinity. As demonstrated by EMSA, both Aiolos and Ikaros proteins form similar high-affinity complexes with an oligonucleotide containing a binding site for the Ik-1 protein (Figure 4A). Furthermore, competition with specific and mutated oligonucleotides show that these proteins have similar affinities for this binding site. Hence, Aiolos and Ikaros can, in principle, compete for target sites in the genome. Figure 4.DNA binding and activation properties of the Aiolos protein. (A) The Aiolos protein binds with high affinity to Ikaros sites. EMSAs were performed with 0.5 μg of Ikaros (lanes 1–7) and Aiolos (lanes 8–14) proteins and a single high-affinity Ikaros binding site IK-BS1 TCAGCTTTTGGGAATACCCTGTCA (100 000 c.p.m./1–2 ng). The prominent shifted band is specifically competed by an increasing molar excess of unlabeled Ik-BS1 (4-fold, lanes 2 and 9; 8-fold, lanes 3 and 10; 16-fold, lanes 4 and 11; 40-fold, lanes 5 and 12) but was not competed by the Ik-BS8 variant oligonucleotide with two base changes in the core binding motif (GGGGG for GGGAA; 16-fold excess, lanes 6 and 13; 40-fold excess, lanes 7 and 14). (B) Aiolos and Ikaros homo- and heterodimers activate transcription in NIH 3T3 fibroblasts. Aiolos and the Ikaros isoforms Ik-1 and Ik-6 were co-transfected at different ratios together with the Ikaros–tkCAT reporter gene in NIH 3T3 cells (see Materials and methods). Numbers in parentheses refer to the μg of plasmid transfected. The amounts of Aiolos and Ikaros proteins expressed in the transfected fibroblasts was determined by Western analysis using Ikaros and Flag antibodies (data not shown). Aiolos and Ikaros proteins were expressed at similar levels, but the levels of CAT activity elicited by Aiolos were higher than those observed with Ik-1, the most potent activator of the Ikaros isoforms. Co-expression of Ikaros and Aiolos proteins stimulated expression of the reporter gene to levels intermediate between those seen with Aiolos or Ikaros homodimers [Aiolos (10) versus Aiolos (5) + Ik-1(5) versus Ik-1 (10)]. However, when Aiolos was co-expressed with one of the Ikaros isoforms that lacks a DNA-binding domain, its activity was drastically reduced. The transfected transcription factors were limiting throughout the range employed as shown by the linear increase in CAT activity which resulted when an activating form of Ikaros (Ik-1) was co-transfected with Aiolos. This suggests that the resulting Aiolos–Ik-6 heterodimers are transcriptionally inert, possibly due to their inability to bind DNA. Download figure Download PowerPoint Alternative splicing leads to the production of multiple Ikaros isoforms with different combinations of N-terminal zinc fingers appended to the common C-terminal domain. The messages encoding these isoforms are readily detectable by PCR using primers from exons 2, 3 and 7 of the Ikaros gene (Figure 6-Ik; see also Molnar and Georgopoulos, 1994). In contrast, PCR analysis performed with analogous primers derived from the Aiolos cDNA detected a single cDNA species (data not shown and Figure 6, Aio). Indeed, analysis with primers designed from Aiolos sequence corresponding to each of the exons in Ikaros failed to detect alternatively spliced products (data not shown). Western analysis of thymic nuclear extracts revealed a single protein which reacts with an antibody raised against Aiolos (Figure 1B). Aiolos is a more potent transcriptional activator than Ikaros Although the third block of conservation has not been characterized functionally, the fourth conserved block is a domain required by Ikaros for transcriptional activation (Sun et al., 1996). This activation domain is composed of a stretch of acidic amino acids followed by a stretch of hydrophobic residues, both of which are required for its full activation potential. Despite the similarity between Aiolos and Ikaros in this region, Aiolos is a stronger activator in mammalian cells. When co-transfected into fibroblast cells with a tkCAT reporter construct under the control of four copies of a single high-affinity Ikaros binding site, Aiolos stimulated CAT activity by 25- to 50-fold [Figure 4B, Aio (5) and Aio (10)]. In contrast, Ik-1, the strongest transcriptional activator of the Ikaros family (Molnar and Georgopoulos, 1994), elicited a 12- to 25-fold increase in expression in this assay [Figure 4B, Ik-1 (5) and (10)]. Therefore, Aiolos homodimers can compete with Ikaros homodimers for binding sites and can stimulate transcription to higher levels. The net activity of resulting Ikaros–Aiolos mixtures was estimated by co-expressing both proteins in fibroblasts at different ratios. These data suggest that Ikaros–Aiolos heterodimers have transcriptional activity which is intermediate between the activities of Aiolos and Ikaros homodimers [Figure 4B, Aio (10), Aio (5) + Ik-1 (5), Ik-1 (10)]. Ikaros isoforms which lack a DNA-binding domain interfere with the transcriptional activity of Aiolos proteins when both are expressed in the same cell (Figure 4B, Aiolos + Ik-6). Similar results were obtained when Ikaros isoforms with and without a DNA-binding domain were co-expressed (Sun et al., 1996). Heterodimers formed between these two functionally distinct Ikaros isoforms do not bind DNA and consequently cannot activate transcription (Sun et al., 1996). The dramatic decrease in Aiolos activity is most probably due to the formation of such functionally inactive Aiolos–Ikaros heterodimers. Transfection with equimolar amounts of Aiolos and an Ikaros isoform that lacks a DNA-binding domain (Ik-6) leads to the 65% reduction in CAT activity expected if Aiolos–Ik-6 heterodimers are transcriptionally inert. Addition of higher levels of Ik-6 further reduces transcription of the reporter gene. This effect is specific for the interfering isoform, since addition of similar amounts of an Ikaros isoform with an intact DNA-binding domain leads to a linear increase in transcriptional activity [Figure 4B, Aio 5 + Ik-1 (5–15)]. Aiolos expression is restricted to the lymphoid system In the adult mouse, Aiolos transcripts are detected exclusively in lymphoid tissues and are ∼9 and 4.5 kb in size (Figure 5A). Aiolos expression levels are highest in the spleen, progressively lower in the thymus and bone marrow, and undetectable in non-lymphoid tissues. The spleen is largely populated by mature B and T lymphocytes, while the majority of cells in the thymus are immature CD4+/CD8+ thymocytes which are in the process of rearranging their T-antigen receptors. In the bone marrow, ∼25% of the cells are pre-B cells at a stage of differentiation comparable with that of double-positive thymocytes, while the remainder are predominately erythroid and myeloid precursors. Aiolos mRNAs are not detected in the bone marrow of Ikaros dominant-negative mutant mice, the marrow being comprised largely of erythroid and myeloid cells and lacking detectable numbers of committed lymphoid precursors. These observations suggest that Aiolos is expressed predominantly in precursors of the B and T lineage, and is up-regulated upon their terminal differentiation. Figure 5.Aiolos expression in the adult and fetal hemo-lymphopoietic system. (A) Total RNAs (10–20 mg) from thymus (T), spleen (S) and bone marrow (BM) of wild-type mice and from bone marrow of mice homozygous for a mutation in the Ikaros DNA-binding domain (Ik) were used for Northern analysis. A 330 bp fragment derived from the last translated exon of Aiolos which does not cross-react with Ikaros sequences was used as a probe to detect Aiolos transcripts of 4.5 and 9 kb. Aiolos was not detected in RNA from brain (B), heart (H), kidney (K) or liver (L) of a wild-type mouse. Arrows indicate the position of 4.5 and 9 kb transcripts on both blots. A probe from GAP" @default.
• W2091253809 created "2016-06-24" @default.
• W2091253809 creator A5066834159 @default.
• W2091253809 date "1997-04-15" @default.
• W2091253809 modified "2023-10-18" @default.
• W2091253809 title "Aiolos, a lymphoid restricted transcription factor that interacts with Ikaros to regulate lymphocyte differentiation" @default.
• W2091253809 cites W1260885512 @default.
• W2091253809 cites W1479721949 @default.
• W2091253809 cites W1570758035 @default.
• W2091253809 cites W1588840730 @default.
• W2091253809 cites W1883290480 @default.
• W2091253809 cites W1929966198 @default.
• W2091253809 cites W1975969909 @default.
• W2091253809 cites W1989645452 @default.
• W2091253809 cites W1994911637 @default.
• W2091253809 cites W1996441373 @default.
• W2091253809 cites W1999870633 @default.
• W2091253809 cites W2000230310 @default.
• W2091253809 cites W2007243966 @default.
• W2091253809 cites W2019338546 @default.
• W2091253809 cites W2030333654 @default.
• W2091253809 cites W2032205265 @default.
• W2091253809 cites W2048365283 @default.
• W2091253809 cites W2068903461 @default.
• W2091253809 cites W2069501059 @default.
• W2091253809 cites W2070994243 @default.
• W2091253809 cites W2080801585 @default.
• W2091253809 cites W2100634503 @default.
• W2091253809 cites W2104931922 @default.
• W2091253809 cites W2126464081 @default.
• W2091253809 cites W2127321901 @default.
• W2091253809 cites W2140489687 @default.
• W2091253809 cites W2143041969 @default.
• W2091253809 cites W2154032335 @default.
• W2091253809 cites W81453212 @default.
• W2091253809 doi "https://doi.org/10.1093/emboj/16.8.2004" @default.
• W2091253809 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/1169803" @default.
• W2091253809 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/9155026" @default.
• W2091253809 hasPublicationYear "1997" @default.
• W2091253809 type Work @default.
• W2091253809 sameAs 2091253809 @default.
• W2091253809 citedByCount "333" @default.
• W2091253809 countsByYear W20912538092012 @default.
• W2091253809 countsByYear W20912538092013 @default.
• W2091253809 countsByYear W20912538092014 @default.
• W2091253809 countsByYear W20912538092015 @default.
• W2091253809 countsByYear W20912538092016 @default.
• W2091253809 countsByYear W20912538092017 @default.
• W2091253809 countsByYear W20912538092018 @default.
• W2091253809 countsByYear W20912538092019 @default.
• W2091253809 countsByYear W20912538092020 @default.
• W2091253809 countsByYear W20912538092021 @default.
• W2091253809 countsByYear W20912538092022 @default.
• W2091253809 countsByYear W20912538092023 @default.
• W2091253809 crossrefType "journal-article" @default.
• W2091253809 hasAuthorship W2091253809A5066834159 @default.
• W2091253809 hasBestOaLocation W20912538092 @default.
• W2091253809 hasConcept C104317684 @default.
• W2091253809 hasConcept C109159458 @default.
• W2091253809 hasConcept C148738053 @default.
• W2091253809 hasConcept C167672396 @default.
• W2091253809 hasConcept C203014093 @default.
• W2091253809 hasConcept C2779341262 @default.
• W2091253809 hasConcept C28328180 @default.
• W2091253809 hasConcept C2908554999 @default.
• W2091253809 hasConcept C3020391436 @default.
• W2091253809 hasConcept C47742525 @default.
• W2091253809 hasConcept C54355233 @default.
• W2091253809 hasConcept C79904392 @default.
• W2091253809 hasConcept C86339819 @default.
• W2091253809 hasConcept C86803240 @default.
• W2091253809 hasConcept C8891405 @default.
• W2091253809 hasConcept C94966510 @default.
• W2091253809 hasConcept C95444343 @default.
• W2091253809 hasConceptScore W2091253809C104317684 @default.
• W2091253809 hasConceptScore W2091253809C109159458 @default.
• W2091253809 hasConceptScore W2091253809C148738053 @default.
• W2091253809 hasConceptScore W2091253809C167672396 @default.
• W2091253809 hasConceptScore W2091253809C203014093 @default.
• W2091253809 hasConceptScore W2091253809C2779341262 @default.
• W2091253809 hasConceptScore W2091253809C28328180 @default.
• W2091253809 hasConceptScore W2091253809C2908554999 @default.
• W2091253809 hasConceptScore W2091253809C3020391436 @default.
• W2091253809 hasConceptScore W2091253809C47742525 @default.
• W2091253809 hasConceptScore W2091253809C54355233 @default.
• W2091253809 hasConceptScore W2091253809C79904392 @default.
• W2091253809 hasConceptScore W2091253809C86339819 @default.
• W2091253809 hasConceptScore W2091253809C86803240 @default.
• W2091253809 hasConceptScore W2091253809C8891405 @default.
• W2091253809 hasConceptScore W2091253809C94966510 @default.
• W2091253809 hasConceptScore W2091253809C95444343 @default.
• W2091253809 hasIssue "8" @default.
• W2091253809 hasLocation W20912538091 @default.
• W2091253809 hasLocation W20912538092 @default.
• W2091253809 hasLocation W20912538093 @default.
• W2091253809 hasLocation W20912538094 @default.
• W2091253809 hasOpenAccess W2091253809 @default.
• W2091253809 hasPrimaryLocation W20912538091 @default.

• next