FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2091262927> ?p ?o ?g. }

• W2091262927 endingPage "27291" @default.
• W2091262927 startingPage "27286" @default.
• W2091262927 abstract "Y-family (lesion-bypass) DNA polymerases show the same overall structural features seen in other members of the polymerase superfamily, yet their active sites are more open, with fewer contacts to the DNA and nucleotide substrates. This raises the question of whether analogous active-site side chains play equivalent roles in the bypass polymerases and their classical DNA polymerase counterparts. In Klenow fragment, an A-family DNA polymerase, the steric gate side chain (Glu710) not only prevents ribonucleotide incorporation but also plays an important role in discrimination against purine-pyrimidine mispairs. In this work we show that the steric gate (Phe12) of the Y-family polymerase Dbh plays a very minor role in fidelity, despite its analogous role in sugar selection. Using ribonucleotide discrimination to report on the positioning of a mispaired dNTP, we found that the pyrimidine of a Pu-dPyTP nascent mispair occupies a similar position to that of a correctly paired dNTP in the Dbh active site, whereas in Klenow fragment the mispaired dNTP sits higher in the active site pocket. If purine-pyrimidine mispairs adopt the expected wobble geometry, the difference between the two polymerases can be attributed to the binding of the templating base, with the looser binding site of Dbh permitting a variety of template conformations with only minimal adjustment at the incoming dNTP. In Klenow fragment the templating base is more rigidly held, so that changes in base pair geometry would affect the dNTP position, allowing the Glu710 side chain to serve as a sensor of nascent mispairs. Y-family (lesion-bypass) DNA polymerases show the same overall structural features seen in other members of the polymerase superfamily, yet their active sites are more open, with fewer contacts to the DNA and nucleotide substrates. This raises the question of whether analogous active-site side chains play equivalent roles in the bypass polymerases and their classical DNA polymerase counterparts. In Klenow fragment, an A-family DNA polymerase, the steric gate side chain (Glu710) not only prevents ribonucleotide incorporation but also plays an important role in discrimination against purine-pyrimidine mispairs. In this work we show that the steric gate (Phe12) of the Y-family polymerase Dbh plays a very minor role in fidelity, despite its analogous role in sugar selection. Using ribonucleotide discrimination to report on the positioning of a mispaired dNTP, we found that the pyrimidine of a Pu-dPyTP nascent mispair occupies a similar position to that of a correctly paired dNTP in the Dbh active site, whereas in Klenow fragment the mispaired dNTP sits higher in the active site pocket. If purine-pyrimidine mispairs adopt the expected wobble geometry, the difference between the two polymerases can be attributed to the binding of the templating base, with the looser binding site of Dbh permitting a variety of template conformations with only minimal adjustment at the incoming dNTP. In Klenow fragment the templating base is more rigidly held, so that changes in base pair geometry would affect the dNTP position, allowing the Glu710 side chain to serve as a sensor of nascent mispairs. Dbh 2The abbreviations used are: Dbh, DinB homologue; dNTP, deoxyribonucleoside triphosphate; rNTP, ribonucleoside triphosphate; Pu, purine; Py, pyrimidine.2The abbreviations used are: Dbh, DinB homologue; dNTP, deoxyribonucleoside triphosphate; rNTP, ribonucleoside triphosphate; Pu, purine; Py, pyrimidine. (DinB homologue) is a Y-family DNA polymerase from the thermophilic archaebacterium Sulfolobus acidocaldarius. Y-family polymerases comprise a diverse group of low fidelity enzymes that are specialized for a mode of DNA synthesis that involves bypass of DNA damage or helix distortions (1Ohmori H. Friedberg E.C. Fuchs R.P. Goodman M.F. Hanaoka F. Hinkle D. Kunkel T.A. Lawrence C.W. Livneh Z. Nohmi T. Prakash L. Prakash S. Todo T. Walker G.C. Wang Z. Woodgate R. Mol. Cell. 2001; 8: 7-8Abstract Full Text Full Text PDF PubMed Scopus (734) Google Scholar). The replication fidelity of Dbh (and DinB polymerases from other organisms) is ∼102 to 103 lower than that of the “classical” replicative and repair polymerases exemplified by families A and B (2Potapova O. Grindley N.D.F. Joyce C.M. J. Biol. Chem. 2002; 277: 28157-28166Abstract Full Text Full Text PDF PubMed Scopus (52) Google Scholar, 3Kokoska R.J. Bebenek K. Boudsocq F. Woodgate R. Kunkel T.A. J. Biol. Chem. 2002; 277: 19633-19638Abstract Full Text Full Text PDF PubMed Scopus (95) Google Scholar, 4Fiala K.A. Suo Z. Biochemistry. 2004; 43: 2106-2115Crossref PubMed Scopus (109) Google Scholar, 5Kobayashi S. Valentine M.R. Pham P. O'Donnell M. Goodman M.F. J. Biol. Chem. 2002; 277: 34198-34207Abstract Full Text Full Text PDF PubMed Scopus (120) Google Scholar). Structures have been solved for several Y-family polymerases: Dbh and its close homologue Dpo4 (from Sulfolobus solfataricus), as well as eukaryotic DNA polymerases η, ι, and κ (6Zhou B.L. Pata J.D. Steitz T.A. Mol. Cell. 2001; 8: 427-437Abstract Full Text Full Text PDF PubMed Scopus (179) Google Scholar, 7Silvian L.F. Toth E.A. Pham P. Goodman M.F. Ellenberger T. Nat. Struct. Biol. 2001; 8: 984-989Crossref PubMed Scopus (158) Google Scholar, 8Trincao J. Johnson R.E. Escalante C.R. Prakash S. Prakash L. Aggarwal A.K. Mol. Cell. 2001; 8: 417-426Abstract Full Text Full Text PDF PubMed Scopus (301) Google Scholar, 9Nair D.T. Johnson R.E. Prakash S. Prakash L. Aggarwal A.K. Nature. 2004; 430: 377-380Crossref PubMed Scopus (258) Google Scholar, 10Uljon S.N. Johnson R.E. Edwards T.A. Prakash S. Prakash L. Aggarwal A.K. Structure (Camb.). 2004; 12: 1395-1404Abstract Full Text Full Text PDF PubMed Scopus (93) Google Scholar). The global subdomain arrangements of Y-family polymerases are similar to the “right-hand” structures previously described for high fidelity polymerases but, compared with high fidelity polymerases, bypass polymerases have a more open active site with fewer contacts to the DNA and nucleotide substrates. Moreover, the Y-family polymerase structures do not show evidence for a conformational transition of the fingers subdomain analogous to the fingers-closing motion that allows higher fidelity polymerases to envelop the nascent base pair in an extremely snug binding pocket (11Li Y. Korolev S. Waksman G. EMBO J. 1998; 17: 7514-7525Crossref PubMed Scopus (654) Google Scholar, 12Li Y. Waksman G. Protein Sci. 2001; 10: 1225-1233Crossref PubMed Scopus (75) Google Scholar, 13Doublié S. Tabor S. Long A. Richardson C.C. Ellenberger T. Nature. 1998; 391: 251-258Crossref PubMed Scopus (1100) Google Scholar, 14Huang H. Chopra R. Verdine G.L. Harrison S.C. Science. 1998; 282: 1669-1675Crossref PubMed Scopus (1355) Google Scholar, 15Franklin M.C. Wang J. Steitz T.A. Cell. 2001; 105: 657-667Abstract Full Text Full Text PDF PubMed Scopus (488) Google Scholar, 16Johnson S.J. Taylor J.S. Beese L.S. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 3895-3900Crossref PubMed Scopus (261) Google Scholar, 17Sawaya M.R. Prasad R. Wilson S.H. Kraut J. Pelletier H. Biochemistry. 1997; 36: 11205-11215Crossref PubMed Scopus (574) Google Scholar). The more open active site of the Y-family polymerases is thought to facilitate lesion bypass at the expense of compromising polymerase fidelity (18Goodman M.F. Annu. Rev. Biochem. 2002; 71: 17-50Crossref PubMed Scopus (625) Google Scholar). Despite the difference in active site tightness between bypass and high fidelity polymerases, we have shown that Dbh discriminates against ribonucleotides with a stringency similar to that seen in A- and B-family DNA polymerases and reverse transcriptases (19DeLucia A.M. Grindley N.D.F. Joyce C.M. Nucleic Acids Res. 2003; 31: 4129-4137Crossref PubMed Scopus (67) Google Scholar). In all cases, selection of the appropriate (deoxyribose) sugar is mediated by the so-called “steric gate” side chain, located on the floor of the binding pocket, which makes an unfavorable interaction with the 2′-OH group of an incoming rNTP (19DeLucia A.M. Grindley N.D.F. Joyce C.M. Nucleic Acids Res. 2003; 31: 4129-4137Crossref PubMed Scopus (67) Google Scholar, 20Astatke M. Ng K. Grindley N.D.F. Joyce C.M. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 3402-3407Crossref PubMed Scopus (181) Google Scholar, 21Bonnin A. Lázaro J.M. Blanco L. Salas M. J. Mol. Biol. 1999; 290: 241-251Crossref PubMed Scopus (74) Google Scholar, 22Yang G. Franklin M.C. Li J. Lin T.C. Konigsberg W. Biochemistry. 2002; 41: 10256-10261Crossref PubMed Scopus (75) Google Scholar, 23Gao G. Orlova M. Georgiadis M.M. Hendrickson W.A. Goff S.P. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 407-411Crossref PubMed Scopus (162) Google Scholar, 24Gardner A.F. Jack W.E. Nucleic Acids Res. 1999; 27: 2545-2553Crossref PubMed Scopus (100) Google Scholar, 25Cases-González C.E. Gutiérrez-Rivas M. Menéndez-Arias L. J. Biol. Chem. 2000; 275: 19759-19767Abstract Full Text Full Text PDF PubMed Scopus (70) Google Scholar). The steric gate residue is an invariant glutamate (Glu710 in Klenow fragment) in A-family polymerases, an invariant tyrosine in B-family polymerases, and it is conserved as Phe or Tyr in the Y-family and reverse transcriptases. Previous work established that Glu710 of Klenow fragment not only functions in sugar selection but also plays an important role in fidelity by providing discrimination against purine-pyrimidine mismatches (20Astatke M. Ng K. Grindley N.D.F. Joyce C.M. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 3402-3407Crossref PubMed Scopus (181) Google Scholar, 26Minnick D.T. Liu L. Grindley N.D.F. Kunkel T.A. Joyce C.M. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 1194-1199Crossref PubMed Scopus (44) Google Scholar). The E710A mutant of Klenow fragment is a strong mutator for errors in which an incoming pyrimidine nucleotide is mispaired opposite a template purine (Pu-dPyTP mispairs). Kinetic studies with wild-type and E710A Klenow fragment led to a model for the binding of purine-pyrimidine mismatches at the active site, in which Glu710 plays an important role in excluding mismatches from the nascent base pair binding pocket (26Minnick D.T. Liu L. Grindley N.D.F. Kunkel T.A. Joyce C.M. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 1194-1199Crossref PubMed Scopus (44) Google Scholar). In the current study, we explore how the active site of a bypass polymerase (Dbh) compares with that of a high fidelity DNA polymerase (Klenow fragment) by investigating whether the steric gate side chain (Phe12) of Dbh plays a role in purinepyrimidine mismatch fidelity analogous to that of Klenow fragment Glu710. Because dNTP/rNTP discrimination reports the position of the incoming nucleotide relative to the steric gate side chain (19DeLucia A.M. Grindley N.D.F. Joyce C.M. Nucleic Acids Res. 2003; 31: 4129-4137Crossref PubMed Scopus (67) Google Scholar), we have used this as a diagnostic for the geometry of nascent mispairs bound to Dbh and Klenow fragment. Our findings suggest there are significant differences in the way these two DNA polymerases accommodate nascent mispairs. Materials—DNA oligonucleotides were synthesized by the Keck Biotechnology Resource Laboratory at Yale Medical School. Duplex DNA substrates for kinetic experiments, 5′-labeled on the primer strand, were prepared by annealing appropriate template and primer strands. Ultrapure dNTPs and rNTPs were purchased from Amersham Biosciences, except for rTTP, which was from TriLink Biotechnologies. Purification of Dbh (wild-type and F12A) and 3′-5′ exonuclease-deficient Klenow fragment (D424A) proteins followed our standard procedures (19DeLucia A.M. Grindley N.D.F. Joyce C.M. Nucleic Acids Res. 2003; 31: 4129-4137Crossref PubMed Scopus (67) Google Scholar, 27Joyce C.M. Derbyshire V. Methods Enzymol. 1995; 262: 3-13Crossref PubMed Scopus (64) Google Scholar). Klenow fragment derivatives relevant to this work all carry the D424A mutation but are described here simply by the genotype of their polymerase domain. Kinetic Measurements—All kinetic measurements were carried out under single turnover conditions, using a rapid quench-flow instrument (KinTek Corp., model RQF-3) for reactions that were too fast to stop by manual quenching. For Klenow fragment, reactions were carried out at 22 °C as described previously (26Minnick D.T. Liu L. Grindley N.D.F. Kunkel T.A. Joyce C.M. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 1194-1199Crossref PubMed Scopus (44) Google Scholar). For Dbh, measurements were made at 37 °C, based on our published methods (2Potapova O. Grindley N.D.F. Joyce C.M. J. Biol. Chem. 2002; 277: 28157-28166Abstract Full Text Full Text PDF PubMed Scopus (52) Google Scholar, 19DeLucia A.M. Grindley N.D.F. Joyce C.M. Nucleic Acids Res. 2003; 31: 4129-4137Crossref PubMed Scopus (67) Google Scholar) with the following modifications. Reactions were initiated by mixing equal volumes of a dNTP or rNTP solution with a preincubated Dbh-DNA solution. In each reaction extra MgCl2 (equimolar with the dNTP or rNTP) was provided in addition to the 10 mm MgCl2 already present in the Dbh reaction buffer. All reaction products were analyzed as described previously (2Potapova O. Grindley N.D.F. Joyce C.M. J. Biol. Chem. 2002; 277: 28157-28166Abstract Full Text Full Text PDF PubMed Scopus (52) Google Scholar). Misinsertion Kinetics for Wild-type and F12A Dbh—To investigate whether the steric gate residue (Phe12) of Dbh plays a role in polymerase fidelity that is analogous to that of the steric gate residue (Glu710) in Klenow fragment, we measured the discrimination against T-dGTP and G-dTTP misinsertions by wild-type and F12A Dbh (Table 1). The rate of incorporation (kobs) of the correct and incorrect nucleotide was measured at a series of nucleotide concentrations under single-turnover conditions at 37 °C. From plots of the first-order rate constant (kobs) as a function of nucleotide concentration, we determined the maximum rate of nucleotide incorporation (kpol) and nucleotide binding affinity (Kd) for the Dbh-DNA complex (Fig. 1). Selection against formation of T-dGTP or G-dTTP mispairs was calculated by dividing the efficiency (kpol/Kd) for correct nucleotide addition by the efficiency for incorrect nucleotide addition.TABLE 1Pre-steady-state insertion kinetics for wild-type and F12A Dbh The DNA substrate was as follows, 5′-TGGGTAACGCCAGGGTTTTCTCAGT 3′-ACCCATTGCGGTCCCAAAAGAGTCAXTGCTGCA where X was the templating base appropriate for each determination. Values are the average of at least two determinations and are reported as mean ± S.D.ProteinCorrect dNTPIncorrect dNTPSelectivityaCalculated as (kpol/Kd)correct/(kpol/Kd)incorrectKd (mm)kpol (s–1)kpol/Kd (m–1 s–1)Kd (mm)kpol (s–1)kpol/Kd (m–1 s–1)G-dCTPG-dTTPdC/dTWT0.89 ± 0.067.0 ± 0.27.9 × 1036.4 ± 3.0(1.3 ± 0.03) × 10–22.03.9 × 103F12A4.4 ± 0.52.4 ± 0.25305.4 ± 0.4(9.5 ± 1.4) × 10–40.173.0 × 103T-dATPT-dGTPdA/dGWT2.2 ± 1.38.9 ± 1.14.0 × 1036.2 ± 0.8(3.0 ± 0.4) × 10–24.7850F12A7.2 ± 0.010.55 ± 0.18768.2 ± 3.6(1.3 ± 0.3) × 10–30.16490a Calculated as (kpol/Kd)correct/(kpol/Kd)incorrect Open table in a new tab From the pre-steady-state kinetic constants for correct base pair and mispair formation by wild-type and F12A Dbh (Table 1), the discrimination by wild-type Dbh against wobble mispairs was calculated to be ∼103, with 5-fold greater discrimination against G-dTTP mispairs than T-dGTP mispairs. For both mismatches, the differences in dNTP binding between the correct and incorrect nucleotide were small (3-7-fold) compared with the changes in rate of nucleotide addition (300-540-fold), showing that transition state interactions are the main source of selectivity against these mispairs. Mutation of the steric gate residue, Phe12, to alanine had very little effect on the level of discrimination against either the T-dGTP or G-dTTP mismatch. In each case, the decrease in incorporation efficiency due to the F12A mutation was similar in magnitude for the correct base pair and the corresponding mispair, resulting in no overall change in fidelity. For both the template-T and template-G substrate, the F12A mutation caused a modest decrease (3-5-fold) in binding affinity for the correct dNTP but did not affect binding of the incorrect nucleotide. The F12A mutation also caused a moderate decrease (3-20-fold) in the rate of dNTP addition. The rate decrease was larger for misincorporation than for correct nucleotide addition; when combined with the opposing effect of F12A on nucleotide binding, this accounts for the negligible effect of this mutation on fidelity. Use of rNTP Discrimination to Report on Positioning of Wobble Mispairs—We used the level of discrimination against rNTP incorporation to report on the positioning of nascent mispairs at the polymerase active sites of Dbh and Klenow fragment. The selectivity for dNTPs over rNTPs depends on the positioning of the 2′-OH on the sugar of the incoming nucleotide relative to the steric gate side chain. If an incoming incorrect nucleotide occupies a similar position to that of the corresponding correct nucleotide, then both incorporation reactions should show similar selectivity for the nucleotide sugar. An increase in dNTP/rNTP selectivity in a misinsertion reaction would imply that the incorrect incoming nucleotide is closer to the steric gate side chain than a correctly paired nucleotide; the opposite conclusion would be inferred from a decrease in selectivity. We assessed the dNTP/rNTP selectivity of wild-type Dbh by comparing the rates of polymerase-catalyzed incorporation at a single concentration of 10 mm nucleotide (Table 2). We adopted this approach, rather than determining individual kpol and Kd values, because our previous studies (2Potapova O. Grindley N.D.F. Joyce C.M. J. Biol. Chem. 2002; 277: 28157-28166Abstract Full Text Full Text PDF PubMed Scopus (52) Google Scholar, 19DeLucia A.M. Grindley N.D.F. Joyce C.M. Nucleic Acids Res. 2003; 31: 4129-4137Crossref PubMed Scopus (67) Google Scholar) and this work (Table 1) indicated that changes in the reaction substrates primarily affect the rate of nucleotide addition and have little influence on the rather weak nucleotide binding affinity of Dbh. The rate constants are reported as kobs, not kpol, values because the nucleotide binding of Dbh is not saturated at 10 mm (see Fig. 1). Comparison of the rate constants at 10 and 2 mm nucleotide, for each reaction, supported our expectation that there would be no dramatic changes in nucleotide binding affinity in this series of experiments. For the majority of the reactions, the rate at 2 mm nucleotide was about 40% of that at 10 mm, consistent with a Kd of around 6 mm. For correct dNTP incorporation by wild-type Dbh, the rate at 2 mm was 60 to 70% of that at 10 mm, indicating a Kd of 1-2 mm.TABLE 2rNTP discrimination in correct and wobble base pairs by wild-type Dbh The DNA substrate was as follows, 5′-TGGGTAACGCCAGGGTTTTCTCAGT 3′-ACCCATTGCGGTCCCAAAAGAGTCAXTGCTGCA where X was the templating base, as appropriate. Values are the average of at least two determinations at 10 mm nucleotide and are reported as mean ± S.D.Correct d/rNTP discriminationIncorrect d/rNTP discriminationdNTP kobs (s–1)rNTP kobs (s–1)SelectivityaCalculated as (kobs)deoxy/(kobs)ribodNTP kobs (s–1)rNTP kobs (s–1)SelectivityaCalculated as (kobs)deoxy/(kobs)riboA-dTTPA-rUTPdT/rUG-dTTPG-rUTPdT/rU9.6 ± 0.6(7.3 ± 1.3) × 10–41.3 × 104(7.8 ± 1.2) × 10–3(1.4 ± 0.9) × 10–65.7 × 103A-rTTPdT/rTG-rTTPdT/rT(1.7 ± 0.6) × 10–45.8 × 104(1.1 ± 0.2) × 10–66.9 × 103G-dCTPG-rCTPdC/rCA-dCTPA-rCTPdC/rC6.4 ± 0.5(3.8 ± 0.4) × 10–31.7 × 103(2.4 ± 0.4) × 10–3(3.5 ± 1.8) × 10–6670C-dGTPC-rGTPdG/rGT-dGTPT-rGTPdG/rG4.5 ± 2.2(2.3 ± 0.003) × 10–41.9 × 104(1.8 ± 0.4) × 10–2(6.0 ± 1.8) × 10–73.1 × 104T-dATPT-rATPdA/rA6.7 ± 0.6(3.4 ± 0.3) × 10–42.0 × 104a Calculated as (kobs)deoxy/(kobs)ribo Open table in a new tab Discrimination by wild-type Dbh against rNTPs in correct Watson-Crick pairings was ∼20,000-fold, except for rCTP where the discrimination was 10-fold lower 3The different behavior of rCTP is interesting in view of the preferred incorporation of dCTP by Dbh, reported previously (2Potapova O. Grindley N.D.F. Joyce C.M. J. Biol. Chem. 2002; 277: 28157-28166Abstract Full Text Full Text PDF PubMed Scopus (52) Google Scholar). (Table 2). For an incoming pyrimidine mispaired opposite a template purine, the rNTP discrimination was slightly lower than for the corresponding correct base pair. When the incoming nucleotide was a purine, rNTP discrimination was essentially the same regardless of whether or not the nucleotide was correctly paired with the templating base. As expected, the absence of the steric gate side chain, in the F12A Dbh mutant, resulted in very little discrimination against rNTPs (less than 10-fold) in all reactions tested (data not shown). Klenow fragment, with a more constrained nucleotide binding pocket than Dbh, normally binds a correct nucleotide with ∼100-fold higher affinity than does Dbh. Therefore the consequences of mispair geometry (reported by rNTP discrimination) at the active site of Klenow fragment may be seen both at the level of nucleotide binding and nucleotide incorporation rate. We compared the single-turnover kinetics for rGTP and rUTP incorporation in correct and wobble mispairs by Klenow fragment at a series of nucleotide concentrations so as to determine kpol and Kd (Table 3). As with Dbh, selection against rNTP addition in a base pair with an incorrect incoming purine (T-d/rGTP) was very similar to dGTP/rGTP discrimination in a correct base pair. However, with the opposite arrangement, an incoming pyrimidine mispaired with a template purine, ribonucleotide discrimination was substantially reduced, with the discrimination between dTTP and rUTP ∼300-fold lower when mispaired with G than when correctly paired with A. The decrease in dTTP/rUTP discrimination was entirely due to changes in ground-state interactions. Because discrimination by Klenow fragment against rUTP has been observed to be particularly high (Table 3 and Ref. 20Astatke M. Ng K. Grindley N.D.F. Joyce C.M. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 3402-3407Crossref PubMed Scopus (181) Google Scholar), we repeated the measurements with rTTP. The results were very similar to those obtained with rUTP, ruling out any unusual effects due to the thymine 5-methyl group.TABLE 3rNTP discrimination in correct and wobble base pairs by Klenow fragmentCorrect d/rNTP discriminationIncorrect d/rNTP discriminationSubstratesKd (μm)kpol (s–1)kpol/Kd (m–1 s–1)SelectivityaCalculated as (kpol/Kd)deoxy/(kpol/Kd)riboKd (μm)kpol (s–1)kpol/Kd (m–1 s–1)SelectivityaCalculated as (kpol/Kd)deoxy/(kpol/Kd)riboA-dT/rUTPbThe DNA substrate was as follows, 5′–TGGGTAACGCCAGGGTTTTCTCAGT 3′–ACCCATTGCGGTCCCAAAAGAGTCAXTGCTGCA where X was A or G, as appropriateG-dT/rUTPbThe DNA substrate was as follows, 5′–TGGGTAACGCCAGGGTTTTCTCAGT 3′–ACCCATTGCGGTCCCAAAAGAGTCAXTGCTGCA where X was A or G, as appropriatedTTPcSingle determination for dNTP parameters except for T-dGTP incorporation data which are from ref. 26. Data for rNTP incorporation are the average of at least two determinations and are reported as mean ± S.D.131601.3 × 1077503.4 × 10–245rUTP960 ± 180(3.6 ± 0.8) × 10–2383.3 × 105200 ± 2(7.4 ± 1.0) × 10–63.8 × 10–21.2 × 103rTTPNDdBecause of the large amounts of nucleotide required for rapid-quench measurements, we did not carry out a full determination of A-rTTP incorporation parameters. At rTTP concentrations up to 1 mM, the reaction rates were essentially identical to those obtained with rUTPND340 ± 50(2.4 ± 0.01) × 10–57.1 × 10–26.4 × 102C-d/rGTPeThe DNA substrate was as follows, 5′–GGTAACGCCAGGGTTTTCTC 3′–ACCCATTGCGGTCCCAAAAGAGXCAGTGCTGCA where X was C or T, as appropriateT-d/rGTPeThe DNA substrate was as follows, 5′–GGTAACGCCAGGGTTTTCTC 3′–ACCCATTGCGGTCCCAAAAGAGXCAGTGCTGCA where X was C or T, as appropriatedGTPcSingle determination for dNTP parameters except for T-dGTP incorporation data which are from ref. 26. Data for rNTP incorporation are the average of at least two determinations and are reported as mean ± S.D.5.91502.6 × 107480.163.4 × 103rGTP60 ± 8(6.2 ± 0.4) × 10–21.0 × 1032.5 × 104110 ± 10(2.0 ± 0.4) × 10–50.191.8 × 104a Calculated as (kpol/Kd)deoxy/(kpol/Kd)ribob The DNA substrate was as follows, 5′–TGGGTAACGCCAGGGTTTTCTCAGT 3′–ACCCATTGCGGTCCCAAAAGAGTCAXTGCTGCA where X was A or G, as appropriatec Single determination for dNTP parameters except for T-dGTP incorporation data which are from ref. 26Minnick D.T. Liu L. Grindley N.D.F. Kunkel T.A. Joyce C.M. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 1194-1199Crossref PubMed Scopus (44) Google Scholar. Data for rNTP incorporation are the average of at least two determinations and are reported as mean ± S.D.d Because of the large amounts of nucleotide required for rapid-quench measurements, we did not carry out a full determination of A-rTTP incorporation parameters. At rTTP concentrations up to 1 mM, the reaction rates were essentially identical to those obtained with rUTPe The DNA substrate was as follows, 5′–GGTAACGCCAGGGTTTTCTC 3′–ACCCATTGCGGTCCCAAAAGAGXCAGTGCTGCA where X was C or T, as appropriate Open table in a new tab Misinsertion Fidelity of Dbh—The pre-steady-state kinetic data for correct and incorrect Pu-Py base pairs show that Dbh has a lower misinsertion fidelity than Klenow fragment, as expected from our earlier measurements of forward mutation frequencies (2Potapova O. Grindley N.D.F. Joyce C.M. J. Biol. Chem. 2002; 277: 28157-28166Abstract Full Text Full Text PDF PubMed Scopus (52) Google Scholar). Relative to wild-type Klenow fragment, mismatch discrimination by wild-type Dbh is 25-fold less for G-dTTP and 5-fold less for T-dGTP misinsertions (Table 1 and Ref. 26Minnick D.T. Liu L. Grindley N.D.F. Kunkel T.A. Joyce C.M. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 1194-1199Crossref PubMed Scopus (44) Google Scholar). Like Klenow fragment, Dbh shows greater discrimination against G-dTTP mispairs than T-dGTP mispairs (26Minnick D.T. Liu L. Grindley N.D.F. Kunkel T.A. Joyce C.M. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 1194-1199Crossref PubMed Scopus (44) Google Scholar). For both mispairs in this study, discrimination by Dbh derives largely from differences in reaction rate, consistent with other kinetic studies of Y-family polymerases (4Fiala K.A. Suo Z. Biochemistry. 2004; 43: 2106-2115Crossref PubMed Scopus (109) Google Scholar, 28Washington M.T. Prakash L. Prakash S. Cell. 2001; 107: 917-927Abstract Full Text Full Text PDF PubMed Scopus (114) Google Scholar, 29Cramer J. Restle T. J. Biol. Chem. 2005; 280: 40552-40558Abstract Full Text Full Text PDF PubMed Scopus (20) Google Scholar). Our results indicate that the steric gate residue, Phe12, of Dbh plays very little role in purine-pyrimidine mismatch fidelity, in contrast to the steric gate residue, Glu710, of Klenow fragment. The E710A Klenow fragment is a mutator for Pu-dPyTP mismatches, and the ∼100-fold loss in selectivity responsible for this phenotype results from the complete loss of discrimination in dNTP binding and ∼10-fold lower selectivity in kpol, relative to wild-type Klenow fragment (26Minnick D.T. Liu L. Grindley N.D.F. Kunkel T.A. Joyce C.M. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 1194-1199Crossref PubMed Scopus (44) Google Scholar). With the opposite mismatch, Py-dPuTP, E710A shows substantial changes in the individual kpol and Kd values compared with wild-type Klenow fragment. Nevertheless, E710A is not a mutator for Py-dPuTP errors because the kpol and Kd changes are in opposite directions, reflecting tighter binding of the mispaired purine but a severely compromised catalytic rate. In contrast to E710A Klenow fragment, the F12A mutation in Dbh results in similar decreases in overall activity, regardless of whether the incoming nucleotide is correct or mismatched (Table 1). The only observation that hints at a role for Phe12 in mismatch recognition is a slight trend in the Kd(dNTP) values for both mismatches tested. Binding of the correctly paired dNTP by wild-type Dbh is tighter (by 3-7-fold) than binding by the F12A mutant or binding by either protein of an incoming mismatched dNTP, perhaps indicating a weak interaction that is compromised either in the absence of Phe12 or in a mismatched nascent base pair. The ribonucleotide discrimination data, which report on the position of the incoming nucleotide, provide a plausible explanation for the different roles of the steric gate side chain in Klenow fragment and Dbh (Tables 2 and 3). In Dbh the dNTP/rNTP discrimination is similar regardless of whether or not the incoming nucleotide is correctly paired with the template base. This indicates that the position of the sugar of an incoming dNTP relative to Phe12 is approximately the same in either situation and therefore that the Phe12 side chain would not be an effective sensor of nascent mispairs. Conversely, the ribonucleotide data for Klenow fragment imply that an incoming dTTP is further from the steric gate side chain when mispaired opposite G than when correctly paired opposite A. The favorable interaction of the nucleotide with Glu710 is therefore less in the mispair and Glu710 serves as a discriminator against Pu-dPyTP errors. This discrimination is lost in the E710A mutant, accounting for its mutator phenotype. Two possible reasons underlying the different properties of steric gate mutants of Klenow fragment and Dbh, one structural and the other mechanistic, are examined below. Active Site Structure—The structural explanation assumes that the misincorporation pathway proceeds via a ternary complex that resembles the ternary complexes seen with correctly paired incoming dNTPs, with appropriate adjustments to accommodate the mispair. In Klenow fragment, the ribonucleotide discrimination data imply that an incoming dTTP sits higher in the active site binding pocket when mispaired with G than when correctly paired with A. This is consistent with the structural model proposed in our earlier study of the E710A mutant (26Minnick D.T. Liu L. Grindley N.D.F. Kunkel T.A. Joyce C.M. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 1194-1199Crossref PubMed Scopus (44) Google Scholar), in which we hypothesized that nascent Pu-Py mispairs would adopt the wobble geometry seen in the structures of Pu-Py mismatches in duplex DNA (30Hunter W.N. Brown T. Kneale G. Anand N.N. Rabinovich D. Kennard O. J. Biol. Chem. 1987; 262: 9962-9970Abstract Full Text PDF PubMed Google Scholar, 31Hunter W.N. Brown T. Anand N.N. Kennard O. Nature. 1986; 320: 552-555Crossref PubMed Scopus (241) Google Scholar). Compared with Watson-Crick base pairs, the wobble mismatches are more asymmetric, with the pyrimidine partner displaced toward the major groove and the purine partner displaced toward the minor groove (Fig. 2A). Thus, the predicted location of a mispaired dPyTP would be further from the floor of the binding pocket, compared with a correctly paired dNTP (Fig. 2B), entirely consistent with the reduced dNTP/rNTP discrimination seen for an incoming mispaired pyrimidine (Table 3). It is harder to predict the position of the opposite nascent mispair, Py-dPuTP. Steric clashes with side chains on the floor of the binding pocket would probably prevent an incorrectly paired incoming purine from being located closer to the minor groove. The likely outcome is that the nucleotide would take up approximately the same position as in a correct base pair, with compensatory changes elsewhere, perhaps on the template side of the binding pocket. Note that the kinetic data for the E710A mutant imply that in the absence of Glu710, a mispaired dGTP can indeed be displaced toward the minor groove, resulting in tighter binding but compromised catalysis (26Minnick D.T. Liu L. Grindley N.D.F. Kunkel T.A. Joyce C.M. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 1194-1199Crossref PubMed Scopus (44) Google Scholar). Different constraints in the binding pocket for the nascent base pair could account for the difference in behavior of Dbh and Klenow fragment toward Pu-dPyTP mispairs. Assuming that a nascent Pu-dPyTP mismatch adopts a wobble conformation, this could be accommodated in an active site optimized for Watson-Crick geometry either by a relative displacement of the templating base toward the floor of the binding pocket or by displacement of the incoming nucleotide away from the floor of the binding pocket or by some combination of the two. We suggest that the snugly fitting A-family binding pocket of Klenow fragment discourages alternative positioning of the templating base and consequently the altered geometry is accommodated primarily on the dNTP side of the binding site (Fig. 2B), with the kinetic and fidelity consequences we have described here and in our previous work (26Minnick D.T. Liu L. Grindley N.D.F. Kunkel T.A. Joyce C.M. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 1194-1199Crossref PubMed Scopus (44) Google Scholar). Conversely, Dbh may have more potential for alternative binding geometries on the template site of the binding pocket and may be less tolerant than Klenow fragment of changes in position of the incoming dNTP. Indeed, it has recently been suggested that assembly of a catalytically competent arrangement of functional groups and divalent metal ions in the Y-family polymerase active site may be conditional on binding of the incoming nucleotide in the correct geometry, and this may provide an important specificity mechanism (32Vaisman A. Ling H. Woodgate R. Yang W. EMBO J. 2005; 24: 2957-2967Crossref PubMed Scopus (158) Google Scholar). Greater flexibility in the geometry of binding the templating base is inherent to the biological function of Y-family polymerases since their role in lesion bypass requires them to accommodate modified or damaged bases in the templating position. The Y-family polymerases do not have a large side chain in the position equivalent to the invariant tyrosine of A-family DNA polymerases (Tyr671 of Klentaq, and Tyr766 of Klenow fragment), which, in the ternary complex, not only forms the floor of the binding pocket on the template side (Fig. 2B) but also contributes to the rigidity of the entire binding pocket with a hydrogen bond from the tyrosine hydroxyl to the steric gate carboxylate (13Doublié S. Tabor S. Long A. Richardson C.C. Ellenberger T. Nature. 1998; 391: 251-258Crossref PubMed Scopus (1100) Google Scholar). The ternary complex of Dpo4, a close homologue of Dbh, has a much smaller side chain (Val32) in an analogous position on the minor groove side of the templating base (Fig. 2C). Moreover, this part of the binding pocket resembles a narrow ledge more than a floor; in contrast to the situation in Klenow fragment, it does not extend to the surface of the primer terminal base pair to form a continuous contact surface for the nascent base pair. It therefore seems reasonable that some repacking of the small side chains that make up the Dpo4 or Dbh binding pocket could take place in order to accommodate a variety of template base positions. As illustrated in Fig. 2C, this would be required in a Pu-dPyTP wobble mispair if the incoming pyrimidine occupied a position identical to that in a correct base pair. Alternatively, the adjustments to accommodate wobble geometry could be shared between template and dNTP sides of the binding site, as appears to be the case in a comparison of T-dATP and T-dGTP base pairs bound to Dpo4 (32Vaisman A. Ling H. Woodgate R. Yang W. EMBO J. 2005; 24: 2957-2967Crossref PubMed Scopus (158) Google Scholar). In summary, we suggest that the flexibility on the template side of the Dbh active site allows for a consistent location of the incoming dNTP regardless of whether or not it is correctly paired with its templating partner. Contact of the dNTP sugar with the Phe12 steric gate side chain is maintained in all circumstances with the result that Dbh shows stringent discrimination against ribonucleotides but does not use the steric gate side chain as a discriminator against nascent mispairs. Reaction Pathway—The alternative mechanistic explanation takes account of the possibility of distinct reaction pathways for polymerase addition depending on whether the incoming dNTP is correct or incorrect (33Joyce C.M. Benkovic S.J. Biochemistry. 2004; 43: 14317-14324Crossref PubMed Scopus (281) Google Scholar). In Dbh, the conformation of the active site binding pocket does not change significantly on binding substrates, suggesting that a nascent mispair may be accommodated, with minor adjustments, as described in the previous section. By contrast, in an A-family DNA polymerase such as Klenow fragment, part of the fingers subdomain moves so as to form the closed complex in response to the binding of a correctly matched dNTP (11Li Y. Korolev S. Waksman G. EMBO J. 1998; 17: 7514-7525Crossref PubMed Scopus (654) Google Scholar, 12Li Y. Waksman G. Protein Sci. 2001; 10: 1225-1233Crossref PubMed Scopus (75) Google Scholar, 13Doublié S. Tabor S. Long A. Richardson C.C. Ellenberger T. Nature. 1998; 391: 251-258Crossref PubMed Scopus (1100) Google Scholar, 16Johnson S.J. Taylor J.S. Beese L.S. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 3895-3900Crossref PubMed Scopus (261) Google Scholar). It is this movement that forms the snug binding pocket for the nascent base pair and brings the dNTP sugar close to the steric gate side chain, Glu710 of Klenow fragment. If the fingers-closing transition were absent or altered in the misincorporation pathway, mispairs would interact to a lesser extent with Glu710, accounting for the changes in ribonucleotide discrimination and for the ability of Glu710 to serve as a discriminator against mispairs. Assessment of the plausibility of this mechanistic explanation will require a fuller understanding of the differences, if any, between the pathways for correct and incorrect dNTP addition, although it is worth noting that fluorescence experiments suggest that significant differences may exist (34Rothwell P.J. Mitaksov V. Waksman G. Mol. Cell. 2005; 19: 345-355Abstract Full Text Full Text PDF PubMed Scopus (111) Google Scholar, 35Purohit V. Grindley N.D.F. Joyce C.M. Biochemistry. 2003; 42: 10200-10211Crossref PubMed Scopus (105) Google Scholar). 4C. M. Joyce, X. Huang, O. Potapova, and N. D. F. Grindley, unpublished observations." @default.
• W2091262927 created "2016-06-24" @default.
• W2091262927 creator A5007089832 @default.
• W2091262927 creator A5022075115 @default.
• W2091262927 creator A5031775584 @default.
• W2091262927 creator A5082140008 @default.
• W2091262927 creator A5086740949 @default.
• W2091262927 date "2006-09-01" @default.
• W2091262927 modified "2023-09-29" @default.
• W2091262927 title "The Properties of Steric Gate Mutants Reveal Different Constraints within the Active Sites of Y-family and A-family DNA Polymerases" @default.
• W2091262927 cites W1479884571 @default.
• W2091262927 cites W1493170168 @default.
• W2091262927 cites W1515096181 @default.
• W2091262927 cites W1543949451 @default.
• W2091262927 cites W1884115821 @default.
• W2091262927 cites W1971364137 @default.
• W2091262927 cites W1973711348 @default.
• W2091262927 cites W1983089355 @default.
• W2091262927 cites W1985746590 @default.
• W2091262927 cites W1986594702 @default.
• W2091262927 cites W1998640559 @default.
• W2091262927 cites W2014727583 @default.
• W2091262927 cites W2023606600 @default.
• W2091262927 cites W2029605473 @default.
• W2091262927 cites W2030961393 @default.
• W2091262927 cites W2041544593 @default.
• W2091262927 cites W2050530360 @default.
• W2091262927 cites W2056422692 @default.
• W2091262927 cites W2056802283 @default.
• W2091262927 cites W2073912176 @default.
• W2091262927 cites W2088221773 @default.
• W2091262927 cites W2089142368 @default.
• W2091262927 cites W2089845127 @default.
• W2091262927 cites W2089891949 @default.
• W2091262927 cites W2104739702 @default.
• W2091262927 cites W2107520545 @default.
• W2091262927 cites W2109649261 @default.
• W2091262927 cites W2114243500 @default.
• W2091262927 cites W2130233138 @default.
• W2091262927 cites W2132005715 @default.
• W2091262927 cites W2142513910 @default.
• W2091262927 cites W2142892199 @default.
• W2091262927 cites W2146859052 @default.
• W2091262927 cites W2149410625 @default.
• W2091262927 cites W2153508349 @default.
• W2091262927 cites W2159924007 @default.
• W2091262927 doi "https://doi.org/10.1074/jbc.m604393200" @default.
• W2091262927 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/16831866" @default.
• W2091262927 hasPublicationYear "2006" @default.
• W2091262927 type Work @default.
• W2091262927 sameAs 2091262927 @default.
• W2091262927 citedByCount "29" @default.
• W2091262927 countsByYear W20912629272012 @default.
• W2091262927 countsByYear W20912629272013 @default.
• W2091262927 countsByYear W20912629272014 @default.
• W2091262927 countsByYear W20912629272015 @default.
• W2091262927 countsByYear W20912629272016 @default.
• W2091262927 countsByYear W20912629272017 @default.
• W2091262927 countsByYear W20912629272018 @default.
• W2091262927 countsByYear W20912629272019 @default.
• W2091262927 countsByYear W20912629272021 @default.
• W2091262927 crossrefType "journal-article" @default.
• W2091262927 hasAuthorship W2091262927A5007089832 @default.
• W2091262927 hasAuthorship W2091262927A5022075115 @default.
• W2091262927 hasAuthorship W2091262927A5031775584 @default.
• W2091262927 hasAuthorship W2091262927A5082140008 @default.
• W2091262927 hasAuthorship W2091262927A5086740949 @default.
• W2091262927 hasBestOaLocation W20912629271 @default.
• W2091262927 hasConcept C104317684 @default.
• W2091262927 hasConcept C143065580 @default.
• W2091262927 hasConcept C185592680 @default.
• W2091262927 hasConcept C201194858 @default.
• W2091262927 hasConcept C2756471 @default.
• W2091262927 hasConcept C501734568 @default.
• W2091262927 hasConcept C54355233 @default.
• W2091262927 hasConcept C552990157 @default.
• W2091262927 hasConcept C71240020 @default.
• W2091262927 hasConcept C82381507 @default.
• W2091262927 hasConcept C86803240 @default.
• W2091262927 hasConceptScore W2091262927C104317684 @default.
• W2091262927 hasConceptScore W2091262927C143065580 @default.
• W2091262927 hasConceptScore W2091262927C185592680 @default.
• W2091262927 hasConceptScore W2091262927C201194858 @default.
• W2091262927 hasConceptScore W2091262927C2756471 @default.
• W2091262927 hasConceptScore W2091262927C501734568 @default.
• W2091262927 hasConceptScore W2091262927C54355233 @default.
• W2091262927 hasConceptScore W2091262927C552990157 @default.
• W2091262927 hasConceptScore W2091262927C71240020 @default.
• W2091262927 hasConceptScore W2091262927C82381507 @default.
• W2091262927 hasConceptScore W2091262927C86803240 @default.
• W2091262927 hasIssue "37" @default.
• W2091262927 hasLocation W20912629271 @default.
• W2091262927 hasOpenAccess W2091262927 @default.
• W2091262927 hasPrimaryLocation W20912629271 @default.
• W2091262927 hasRelatedWork W101124211 @default.
• W2091262927 hasRelatedWork W1964869773 @default.
• W2091262927 hasRelatedWork W1992231596 @default.
• W2091262927 hasRelatedWork W1996781975 @default.

• next