FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2092433658> ?p ?o ?g. }

• W2092433658 endingPage "879" @default.
• W2092433658 startingPage "869" @default.
• W2092433658 abstract "Glomerular expression of p27Kip1 in diabetic db/db mouse: Role of hyperglycemia Early diabetic nephropathy is characterized by glomerular hypertrophy. Previous studies in vitro have demonstrated that mesangial cells exposed to high glucose are arrested in the G1-phase of the cell cycle and express increased levels of the cyclin-dependent kinase inhibitor p27Kip1. The present study was performed to investigate the renal expression of p27Kip1 in db/db mice, a model of diabetes mellitus type II. Glomerular p27Kip1 protein, but not mRNA expression, was strongly enhanced in diabetic db/db mice compared with non-diabetic db/+ littermates. Immunohistochemical studies revealed that this stimulated expression was mainly restricted to the nuclei of mesangial cells and podocytes, but glomerular endothelial cells occasionally also stained positively. Quantification of p27Kip1 positive glomerular cells showed a significant increase of these cells in db/db mice compared with non-diabetic db/+ animals. Although tubular cells revealed a positive staining for p27Kip1 protein, there was no difference between db/+ and db/db mice. Immunoprecipitation experiments revealed that p27Kip1 protein associates with Cdk2 and Cdk4, but not with Cdk6. To test for the influence of hyperglycemia on cell cycle arrest and p27Kip1 expression, mesangial cells were isolated from db/+ and db/db mice. There was a similar basal proliferation when these cells were grown in normal glucose-containing medium (100 mg/dl). However, raising the glucose concentration to 275 to 450 mg/dl induced cell cycle arrest in db/+ as well as db/db mesangial cells. Increasing the medium osmolarity with D-mannitol failed to induce p27Kip1 expression in mesangial cells. Transfection of cells with p27Kip1 antisense, but not missense, phosphorothioate oligonucleotides facilitated cell cycle progression equally well in db/+ and db/db mesangial cells. Furthermore, p27Kip1 expression was comparable in both cell lines in normal glucose, but increased in high glucose medium. Our studies demonstrate that p27Kip1 expression is enhanced in diabetic db/db animals. This induction appears to be due to hyperglycemia. Expression of p27Kip1 may be important in cell cycle arrest and hypertrophy of mesangial cells during early diabetic nephropathy. Glomerular expression of p27Kip1 in diabetic db/db mouse: Role of hyperglycemia Early diabetic nephropathy is characterized by glomerular hypertrophy. Previous studies in vitro have demonstrated that mesangial cells exposed to high glucose are arrested in the G1-phase of the cell cycle and express increased levels of the cyclin-dependent kinase inhibitor p27Kip1. The present study was performed to investigate the renal expression of p27Kip1 in db/db mice, a model of diabetes mellitus type II. Glomerular p27Kip1 protein, but not mRNA expression, was strongly enhanced in diabetic db/db mice compared with non-diabetic db/+ littermates. Immunohistochemical studies revealed that this stimulated expression was mainly restricted to the nuclei of mesangial cells and podocytes, but glomerular endothelial cells occasionally also stained positively. Quantification of p27Kip1 positive glomerular cells showed a significant increase of these cells in db/db mice compared with non-diabetic db/+ animals. Although tubular cells revealed a positive staining for p27Kip1 protein, there was no difference between db/+ and db/db mice. Immunoprecipitation experiments revealed that p27Kip1 protein associates with Cdk2 and Cdk4, but not with Cdk6. To test for the influence of hyperglycemia on cell cycle arrest and p27Kip1 expression, mesangial cells were isolated from db/+ and db/db mice. There was a similar basal proliferation when these cells were grown in normal glucose-containing medium (100 mg/dl). However, raising the glucose concentration to 275 to 450 mg/dl induced cell cycle arrest in db/+ as well as db/db mesangial cells. Increasing the medium osmolarity with D-mannitol failed to induce p27Kip1 expression in mesangial cells. Transfection of cells with p27Kip1 antisense, but not missense, phosphorothioate oligonucleotides facilitated cell cycle progression equally well in db/+ and db/db mesangial cells. Furthermore, p27Kip1 expression was comparable in both cell lines in normal glucose, but increased in high glucose medium. Our studies demonstrate that p27Kip1 expression is enhanced in diabetic db/db animals. This induction appears to be due to hyperglycemia. Expression of p27Kip1 may be important in cell cycle arrest and hypertrophy of mesangial cells during early diabetic nephropathy. Diabetic nephropathy is a major complication of diabetes mellitus and is currently one of the major causes of chronic renal failure. After an initial phase of glomerular hypertrophy associated with an increase in glomerular filtration rate, the natural history of diabetic nephropathy is characterized by the development of irreversible glomerulosclerosis and tubulointerstitial fibrosis causing end-stage renal disease1.Chowdhury T.A. Barnett A.H. Bain S.C. Pathogenesis of diabetic nephropathy.Trends Endocrinol Metab. 1996; 7: 320-323Abstract Full Text PDF PubMed Scopus (7) Google Scholar, 2.Ibrahim H.N. Hostetter T.H. Diabetic nephropathy.J Am Soc Nephrol. 1997; 8: 487-493PubMed Google Scholar, 3.Perneger T.V. Brancati F.L. Whelton P.K. Klag M.J. End-stage renal disease attributable to diabetes mellitus.Ann Intern Med. 1994; 121: 912-918Crossref PubMed Scopus (172) Google Scholar. Although originally considered to be only a feature of insulin-dependent diabetes mellitus type I (IDDM), there is now ample evidence that similar features of diabetic nephropathy also occur in patients with diabetes mellitus type II (NIDDM)4.Nelson R.G. Bennett P.H. Beck G.J. Tan M. Knowler W.C. Mitch W.E. Hirschman G.H. Myers B.D. Development and progression of renal disease in Pima Indians with non-insulin-dependent diabetes mellitus.N Engl J Med. 1996; 335: 1636-1642Crossref PubMed Scopus (403) Google Scholar, 5.Ritz E. Keller C. Bergis K.H. Nephropathy of type II diabetes mellitus.Nephrol Dial Transplant. 1996; 11: 38-44Crossref PubMed Scopus (16) Google Scholar, 6.Pagtalunan M.E. Miller P.L. Jumping-Eagle S. Nelson R.G. Myers B.D. Rennke H.G. Coplon N.S. Sun L. Meyer T.W. Podocyte loss and progressive glomerular injury in type II diabetes.J Clin Invest. 1997; 99: 342-348Crossref PubMed Scopus (899) Google Scholar. In fact, it has been claimed that patients suffering from NIDDM may even have an earlier onset of nephropathy than subjects with IDDM5.Ritz E. Keller C. Bergis K.H. Nephropathy of type II diabetes mellitus.Nephrol Dial Transplant. 1996; 11: 38-44Crossref PubMed Scopus (16) Google Scholar. The pathological lesions are quite similar in NIDDM and IDDM, underscoring the pathophysiological role of hyperglycemia and/or substances modified by high glucose such as advanced glycation end products and Amadori products7.Porte D. Schwartz M.W. Diabetes complications: Why is glucose potentially toxic?.Science. 1996; 272: 699-700Crossref PubMed Scopus (210) Google Scholar, 8.Bucala R. Vlassara H. Advanced glycosylation end products in diabetic renal and vascular disease.Am J Kidney Dis. 1995; 26: 875-888Abstract Full Text PDF PubMed Scopus (175) Google Scholar, 9.Cohen M.P. Ziyadeh F.N. Role of Amadori-modified nonenzymatically glycated serum proteins in the pathogenesis of diabetic nephropathy.J Am Soc Nephrol. 1996; 7: 183-190PubMed Google Scholar. Mesangial cells (MC) play a key role in the glomerular hypertrophy of early diabetic nephropathy2.Ibrahim H.N. Hostetter T.H. Diabetic nephropathy.J Am Soc Nephrol. 1997; 8: 487-493PubMed Google Scholar. These cells are also important in the secretion of extracellular matrix proteins that eventually contribute to the development of glomerulosclerosis. We and others have previously demonstrated that MC, grown in high ambient glucose, are growth arrested in the G1-phase of the cell cycle and undergo cellular hypertrophy10.Wolf G. Sharma K. Chen Y. Ericksen M. Ziyadeh F.N. High glucose-induced proliferation in mesangial cells is reversed by autocrine TGF-β.Kidney Int. 1992; 42: 647-656Abstract Full Text PDF PubMed Scopus (341) Google Scholar, 11.Cosio F.G. Effects of high glucose concentrations on human mesangial cell proliferation.J Am Soc Nephrol. 1995; 5: 1600-1609Crossref PubMed Google Scholar, 12.Nahman N.S. Leonhardt K.L. Cosio F.G. Hebert C.L. Effects of high glucose on cellular proliferation and fibronectin production by cultured human mesangial cells.Kidney Int. 1992; 41: 396-402Abstract Full Text PDF PubMed Scopus (144) Google Scholar. This growth inhibitory effect of high glucose on MC is mediated by synthesis and bioactivation of transforming growth factor-β (TGF-β)10.Wolf G. Sharma K. Chen Y. Ericksen M. Ziyadeh F.N. High glucose-induced proliferation in mesangial cells is reversed by autocrine TGF-β.Kidney Int. 1992; 42: 647-656Abstract Full Text PDF PubMed Scopus (341) Google Scholar. Furthermore, the high glucose-mediated synthesis of collagen type IV is also mediated by TGF-β13.Ziyadeh F.N. Sharma K. Ericksen M. Wolf G. Stimulation of collagen gene expression and protein synthesis in murine mesangial cells by high glucose is mediated by autocrine activation of transforming growth factor-β.J Clin Invest. 1994; 93: 536-542Crossref PubMed Scopus (575) Google Scholar,14.Ayo S.H. Radnik R.A. Glass II, W.F. Garoni J.A. Rampt E.R. Appling D.R. Kreisberg J.I. Increased extracellular matrix synthesis and mRNA in mesangial cells grown in high-glucose medium.Am J Physiol. 1991; 260: F185-F191PubMed Google Scholar. In a recent series of experiments we have investigated the role of the cyclin-dependent kinase (Cdk) inhibitor p27Kip1, a protein that binds to cyclin-Cdk complexes and inhibit their kinase activity, in high glucose-mediated cell cycle arrest in MC15.Wolf G. Schroeder R. Ziyadeh F.N. Thaiss F. Zahner G. Stahl R.A.K. High-glucose stimulates expression of p27Kip1 in cultured mouse mesangial cells: Relationship to hypertrophy.Am J Physiol. 1997; 273: F348-F356PubMed Google Scholar. These studies revealed that high glucose increased p27Kip1 protein in MC15.Wolf G. Schroeder R. Ziyadeh F.N. Thaiss F. Zahner G. Stahl R.A.K. High-glucose stimulates expression of p27Kip1 in cultured mouse mesangial cells: Relationship to hypertrophy.Am J Physiol. 1997; 273: F348-F356PubMed Google Scholar. Interference with high glucose-induced p27Kip1 expression applying oligonucleotide antisense technology abolished cellular hypertrophy and facilitated G1-phase exit indicating a pivotal role of p27Kip1 in MC growth regulation under conditions of high glucose15.Wolf G. Schroeder R. Ziyadeh F.N. Thaiss F. Zahner G. Stahl R.A.K. High-glucose stimulates expression of p27Kip1 in cultured mouse mesangial cells: Relationship to hypertrophy.Am J Physiol. 1997; 273: F348-F356PubMed Google Scholar. The current study was performed to test whether similar mechanisms may be operative in the kidneys of db/db mice, a well-characterized model of NIDDM in which early glomerular expansion resembling that found in human diabetes has been documented16.Cohen M.P. Sharma K. Jin Y. Hud E. Wu V.Y. Tomaszewski J. Ziyadeh F.N. Prevention of diabetic nephropathy in db/db mice with glycated albumin antagonists. A novel treatment strategy.J Clin Invest. 1995; 95: 2338-2345Crossref PubMed Scopus (143) Google Scholar, 17.Velasquez M.T. Kimmel P.L. Michaelis O.E. Animal models of spontaneous diabetic kidney disease.FASEB J. 1990; 4: 2850-2859Crossref PubMed Scopus (100) Google Scholar, 18.Like A.A. Lavine R.L. Poffenbarger P.I. Chick W.L. Studies in the diabetic mutant mouse. VI. Evolution of glomerular lesions and associated proteinuria.Am J Pathol. 1972; 66: 193-224PubMed Google Scholar, 19.GÄRTNER K. Glomerular hyperfiltration during the onset of diabetes mellitus in two strains of diabetic mice (C57BL/6J db/db and C57BL/KsJ db/db).Diabetologia. 1978; 15: 59-63Crossref PubMed Scopus (73) Google Scholar. Our data demonstrate that p27Kip1 protein, but not mRNA, is enhanced in glomeruli of diabetic db/db mice. Glomerular MC are a likely source of this increase. However, transfer of isolated MC from db/db mice to normal glucose containing-cell culture medium reduces the p27Kip1 expression to similar levels as MC derived from non-diabetic heterozygotic db/+ controls. These findings indicate that the increased p27Kip1 expression in kidneys of db/db mice is solely mediated by hyperglycemia. Heterozygotic C57BL/Ks-db/+ (db/+) mice were obtained from Bomholtgard Breeding Center (Ry, Denmark) and a breeding colony was established in our animal facility. Homozygotic db/db offspring can be identified on the basis of appearance of obesity around four to six weeks of age16.Cohen M.P. Sharma K. Jin Y. Hud E. Wu V.Y. Tomaszewski J. Ziyadeh F.N. Prevention of diabetic nephropathy in db/db mice with glycated albumin antagonists. A novel treatment strategy.J Clin Invest. 1995; 95: 2338-2345Crossref PubMed Scopus (143) Google Scholar,17.Velasquez M.T. Kimmel P.L. Michaelis O.E. Animal models of spontaneous diabetic kidney disease.FASEB J. 1990; 4: 2850-2859Crossref PubMed Scopus (100) Google Scholar. Diabetic db/db mice as well as their non-diabetic db/+ littermates were studied at seven weeks of age. The body wt was determined and blood was drawn from anesthetized animals for the determination of blood glucose. Kidneys were weighed, pooled from three mice and kept on ice until further processing. Blood glucose was measured with B-Glucose analyzer (HemoCue, Ängelholm, Sweden). For selected experiments, insulin-dependent diabetes mellitus (IDDM) was induced in seven-week-old BALB/c mice (Charles River, Wiga, Germany) after overnight fasting by the intraperitoneal injection of a single dose of 200 mg/kg body wt streptozotocin (STZ; Sigma, Deisenhofen, Germany)20.Itagaki S.I. Nishida E. Lee M.J. Doi K. Histopathology of subacute renal lesions in mice induced by streptozotocin.Exp Toxic Pathol. 1995; 47: 485-491Crossref PubMed Scopus (14) Google Scholar dissolved in citrate buffer (pH 4.5). Blood was obtained from anesthetized mice for measurement of glucose concentration after injection of STZ. Only mice with a glucose concentration of 200 to 300 mg/dl after 24 hours were used. At different time points (24 hr to 1 week), kidneys were removed and glomeruli were isolated by differential sieving as established in this laboratory21.Thaiss F. Wolf G. Assad N. Zahner G. Stahl R.A.K. Angiotensinase A gene expression and enzyme activity in isolated glomeruli of diabetic rats.Diabetologia. 1996; 39: 275-280Crossref PubMed Scopus (35) Google Scholar,22.Wolf G. Haberstroh U. Neilson E.G. Angiotensin II stimulates the proliferation and biosynthesis of type I collagen in cultured murine mesangial cells.Am J Pathol. 1992; 140: 95-107PubMed Google Scholar. Renal cortices were separated from the medulla, the kidneys were pooled, minced, and glomeruli were isolated by differential sieving exactly as previously described22.Wolf G. Haberstroh U. Neilson E.G. Angiotensin II stimulates the proliferation and biosynthesis of type I collagen in cultured murine mesangial cells.Am J Pathol. 1992; 140: 95-107PubMed Google Scholar. The resulting preparation contained > 80% glomeruli as judged by light microscopy. For the establishment of MC cultures, glomeruli were treated with 0.1% collagenase for 30 minutes, extensively washed, and plated in small culture flasks (50 ml; Nunc, Roskilde, Denmark) in Dulbecco's modified Eagle's medium (DMEM; Gibco-BRL, Eggenstein, Germany) containing 100 mg/dl D-glucose. This medium was supplemented with 10% fetal calf serum, 100 U/ml penicillin, 100 μg/ml streptomycin, and 2 mM glutamine. The glomeruli were cultured at 37°C in 5% CO2, and outgrowth of spindle-like MC could be observed after three to five days. Cells were passaged after eight days and some cells were grown in glass slide chambers for further characterization. The identity of mesangial origin of the cells was established by positive staining for desmin and vimentin, but failure of binding to antibodies generated against factor VIII and proximal tubular cell 3M-1 antigen (gift of Dr. Eric Neilson, University of Pennsylvania, Philadelphia, PA, USA). For 3[H]thymidine incorporation experiments, 104 MC from either db/+ or db/db mice were plated into each well of a 96-well culture plate (Nunc) and rested for 24 hours in serum-free DMEM with 100 mg/dl D-glucose. Cells were then incubated for another 48 hours in serum-free medium with 100 mg/dl (normal glucose) or 450 mg/dl (high glucose) D-glucose. Cells were pulsed with 1 μCi 3[H]thymidine (5 Ci/mmol; Amersham, Braunschweig, Germany) during the last six hours of culture. After pulsing, MC were washed twice with PBS, trypsinized for 10 minutes at room temperature, and finally collected on glass-fiber paper with an automatic cell harvester. Radioactivity of dry filters was measured by liquid scintillation spectroscopy. Experiments were independently repeated with three different primary MC cultures and four duplicates for each experiment. Proliferation experiments were also performed in the presence of p27Kip1 antisense and missense phosphorothioate oligonucleotides23.Wolf G. Stahl R.A.K. Angiotensin II-stimulated hypertrophy of LLC-PK1 cells depends on the induction of the cyclin-dependent kinase inhibitor p27Kip1.Kidney Int. 1996; 50: 2112-2119Abstract Full Text PDF PubMed Scopus (67) Google Scholar. The following murine sequences were used24.Coats S. Flangan W.M. Nourse J. Roberts J.M. Requirement of p27Kip1 for restriction point of the fibroblast cell cycle.Science. 1996; 272: 877-880Crossref PubMed Scopus (650) Google Scholar: antisense p27Kip1, 5′UGGCUCUCCUGCGCC3′; and missense p27Kip1, 5′UCCCUUUGGCGCGCC3′. Cells were transfected in serum-free normal glucose medium with 1 μM of either p27Kip1 antisense or missense oligonucleotides using lipofectin24.Coats S. Flangan W.M. Nourse J. Roberts J.M. Requirement of p27Kip1 for restriction point of the fibroblast cell cycle.Science. 1996; 272: 877-880Crossref PubMed Scopus (650) Google Scholar,25.Bennett C.F. Chiang M.Y. Chan H. Shoemaker J.E. Mirabelli C.K. Cationic lipids enhance cellular uptake and activity of phosphorothioate antisense oligonucleotides.Mol Pharmacol. 1992; 41: 1023-1033PubMed Google Scholar. After another 12 hours, the medium was changed to serum-free normal glucose or high glucose for another 48 hours and cells were pulsed with 3[H]thymidine as described above. For Western blots, a total of 106 of primary cultures of MC derived from either db/+ or db/db mice were incubated for 24 hours in serum-free DMEM with 100 mg/dl D-glucose. Cells were subsequently incubated for 48 hours in serum-free medium with different concentrations (100, 275, 333, and 450 mg/dl) of glucose. In addition, the osmolarity of normal glucose medium was adjusted with D-mannitol (Sigma), so that the final osmolarity was equal to high glucose. After washing in ice-cold PBS, cell monolayers were directly lysed in lysis buffer (2% SDS, 60 mM Tris-HCl [pH 6.8], 100 mM dithiothreitol). Lysates were centrifuged and the supernatants were stored at -20°C until further processing. Western blots of primary cultures of MC were repeated twice from independent isolates. Isolated glomeruli from db/+, db/db, or STZ-injected BALB/c mice (200 μl of glomerular suspension) were lysed in lysis buffer. After centrifugation the supernatants were transferred to new tubes. Protein content was measured in all supernatants including those from lysed MC by a modification of the Lowry method that is insensitive to the used concentrations of SDS and dithiothreitol23.Wolf G. Stahl R.A.K. Angiotensin II-stimulated hypertrophy of LLC-PK1 cells depends on the induction of the cyclin-dependent kinase inhibitor p27Kip1.Kidney Int. 1996; 50: 2112-2119Abstract Full Text PDF PubMed Scopus (67) Google Scholar. Protein concentrations were adjusted to 80 μg/sample and 5% glycerol/0.05% bromophenol blue was added. After boiling for five minutes and centrifugation, supernatants were loaded onto a denaturing 12% SDS-polyacrylamide gel. Prestained low molecular weight markers (Amersham), which comprise 2,350 to 45,000 Daltons, served as the molecular weight standards. After completion of electrophoresis, proteins were electroblotted onto a nitrocellulose membrane (High-bond-N; Amersham) in transfer buffer [50 mM Tris-HCl (pH 7.0), 380 mM glycine, 20% methanol]. Filters were stained with Ponceau S to control for equal loading and transfer. Blocking and detection of p27Kip1 were performed exactly as previously described15.Wolf G. Schroeder R. Ziyadeh F.N. Thaiss F. Zahner G. Stahl R.A.K. High-glucose stimulates expression of p27Kip1 in cultured mouse mesangial cells: Relationship to hypertrophy.Am J Physiol. 1997; 273: F348-F356PubMed Google Scholar,23.Wolf G. Stahl R.A.K. Angiotensin II-stimulated hypertrophy of LLC-PK1 cells depends on the induction of the cyclin-dependent kinase inhibitor p27Kip1.Kidney Int. 1996; 50: 2112-2119Abstract Full Text PDF PubMed Scopus (67) Google Scholar. A 1:1000 dilution of a mouse monoclonal anti-p27Kip1 antibody (Transduction Laboratories, Lexington, MA, USA) was used as primary antibody. This antibody reacts with mouse and rat p27Kip123.Wolf G. Stahl R.A.K. Angiotensin II-stimulated hypertrophy of LLC-PK1 cells depends on the induction of the cyclin-dependent kinase inhibitor p27Kip1.Kidney Int. 1996; 50: 2112-2119Abstract Full Text PDF PubMed Scopus (67) Google Scholar. The ECL system (Amersham) was used for the luminescence detection of horseradish peroxidase-conjugated second antibody. Western blots were independently performed three times from independent experimental series with qualitatively similar results. Exposed films were scanned with a laser densitometer (Hoefer Scientific Instruments, San Francisco, CA, USA), and the area under the curve was determined by Gaussian integration with the computer program GS 365W from Hoefer. Signals obtained from db/+ glomeruli or cells grown in normal glucose were assigned as a relative value of one. To determine which Cdk may associate with p27Kip1, immunoprecipitation experiments were performed on glomerular lysates of db/+ and db/db mice. A total of 100 μl lysate, 400 μl sterile water, 500 μl 2× immunoprecipitation buffer (1 × immunoprecipitation buffer: 1% Triton X-100, 150 mM NaCl, 10 mM Tris-HCl (pH 7.4); 2 mM EDTA, 0.2 mM sodium vanadate, 0.2 mM phenyl methylsulfonylfluoride, 0.5% NP-40], and 5 μg antibody were mixed and incubated on a shaking-platform on ice for 60 minutes. Monoclonal anti-Cdk2 and anti-Cdk4 antibodies (both from Transduction Laboratories) or a polyclonal anti-Cdk6 (Santa Cruz Biotechnology, Santa Cruz, CA, USA) were used. All these antibodies react with the putative Cdks. To facilitate immunoprecipitations, 5 μg polyclonal rabbit anti-mouse IgG (Transduction Laboratories) was added to the mixtures in which monoclonal antibodies were used and tubes were incubated for an additional 30 minutes on ice. For immunoprecipitation, 50 μl S. aureus Cowan strain (Calbiochem-Novabiochem, Bad Soden, Germany) was added, and tubes continued shaking for another 60 minutes. Precipitates were formed by centrifugation, washed three times in ice-cold 1× immunoprecipitation buffer, and the pellets were resuspended in 40 μl SDS-electrophoresis buffer (2% SDS, 60 mM Tris-HCl; pH 6.8; 100 mM dithiothreitol, 5% glycerol, 0.03% bromophenol blue). After boiling for 10 minutes, tubes were shortly centrifuged, and the supernatants were finally loaded onto a 12% SDS-polyacrylamide gel. Western blotting and detection of p27Kip1 were performed as described above. Immunoprecipitation experiments with subsequent Western blotting were independently performed twice with qualitatively similar results. To detect minor changes in p27Kip1 mRNA expression, semiquantitative cDNA amplification after reverse transcription of total RNA was performed exactly as previously described using the housekeeping RNA of β-actin as an internal control23.Wolf G. Stahl R.A.K. Angiotensin II-stimulated hypertrophy of LLC-PK1 cells depends on the induction of the cyclin-dependent kinase inhibitor p27Kip1.Kidney Int. 1996; 50: 2112-2119Abstract Full Text PDF PubMed Scopus (67) Google Scholar. Isolated glomeruli from six kidneys obtained from db/+ as well as db/db mice were directly lysed in 4 M guanidinium isothiocyanate, 25 mM sodium citrate (pH 7.0), 0.5% sarcosyl, and 0.1 M 2-mercaptoethanol. Isolation of total and reverse transcription of total RNA was performed exactly as previously described23.Wolf G. Stahl R.A.K. Angiotensin II-stimulated hypertrophy of LLC-PK1 cells depends on the induction of the cyclin-dependent kinase inhibitor p27Kip1.Kidney Int. 1996; 50: 2112-2119Abstract Full Text PDF PubMed Scopus (67) Google Scholar. For cDNA amplification, the following primers were used: p27Kip1 (5′GTCTAACGGGAGCCCGAGCCTGG3′; 5′GAAGGCCGGGCTTCTTGGGCG3′); β-actin (5′GGCCAAGTCATCACTATTGG3′, 5′GGACTCATCGTACTCCTGC3′). A total of 150 ng of the primers was used. The complete amplification mix without the primers was equivalently distributed to separate tubes containing either p27Kip1 or β-actin primers. Reactions were performed using the GeneAmp™ kit (Perkin Elmer Cetus, Überlingen, Germany). Reactions were performed for 30 cycles with an annealing temperature of 60°C for 1.5 minutes, an extension step at 72°C for 1.5 minutes, and a denaturation step at 92°C. Ten microliters of the reaction product were run on a 1.5% agarose gel containing 0.5 μg/ml ethidium bromide. Bands of the predicted size (p27Kip1, 560 bp; β-actin, 360 bp) were photographed with Polaroid 55 negative film, and the reaction products on the film were scanned by laser densitometry. Reverse transcription and cDNA amplification were independently performed three times. Small pieces of kidneys were fixed in Methyl Carnoy's solution, embedded in paraffin, and 2 μm thick sections were prepared. For immunohistochemistry demonstration of p27Kip1, a rabbit polyclonal anti-mouse p27Kip1 antibody (Santa Cruz) was used. This rabbit antiserum was selected instead of the mouse monoclonal anti-p27Kip1 antibody to prevent non-specific binding of secondary anti-mouse antibody to nonspecifically trapped IgG in diabetic mice26.Westberg N.G. Michael A.F. Immunohistopathology of diabetic glomerulosclerosis.Diabetes. 1972; 21: 163-174Crossref PubMed Scopus (98) Google Scholar. Sections were dewaxed, rehydrated and microwave pretreated. Tissue sections were incubated with a 1:20 dilution of the rabbit polyclonal anti-p27Kip1 antibody. As additional controls, slides were incubated with normal rabbit serum. The APAAP complex was used for the visualization of the primary antibody. Evaluation of p27Kip1-positive cells were performed by an investigator blinded to the experimental protocol. p27Kip1-positive cells were counted in at least 10 glomeruli from three independent animals. Results are expressed as means ±SEM. Statistical significance was tested with the Wilcoxon-Mann-Whitney test. A value of P < 0.05 was considered significant. As predicted, db/db mice at seven weeks after birth revealed a higher body and kidney weight as well as significantly higher blood glucose concentrations compared with non-diabetic, age-matched db/+ littermates Table 1.Table 1Body weight, kidney weight, and blood glucose levels of db/+ and db/db mice 7 weeks after birth As shown in Figure 1, glomeruli from db/db mice at seven weeks of age expressed easily detectable amounts of p27Kip1 protein whereas p27Kip1 expression was hardly detectable in non-diabetic db/+ littermates Figure 1. However, in contrast to protein expression, there was no difference in glomerular mRNA expression between db/db and db/+ mice as determined by cDNA amplification of reverse-transcribed RNA Figure 2. Quantification of p27Kip1 expression by laser densitometry is given in Table 2.Figure 2Semiquantitative cDNA amplification of reversed transcribed total RNA. In contrast to p27Kip1 protein expression, there was no change in glomerular transcript abundance between db/+ and db/db mice. Parallel amplification of the housekeeping gene β-actin served as an internal control. Isolation of total RNA, reverse transcription, and cDNA amplification were independently performed three times using isolated glomeruli from different animals.View Large Image Figure ViewerDownload (PPT)Table 2Quantitative analysis of Western blots by laser densitometryTable 2Quantitative analysis of Western blots by laser densitometry Immunohistochemistry staining was performed to obtain further information on the morphological localization of the increased p27Kip1 protein expression in db/db mice. Since diffuse linear localization of IgG along the glomerular capillary wall has been observed in diabetic nephropathy which may be non-specifically detected by a secondary anti-mouse antibody26.Westberg N.G. Michael A.F. Immunohistopathology of diabetic glomerulosclerosis.Diabetes. 1972; 21: 163-174Crossref PubMed Scopus (98) Google Scholar, we used for our indirect immunohistochemistry studies a rabbit polyclonal anti-p27Kip1 antiserum with an anti-rabbit secondary antibody. Furthermore, sections were microwave pretreated which destroys potential mouse IgG. p27Kip1 staining was principally localized to nuclei. Only a few, mainly podocytes and endothelial cells, stained positively for p27Kip1 in db/+ mice Figure 3a. In contrast, a significant increase in the number of p27Kip1-positive cells were observed in db/db mice Figure 3b. These positive cells were mainly found in mesangial areas, but occasionally nuclei of endothelial cells were also positive. Quantification of glomerular p27Kip1-positive cells revealed a significant incr" @default.
• W2092433658 created "2016-06-24" @default.
• W2092433658 creator A5010801772 @default.
• W2092433658 creator A5022475409 @default.
• W2092433658 creator A5040093820 @default.
• W2092433658 creator A5040494349 @default.
• W2092433658 creator A5056621753 @default.
• W2092433658 creator A5070005567 @default.
• W2092433658 date "1998-04-01" @default.
• W2092433658 modified "2023-10-15" @default.
• W2092433658 title "Glomerular expression of p27Kip1 in diabetic db/db mouse: Role of hyperglycemia" @default.
• W2092433658 cites W1572048900 @default.
• W2092433658 cites W1574419048 @default.
• W2092433658 cites W1964094843 @default.
• W2092433658 cites W1964448491 @default.
• W2092433658 cites W1978747049 @default.
• W2092433658 cites W1984640964 @default.
• W2092433658 cites W1986722947 @default.
• W2092433658 cites W1988171238 @default.
• W2092433658 cites W1991530366 @default.
• W2092433658 cites W1997298109 @default.
• W2092433658 cites W2000519471 @default.
• W2092433658 cites W2009775031 @default.
• W2092433658 cites W2010018722 @default.
• W2092433658 cites W2011848967 @default.
• W2092433658 cites W2012293213 @default.
• W2092433658 cites W2015066175 @default.
• W2092433658 cites W2016994959 @default.
• W2092433658 cites W2021457628 @default.
• W2092433658 cites W2024482135 @default.
• W2092433658 cites W2025671031 @default.
• W2092433658 cites W2031301348 @default.
• W2092433658 cites W2033950216 @default.
• W2092433658 cites W2035053654 @default.
• W2092433658 cites W2036853065 @default.
• W2092433658 cites W2038376881 @default.
• W2092433658 cites W2039402104 @default.
• W2092433658 cites W2039839254 @default.
• W2092433658 cites W2041573061 @default.
• W2092433658 cites W2048655841 @default.
• W2092433658 cites W2051192888 @default.
• W2092433658 cites W2060313221 @default.
• W2092433658 cites W2060423078 @default.
• W2092433658 cites W2062036646 @default.
• W2092433658 cites W2066907979 @default.
• W2092433658 cites W2067622134 @default.
• W2092433658 cites W2085129915 @default.
• W2092433658 cites W2091754751 @default.
• W2092433658 cites W2094859123 @default.
• W2092433658 cites W2106341180 @default.
• W2092433658 cites W2117810164 @default.
• W2092433658 cites W2128705810 @default.
• W2092433658 cites W2145356697 @default.
• W2092433658 cites W2158734340 @default.
• W2092433658 cites W2168176965 @default.
• W2092433658 cites W2285177017 @default.
• W2092433658 cites W2297568899 @default.
• W2092433658 cites W2324062964 @default.
• W2092433658 cites W2412946328 @default.
• W2092433658 cites W4252245575 @default.
• W2092433658 doi "https://doi.org/10.1111/j.1523-1755.1998.00829.x" @default.
• W2092433658 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/9551393" @default.
• W2092433658 hasPublicationYear "1998" @default.
• W2092433658 type Work @default.
• W2092433658 sameAs 2092433658 @default.
• W2092433658 citedByCount "88" @default.
• W2092433658 countsByYear W20924336582012 @default.
• W2092433658 countsByYear W20924336582013 @default.
• W2092433658 countsByYear W20924336582014 @default.
• W2092433658 countsByYear W20924336582015 @default.
• W2092433658 countsByYear W20924336582016 @default.
• W2092433658 countsByYear W20924336582017 @default.
• W2092433658 countsByYear W20924336582020 @default.
• W2092433658 countsByYear W20924336582021 @default.
• W2092433658 countsByYear W20924336582022 @default.
• W2092433658 crossrefType "journal-article" @default.
• W2092433658 hasAuthorship W2092433658A5010801772 @default.
• W2092433658 hasAuthorship W2092433658A5022475409 @default.
• W2092433658 hasAuthorship W2092433658A5040093820 @default.
• W2092433658 hasAuthorship W2092433658A5040494349 @default.
• W2092433658 hasAuthorship W2092433658A5056621753 @default.
• W2092433658 hasAuthorship W2092433658A5070005567 @default.
• W2092433658 hasBestOaLocation W20924336581 @default.
• W2092433658 hasConcept C126322002 @default.
• W2092433658 hasConcept C134018914 @default.
• W2092433658 hasConcept C555293320 @default.
• W2092433658 hasConcept C71924100 @default.
• W2092433658 hasConceptScore W2092433658C126322002 @default.
• W2092433658 hasConceptScore W2092433658C134018914 @default.
• W2092433658 hasConceptScore W2092433658C555293320 @default.
• W2092433658 hasConceptScore W2092433658C71924100 @default.
• W2092433658 hasIssue "4" @default.
• W2092433658 hasLocation W20924336581 @default.
• W2092433658 hasLocation W20924336582 @default.
• W2092433658 hasOpenAccess W2092433658 @default.
• W2092433658 hasPrimaryLocation W20924336581 @default.
• W2092433658 hasRelatedWork W1966504330 @default.
• W2092433658 hasRelatedWork W1966775726 @default.

• next