FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2092752023> ?p ?o ?g. }

• W2092752023 endingPage "39494" @default.
• W2092752023 startingPage "39485" @default.
• W2092752023 abstract "In salivary acinar cells, intracellular calcium ([Ca2+]i) signaling plays an important role in eliciting fluid secretion through the activation of Ca2+-activated ionic conductances. Ca2+ and cAMP have synergistic effects on fluid secretion such that peak secretion is elicited following activation of both parasympathetic and sympathetic pathways. We have recently demonstrated that cAMP exerts effects on Ca2+ release, through protein kinase A (PKA)-mediated phosphorylation of inositol 1,4,5-trisphosphate receptors (InsP3R) in mouse parotid acinar cells. To extend these findings, in the present study cross-talk between Ca2+ signaling and cAMP pathways in human parotid acinar cells was investigated. In human parotid acinar cells, carbachol stimulation evoked increases in the [Ca2+]i and the initial peak amplitude was enhanced following PKA activation, consistent with reports from mouse parotid. Stimulation with ATP also evoked an increase in [Ca2+]i. The ATP-evoked Ca2+ elevation was largely dependent on extracellular Ca2+, suggesting the involvement of the P2X family of purinergic receptors. Pharmacological elevation of cAMP resulted in a ∼5-fold increase in the peak [Ca2+]i change evoked by ATP stimulation. This enhanced [Ca2+]i increase was not dependent on intracellular release from InsP3R or ryanodine receptors, suggesting a direct effect on P2XR. Reverse transcription-polymerase chain reaction and Western blot analysis confirmed the presence of P2X4R and P2X7R mRNA and protein in human parotid acinar cells. ATP-activated cation currents were studied using whole cell patch clamp techniques in HEK-293 cells, a null background for P2XR. Raising cAMP resulted in a ∼4.5-fold enhancement of ATP-activated current in HEK-293 cells transfected with P2X4R DNA but had no effects on currents in cells expressing P2X7R. These data indicate that in human parotid acinar cells, in addition to modulation of Ca2+ release, Ca2+ influx through P2X4R may constitute a further locus for the synergistic effects of Ca2+ and PKA activation. In salivary acinar cells, intracellular calcium ([Ca2+]i) signaling plays an important role in eliciting fluid secretion through the activation of Ca2+-activated ionic conductances. Ca2+ and cAMP have synergistic effects on fluid secretion such that peak secretion is elicited following activation of both parasympathetic and sympathetic pathways. We have recently demonstrated that cAMP exerts effects on Ca2+ release, through protein kinase A (PKA)-mediated phosphorylation of inositol 1,4,5-trisphosphate receptors (InsP3R) in mouse parotid acinar cells. To extend these findings, in the present study cross-talk between Ca2+ signaling and cAMP pathways in human parotid acinar cells was investigated. In human parotid acinar cells, carbachol stimulation evoked increases in the [Ca2+]i and the initial peak amplitude was enhanced following PKA activation, consistent with reports from mouse parotid. Stimulation with ATP also evoked an increase in [Ca2+]i. The ATP-evoked Ca2+ elevation was largely dependent on extracellular Ca2+, suggesting the involvement of the P2X family of purinergic receptors. Pharmacological elevation of cAMP resulted in a ∼5-fold increase in the peak [Ca2+]i change evoked by ATP stimulation. This enhanced [Ca2+]i increase was not dependent on intracellular release from InsP3R or ryanodine receptors, suggesting a direct effect on P2XR. Reverse transcription-polymerase chain reaction and Western blot analysis confirmed the presence of P2X4R and P2X7R mRNA and protein in human parotid acinar cells. ATP-activated cation currents were studied using whole cell patch clamp techniques in HEK-293 cells, a null background for P2XR. Raising cAMP resulted in a ∼4.5-fold enhancement of ATP-activated current in HEK-293 cells transfected with P2X4R DNA but had no effects on currents in cells expressing P2X7R. These data indicate that in human parotid acinar cells, in addition to modulation of Ca2+ release, Ca2+ influx through P2X4R may constitute a further locus for the synergistic effects of Ca2+ and PKA activation. In salivary acinar cells, acetylcholine (ACh) 1The abbreviations used are: ACh, acetylcholine; CCH, carbamylcholine (carbachol); PKA, protein kinase A; R, receptor(s); [Ca2+]i, intracellular calcium concentration; InsP3, inositol 1,4,5-trisphosphate; RyR, ryanodine receptor(s); RT, reverse transcription; Bz-ATP, 2′-3′-O-(4-benzoylbenzoyl)ATP. 1The abbreviations used are: ACh, acetylcholine; CCH, carbamylcholine (carbachol); PKA, protein kinase A; R, receptor(s); [Ca2+]i, intracellular calcium concentration; InsP3, inositol 1,4,5-trisphosphate; RyR, ryanodine receptor(s); RT, reverse transcription; Bz-ATP, 2′-3′-O-(4-benzoylbenzoyl)ATP. released following parasympathetic stimulation is the primary regulator of a variety of physiological processes, including exocytosis of salivary proteins and fluid secretion. These processes are controlled in large part by the ACh-stimulated increase in [Ca2+]i as a result of the Gαq-coupled, phospholipase C-catalyzed increase in inositol 1,4,5-trisphosphate (InsP3) and subsequent Ca2+ release from the endoplasmic reticulum (1Dobrosielski-Vergona K. Biology of the Salivary Glands. CRC Press, Inc., Boca Raton1993: 153-179Google Scholar, 2Ambudkar I.S. Crit. Rev. Oral Biol. Med. 2000; 11: 4-25Crossref PubMed Scopus (80) Google Scholar, 3Berridge M.J. Lipp P. Bootman M.D. Nat. Rev. Mol. Cell. Biol. 2000; 1: 11-21Crossref PubMed Scopus (4366) Google Scholar, 4Sawaki K. Hiramatsu Y. Baum B.J. Ambudkar I.S. Arch. Biochem. Biophys. 1993; 305: 546-550Crossref PubMed Scopus (32) Google Scholar).The principal targets of the [Ca2+]i increase important for initiating fluid secretion are Ca2+-activated conductances required for the transcellular movement of ions (5Melvin J.E. Crit. Rev. Oral. Biol. Med. 1999; 10: 199-209Crossref PubMed Scopus (55) Google Scholar, 6Turner R.J. Ann. N. Y. Acad. Sci. 1993; 694: 24-35Crossref PubMed Scopus (57) Google Scholar, 7Petersen O.H. J. Physiol. 1992; 448: 1-51Crossref PubMed Scopus (366) Google Scholar, 8Giovannucci D.R. Bruce J.I. Straub S.V. Arreola J. Sneyd J. Shuttleworth T.J. Yule D.I. J. Physiol. 2002; 540: 469-484Crossref PubMed Scopus (67) Google Scholar, 9Park K. Case R.M. Brown P.D. Arch. Oral Biol. 2001; 46: 801-810Crossref PubMed Scopus (24) Google Scholar). Initially, Ca2+-activated Cl– conductances present in the apical plasma membrane of the acinar cell are activated by the release of Ca2+. The result of net Cl– accumulation into the lumen leads to an electrical potential that allows Na+ movement via the paracellular pathway, and the subsequent osmotic movement of water creates an isotonic, NaCl-rich fluid, the primary saliva (10Baum B.J. Ann. N. Y. Acad. Sci. 1993; 694: 17-23Crossref PubMed Scopus (241) Google Scholar, 11Putney Jr., J.W. Annu. Rev. Physiol. 1986; 48: 75-88Crossref PubMed Google Scholar). As a consequence of the Cl– flux through Ca2+-activated Cl– conductance, the membrane depolarizes and the driving force for secretion diminishes as the membrane potential (Vm) approaches the equilibrium potential for Cl– (ECl). To maintain the membrane potential and facilitate continued Cl– efflux, basolaterally located Ca2+-activated K+ channels open, allowing K+ efflux (7Petersen O.H. J. Physiol. 1992; 448: 1-51Crossref PubMed Scopus (366) Google Scholar, 9Park K. Case R.M. Brown P.D. Arch. Oral Biol. 2001; 46: 801-810Crossref PubMed Scopus (24) Google Scholar, 12Nehrke K. Quinn C.C. Begenisich T. Am. J. Physiol. 2003; 284: C535-C546Crossref PubMed Scopus (55) Google Scholar, 13Putney Jr., J.W. J. Pharmacol. Exp. Ther. 1976; 198: 375-384PubMed Google Scholar) and membrane repolarization.Fluid secretion evoked by muscarinic stimulation has been shown to be dramatically potentiated by activation of cAMP-raising pathways, for example by co-stimulation with vasoactive intestinal peptide or β-adrenoreceptor agonists (14Larsson O. Olgart L. Acta. Physiol. Scand. 1989; 137: 231-236Crossref PubMed Scopus (38) Google Scholar, 15Bobyock E. Chernick W.S. J. Dent. Res. 1989; 68: 1489-1494Crossref PubMed Scopus (37) Google Scholar, 16Baldys-Waligorska A. Pour A. Moriarty C.M. Dowd F. Biochim. Biophys. Acta. 1987; 929: 190-196Crossref PubMed Scopus (23) Google Scholar, 17Yoshimura K. Hiramatsu Y. Murakami M. Biochim. Biophys. Acta. 1998; 1402: 171-187Crossref PubMed Scopus (19) Google Scholar). Recently, cAMP has been shown to modulate the cellular Ca2+ release machinery. Specifically in mouse parotid acinar cells, stimulation with cAMP-raising agents and subsequent activation of protein kinase A (PKA) results in phosphorylation of type II InsP3 receptors (InsP3R), and increased sensitivity of the receptor to InsP3 (18Bruce J.I. Shuttleworth T.J. Giovannucci D.R. Yule D.I. J. Biol. Chem. 2002; 277: 1340-1348Abstract Full Text Full Text PDF PubMed Scopus (128) Google Scholar, 19Tanimura A. Nezu A. Tojyo Y. Matsumoto Y. Am. J. Physiol. 1999; 276: C1282-C1287Crossref PubMed Google Scholar). This enhanced Ca2+ release appears largely responsible for the potentiated CCh-evoked Ca2+ response that is observed following exposure to cAMP-raising agonists and is consistent with this event contributing to potentiated fluid secretion observed upon co-stimulation with cAMP and Ca2+ raising agonists. An initial goal of this study was to confirm that this mechanism is relevant in salivary gland tissue of human origin. Indeed, using two different cAMP-raising agents, the present study demonstrated that CCh-evoked Ca2+ signaling in human parotid acinar cells was potentiated with characteristics similar to that observed in mouse parotid acinar cells.In addition to ACh release following parasympathetic stimulation, extracellular ATP also functions as a regulator of salivary gland function. Indeed, various salivary gland acinar cells derived from an assortment of species express ATP-activated purinergic receptors (20Gallacher D.V. Nature. 1982; 296: 83-86Crossref PubMed Scopus (89) Google Scholar, 21McMillian M.K. Soltoff S.P. Lechleiter J.D. Cantley L.C. Talamo B.R. Biochem. J. 1988; 255: 291-300PubMed Google Scholar, 22Soltoff S.P. McMillian M.K. Cragoe Jr., E.J. Cantley L.C. Talamo B.R. J. Gen. Physiol. 1990; 95: 319-346Crossref PubMed Scopus (61) Google Scholar, 23Soltoff S.P. McMillian M.K. Lechleiter J.D. Cantley L.C. Talamo B.R. Ann. N. Y. Acad. Sci. 1990; 603 (discussion 91–72): 76-90Crossref PubMed Scopus (36) Google Scholar, 24Turner J.T. Landon L.A. Gibbons S.J. Talamo B.R. Crit. Rev. Oral. Biol. Med. 1999; 10: 210-224Crossref PubMed Scopus (61) Google Scholar, 25Turner J.T. Park M. Camden J.M. Weisman G.A. Ann. N. Y. Acad. Sci. 1998; 842: 70-75Crossref PubMed Scopus (21) Google Scholar, 26Turner J.T. Weisman G.A. Landon L.A. Park M. Camden J.M. Eur. J. Morphol. 1998; 36: 170-175PubMed Google Scholar, 27Xu X. Diaz J. Zhao H. Muallem S. J. Physiol. 1996; 491: 647-662Crossref PubMed Scopus (58) Google Scholar, 28Lee M.G. Zeng W. Muallem S. J. Biol. Chem. 1997; 272: 32951-32955Abstract Full Text Full Text PDF PubMed Scopus (55) Google Scholar, 29Luo X. Zheng W. Yan M. Lee M.G. Muallem S. Am. J. Physiol. 1999; 277: C205-C215Crossref PubMed Google Scholar). The purinergic receptor gene family consists of two distinct groups based on the signal transduction pathway activated by ATP binding. P2Y receptors (P2YR) act as traditional Gαq-coupled receptors, and thus activation results in an increase in [Ca2+]i (30Harden T.K. Boyer J.L. Nicholas R.A. Annu. Rev. Pharmacol. Toxicol. 1995; 35: 541-579Crossref PubMed Google Scholar). P2X receptors (P2XR) conversely act as ligand-gated, cation-selective ion channels (31North R.A. Physiol. Rev. 2002; 82: 1013-1067Crossref PubMed Scopus (2438) Google Scholar). Activation of P2XR consequently results in the influx of positively charged ions such as Na+ and Ca2+ into the cell. Thus, P2XR represents an additional mechanism resulting in a increase in [Ca2+]i, which is independent of the InsP3R pathway. Salivary tissue has been reported to express P2X4 and P2X7 (P2Z) as well as P2Y1 and P2Y2 (P2U) receptors (22Soltoff S.P. McMillian M.K. Cragoe Jr., E.J. Cantley L.C. Talamo B.R. J. Gen. Physiol. 1990; 95: 319-346Crossref PubMed Scopus (61) Google Scholar, 23Soltoff S.P. McMillian M.K. Lechleiter J.D. Cantley L.C. Talamo B.R. Ann. N. Y. Acad. Sci. 1990; 603 (discussion 91–72): 76-90Crossref PubMed Scopus (36) Google Scholar, 24Turner J.T. Landon L.A. Gibbons S.J. Talamo B.R. Crit. Rev. Oral. Biol. Med. 1999; 10: 210-224Crossref PubMed Scopus (61) Google Scholar, 28Lee M.G. Zeng W. Muallem S. J. Biol. Chem. 1997; 272: 32951-32955Abstract Full Text Full Text PDF PubMed Scopus (55) Google Scholar, 32Li Q. Luo X. Zeng W. Muallem S. J. Biol. Chem. 2003; 278: 47554-47561Abstract Full Text Full Text PDF PubMed Scopus (50) Google Scholar). These receptors are thought to be activated by neuronally released ATP, co-packaged with various neurotransmitters. Additionally, it has been proposed that ATP released from neighboring acinar cells, possibly through exocytosis of zymogen granules or transit through gap-junction hemi-channels, acts in a paracrine manner (33Sorensen C.E. Novak I. J. Biol. Chem. 2001; 276: 32925-32932Abstract Full Text Full Text PDF PubMed Scopus (154) Google Scholar, 34Novak I. Nitschke R. Amstrup J. Cell Physiol. Biochem. 2002; 12: 83-92Crossref PubMed Scopus (26) Google Scholar, 35Arcuino G. Lin J.H. Takano T. Liu C. Jiang L. Gao Q. Kang J. Nedergaard M. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 9840-9845Crossref PubMed Scopus (263) Google Scholar). In terms of elevating [Ca2+]i, it has been suggested that activation of purinergic receptors by ATP is a more effective stimulus than activation of muscarinic receptors (21McMillian M.K. Soltoff S.P. Lechleiter J.D. Cantley L.C. Talamo B.R. Biochem. J. 1988; 255: 291-300PubMed Google Scholar). Consistent with this assertion ATP can effectively regulate secretory processes in salivary glands (21McMillian M.K. Soltoff S.P. Lechleiter J.D. Cantley L.C. Talamo B.R. Biochem. J. 1988; 255: 291-300PubMed Google Scholar). Thus, the principal goal of the present study was to investigate the effects of ATP in human parotid acinar cells. Moreover, as synergism between cAMP and Ca2+ signaling is physiologically important in this tissue, the effects of raising cAMP on ATP-mediated Ca2+ signaling events were also evaluated. These latter experiments reveal a novel mechanism whereby raising cAMP can potentiate Ca2+-signaling events via an effect on P2X4R purinergic signaling in human parotid acinar cells.MATERIALS AND METHODSIsolation of Human Parotid Acinar Cells—Human parotid tissue was obtained from adult male and female subjects scheduled to have parotid surgery because their gland contained an adenoma or other type of tumor that required removal of all or a large portion of the gland. Not all of the normal tissue surrounding the tumor is typically used for diagnostic evaluation of the sample. This remaining tissue was collected immediately after surgical excision and transported in ice-cold physiological saline to the laboratory for acute functional assays, and cell preparations were begun within 1 h of surgical removal. Informed consent was obtained, and the use of human tissue was approved by the University of Rochester Institutional Review Board. Small groups of human parotid acinar cells were isolated by collagenase digestion of surgically resected human parotid glands using a protocol similar to that described previously for the isolation of rodent parotid acinar cells (36Nguyen H.V. Stuart-Tilley A. Alper S.L. Melvin J.E. Am. J. Physiol. 2003; 286: G312-G320Google Scholar, 37Evans R.L. Bell S.M. Schultheis P.J. Shull G.E. Melvin J.E. J. Biol. Chem. 1999; 274: 29025-29030Abstract Full Text Full Text PDF PubMed Scopus (55) Google Scholar). Briefly, parotid glands were dissected from connective tissue and minced in Earle's minimum essential medium (Biofluids, Rockville, MD) containing 2 mm glutamine, 0.1% bovine serum albumin, and 0.02% Type I-S trypsin inhibitor (Sigma). Minced tissue was placed in Earle's minimum essential medium (Biofluids) containing 2 mm glutamine, 0.1% bovine serum albumin, and 0.3 mg/ml collagenase P (Roche Applied Science) and was dispersed by multiple triterations. Cells were resuspended in Basal Media Eagle (Invitrogen) supplemented with 2 mm glutamine, 0.1% bovine serum albumin, 100 units-100 μg/ml penicillin/streptomycin and maintained at 37 °C and equilibrated with 95% O2 and 5% CO2 until use.Digital Imaging of Intracellular Ca2+—Human parotid acinar cells were loaded with the Ca2+-sensitive dye Fura-2 AM (2 μm, TEFLABS, Austin, TX) by incubation for 30 min in a physiological saline solution at room temperature. Cells were removed from Fura-2-containing solution and resuspended in physiological saline solution used for imaging experiments that contained (mm): 137 NaCl, 0.56 MgCl2, 4.7 KCl, 1 Na2HPO4, 10 HEPES, 5.5 glucose, 1.26 CaCl2, pH 7.4. Fura-2-loaded cells were allowed to adhere to a 25-mm glass coverslip for 1 min before cells were locally superfused at a rate of at least 1 ml/min using a 0.5-mm diameter fused silica tube placed within 100 μm of the cells to be recorded. Rapid solution changes were performed utilizing an electronic solenoid controlled perfusion system and gravity-fed reservoirs (Warner Instruments, Hamden, CT). Imaging was performed using an inverted Nikon epifluorescence microscope with a 40× oil immersion objective lens (numerical aperture, 1.3). Fura-2-loaded cells were excited alternately with light at 340 and 380 nm using a monochromator-based illumination system, and the emission at 510 nm was captured using a high speed, digital charge-coupled device camera (TILL Photonics, Pleasanton, CA). The fluorescence ratio of 340 nm over 380 nm was calculated, and all data are presented as the change in ratio units. Images were acquired at a rate of 1 Hz with an exposure of 20 ms. All imaging experiments were performed at room temperature, essentially as previously described (8Giovannucci D.R. Bruce J.I. Straub S.V. Arreola J. Sneyd J. Shuttleworth T.J. Yule D.I. J. Physiol. 2002; 540: 469-484Crossref PubMed Scopus (67) Google Scholar, 38Brown D.A. Melvin J.E. Yule D.I. Am. J. Physiol. 2003; 285: G804-G812Crossref PubMed Scopus (35) Google Scholar, 39Straub S.V. Giovannucci D.R. Bruce J.I. Yule D.I. J. Biol. Chem. 2002; 277: 31949-31956Abstract Full Text Full Text PDF PubMed Scopus (51) Google Scholar). Traces are from a single cell, representative of multiple individual cells (>3 cells) from an imaged acinus in a particular experimental run, and n represents the number of experimental runs.PCR Analysis—Total RNA from three individual human parotid tissues was prepared using an RNeasy RNA kit (Qiagen). From these RNA preparations, cDNA preparations were made using an RT-PCR kit (Stratagene, La Jolla, CA). For positive controls total RNA from human brain, testis, and spleen were obtained from BD Biosciences. One-step RT-PCR was done for the positive controls using a commercially available kit (Invitrogen). Primers were ordered from Integrated DNA Technologies (Coralville, IA). Primers were diluted to a working solution concentration of 20 pm/μl. Each reaction contained (in μl): 2.5 10× PCR Buffer, 2.0 50 mm MgCl2, 1 4× dNTP (25 mm), 1 cDNA of interest, 0.5 forward primer, 0.5 reverse primer, and 0.1 Taq polymerase. All standard reagents were from Invitrogen. The total reaction volume was 25 μl. The PCR cycler protocol was 94 °C for 3 min, 94 °C for 30 s, 59 °C for 30 s, 72 °C for 1 min, for 30 cycles, then 72 °C for 3 min, final hold 4 °C. Samples were separated on a 1–3% agarose (TAE buffered) gel for 1–2 h at 100 mV and visualized by ethidium bromide staining. A 100-bp DNA ladder was used as a molecular size marker. The primer sequences and expected sizes of the PCR products are shown in Table I.Table IOligonucleotide primers used to detect P2X receptor subtypes by RT-PCRForward primerReverse primerExpected sizebpP2X1TGCTTCACATCCTGCCTAAGAGGCACATGCACCCTGAGCTTCTGGCAAACTG291P2X2TCAGTAGCGGAGCATCTCCACGAAACGGGCAGATTCAAGGTTACAACGCCTG274P2X3AGCGTTTCTGAGAAAAGCAGCGTGTCTAAAGGCCGCCACAGAGCTGATGATG190P2X4TGGGTCAACTCTGCTTTTCCCGCAACTCTCTGAGGAGAAATGCCAGCTCTGC294P2X5AGGATGCTGCCCAACGGGAAATTTGAGCCACGGAGAAAGGAAGAACTGACG176P2X6TGTCCAAGTTCTGACACCCACTTGCCTTCTGTCGCCGTCTCAAAACACAGCC252P2X7AAGTGCGAGTCCATTGTGGAGCCAGGACGTGTCTGGACAGGACCA410 Open table in a new tab Transfection of HEK-293 Cells—Rat P2X4R or P2X7R cDNA kindly provided by R. A. North (University of Manchester, UK) was transiently transfected into HEK-293 cells using LipofectAMINE 2000 (Invitrogen) following the instructions provided. Specifically, 5 × 104 cells were grown on 25-mm coverslips in 6-well culture plates and were co-transfected with 1 μg of the P2XR cDNA and 100 ng of pHcRed 1-N1 cDNA (red fluorescent protein for visualization of positively transfected cells) per well. Just prior to transfection cells were placed in 2 ml of Opti-MEM (Invitrogen) medium and incubated with the DNA mixture in 500 μl of Opti-MEM per well for 3–5hina5%CO2 incubator at 37 °C. After 3–5 h the media was removed and the cells were washed in phosphate-buffered saline and then placed back into 2 ml of MEM supplemented with 10% fetal bovine serum and penicillin-streptomycin (100 units-100 μg/ml) per well. Transfected cells were placed in a 5% CO2 incubator at 37 °C overnight, and experiments were performed the next day. All standard reagents not mentioned were from Invitrogen.Electrophoresis and Immunoblotting—Protein samples were prepared from isolated human parotid acinar cells. Briefly, cells were pelleted and resuspended in an ice-cold lysis buffer that contained (mm): 250 NaCl, 50 Tris, 5 EDTA, 50 NaF, 0.1% Triton X-100, and 1 Complete EDTA-free protease inhibitor mixture tablet (Roche Applied Science), pH 7.4. Samples were sonicated and left on ice for 30 min to solubilize. Protein concentrations were measured using Bio-Rad protein assay reagent. Samples were resolved on 7.5% SDS-PAGE and transferred at room temperature to nitrocellulose membranes using a semi-dry transfer system for 1 h at 0.08 A (Bio-Rad). Polyclonal α-P2X4R and α-P2X7R primary antibodies were obtained from Chemicon (Temecula, CA) and used at a 1:250 dilution. When indicated, the control antigen was preincubated in the primary antibody for 1 h at room temperature prior to use (1 μg of antigen/1 μg of primary antibody). After 2 h of incubation in primary antibody at room temperature, the proteins were visualized using a 1:2000 dilution of goat anti-rabbit IgG horseradish peroxidase secondary antibody (Bio-Rad) and SuperSignal West Pico substrate (Pierce) exposed on XAR film (Eastman Kodak Co.).Whole Cell Patch Clamp Recordings—ATP-activated cation currents were recorded at a sampling rate of 1 kHz using an Axopatch 200A patch clamp amplifier (Axon Instruments, Union City, CA), Axon digital interface, and pCLAMP version 9.0 software using the whole cell patch clamp technique. To measure ATP-activated currents in HEK-293 cells, cells were perfused with an extracellular solution containing (mm): 140 NaCl, 5 CsCl, 1.2 MgCl2, 1 CaCl2, 10 HEPES-CsOH, 10 d-glucose, pH 7.4. Internal patch solution contained (mm): 140 cesium acetate, 1.22 MgCl2, 10 HEPES-CsOH, 0.1 EGTA, 10 NaCl, 0.0365 CaCl2, pH 7.2. Intervals of 2–3 min were allowed between patch rupture and stimuli to allow for equilibration with the patch pipette solution. HEK-293 cells were voltage-clamped at a holding potential of –30 mV. Experiments were performed at room temperature. All currents were normalized to cell size.Statistical Analysis—Statistical significance was determined using either a paired or unpaired t test. Data from several cells in a particular experimental run were averaged, and experiment averages were used to calculate the mean ± S.E. Two-tailed p values of less than 0.05 were considered statistically significant.RESULTSEffects of cAMP on CCh-evoked Ca2+Signals in Human Parotid Acinar Cells—Experiments were first performed to characterize Ca2+ signaling events in human parotid acinar cells following muscarinic receptor stimulation. Low, physiologically relevant concentrations of CCh (100–300 nm) elicited oscillatory-type responses, typical of signals observed in mouse exocrine acinar cells at similar concentrations of muscarinic agonist. In contrast, higher concentrations of CCh (5 μm) resulted in a peak and plateau-type response, characteristic of maximal concentrations of agonists in a variety of exocrine cell types (Fig. 1A) (18Bruce J.I. Shuttleworth T.J. Giovannucci D.R. Yule D.I. J. Biol. Chem. 2002; 277: 1340-1348Abstract Full Text Full Text PDF PubMed Scopus (128) Google Scholar, 38Brown D.A. Melvin J.E. Yule D.I. Am. J. Physiol. 2003; 285: G804-G812Crossref PubMed Scopus (35) Google Scholar, 40Yule D.I. Gallacher D.V. FEBS Lett. 1988; 239: 358-362Crossref PubMed Scopus (96) Google Scholar).Recently, it has been reported that raising cAMP significantly potentiates CCh-induced Ca2+ release in mouse parotid acinar cells (18Bruce J.I. Shuttleworth T.J. Giovannucci D.R. Yule D.I. J. Biol. Chem. 2002; 277: 1340-1348Abstract Full Text Full Text PDF PubMed Scopus (128) Google Scholar). This effect was blocked by the serine/threonine kinase inhibitor H89, and attributed to phosphoregulation of InsP3R (18Bruce J.I. Shuttleworth T.J. Giovannucci D.R. Yule D.I. J. Biol. Chem. 2002; 277: 1340-1348Abstract Full Text Full Text PDF PubMed Scopus (128) Google Scholar). Initially, experiments were performed to investigate if a similar phenomenon occurs in human parotid acinar cells. Prior incubation of human parotid acinar cells with forskolin (Fig. 1B) or the β-adrenergic agonist, isoprenaline (Fig. 1C) to raise cAMP levels, significantly enhanced the peak amplitude of the CCh-evoked [Ca2+]i signal by 146 ± 17% and 135 ± 13%, respectively, over the control response; p = 0.01. These data are consistent with studies in mouse parotid in which forskolin enhanced the CCh-evoked [Ca2+]i response by ∼150% (18Bruce J.I. Shuttleworth T.J. Giovannucci D.R. Yule D.I. J. Biol. Chem. 2002; 277: 1340-1348Abstract Full Text Full Text PDF PubMed Scopus (128) Google Scholar). The cAMP-induced potentiation of CCh-stimulated Ca2+ signaling was blocked by prior incubation with H89 (second response reduced to 94 ± 3% of the first response) (Fig. 1D) suggesting that PKA activity was responsible for the effect. These data in human acinar cells are entirely consistent with studies from mouse and presumably reflect a similar mechanism; i.e. potentiation of Ca2+ release via phosphorylation of InsP3R.Extracellular ATP Stimulates an Increase in [Ca2+]i in Human Parotid Acinar Cells—Purinergic receptor stimulation has been reported to regulate secretory function in mouse and rat salivary glands by increasing [Ca2+]i. We therefore evaluated the effects of ATP in stimulating Ca2+-signaling events in human parotid acinar cells. A minority of cells responded following exposure to 1–50 μm ATP. 100 μm ATP however, consistently elicited an increase in [Ca2+]i (Fig. 2A), although markedly smaller than Ca2+ elevations initiated by physiological muscarinic receptor stimulation. Significantly larger responses were not induced by higher concentrations of ATP (data not shown). Thus, although these observations suggest that human parotid acinar cells express at least one type of purinergic receptor, stimulation of these receptors results only in modest increases in [Ca2+]i in contrast to muscarinic stimulation.Fig. 2ATP stimulation results in an elevation of [Ca2+]i in human parotid acini.A, stimulation with 100 μm ATP results in a small reproducible Ca2+ transient. B, 100 μm UTP causes little, if any, Ca2+ response in human parotid acinar cells while stimulation with 100 μm ATP in the same cells generates a small Ca2+ transient. C, 100 μm ATP stimulation failed to increase [Ca2+]i in human parotid acinar cells in external Ca2+-free solution. However, addition of Ca2+ to the extracellular medium resulted in a significant increase in [Ca2+]i. This suggests that ATP is acting on P2XR. Each trace is representative of four or more experiments.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Experiments were next performed to define the class of purinergic receptor responsible for the ATP-stimulated increase in [Ca2+]i. Although ATP is an agonist at both P2YR and P2XR, UTP is considered to be a relatively selective activator of P2YR (24Turner J.T. Landon L.A. Gibbons S.J. Talamo B.R. Crit. Rev. Oral. Biol. Med. 1999; 10: 210-224Crossref PubMed Scopus (61) Google Scholar, 41Muller C.E. Curr. Pharm. Des. 2002; 8: 2353-2369Crossref PubMed Scopus (55) Google Scholar). Stimulation with 100 μm-1 mm UTP did not cause a detectable [Ca2+]i response in the vast majority of human parotid acinar cells (Fig. 2B) (54 of 59 cells). In the four cells where an increase was detected, UTP stimulation resulted in a change of 0.018 ± 0.005 ratio units. In contrast, stimulation with 100 μm ATP in the same cells resulted in a significantly larger Ca2+ transient of 0.088 ± 0.021 units; p = 0.04 (Fig. 2B). These data provide an initial suggestion that P2XR are the predominant mediator of purinergic receptor Ca2+ signaling in human parotid acinar cells.Conceptually, a further paradigm to identify any contribution of P2YRs is to isolate Ca2+ release either by removing extracellular Ca2+ or alternatively by blocking Ca2+ influx through P2XR. In Ca2+-free external solution, 100 μm ATP failed to increase [Ca2+]i, indicating that Ca2+ release (presumably through P2YR) was not occurring to a signi" @default.
• W2092752023 created "2016-06-24" @default.
• W2092752023 creator A5006672847 @default.
• W2092752023 creator A5027714194 @default.
• W2092752023 creator A5078948939 @default.
• W2092752023 creator A5086002793 @default.
• W2092752023 date "2004-09-01" @default.
• W2092752023 modified "2023-09-29" @default.
• W2092752023 title "cAMP Potentiates ATP-evoked Calcium Signaling in Human Parotid Acinar Cells" @default.
• W2092752023 cites W1599277155 @default.
• W2092752023 cites W1747783318 @default.
• W2092752023 cites W1830561018 @default.
• W2092752023 cites W1871656259 @default.
• W2092752023 cites W1897243328 @default.
• W2092752023 cites W1944559560 @default.
• W2092752023 cites W1965188809 @default.
• W2092752023 cites W1975979472 @default.
• W2092752023 cites W1982938190 @default.
• W2092752023 cites W1983792468 @default.
• W2092752023 cites W1989494896 @default.
• W2092752023 cites W1997030574 @default.
• W2092752023 cites W2004111769 @default.
• W2092752023 cites W2006442989 @default.
• W2092752023 cites W2012246710 @default.
• W2092752023 cites W2019505925 @default.
• W2092752023 cites W2021199664 @default.
• W2092752023 cites W2027071672 @default.
• W2092752023 cites W2027226283 @default.
• W2092752023 cites W2028652800 @default.
• W2092752023 cites W2032842750 @default.
• W2092752023 cites W2054332703 @default.
• W2092752023 cites W2058149157 @default.
• W2092752023 cites W2058329613 @default.
• W2092752023 cites W2064428064 @default.
• W2092752023 cites W2065319956 @default.
• W2092752023 cites W2066874852 @default.
• W2092752023 cites W2070138294 @default.
• W2092752023 cites W2077528345 @default.
• W2092752023 cites W2077569439 @default.
• W2092752023 cites W2084358978 @default.
• W2092752023 cites W2085850146 @default.
• W2092752023 cites W2092710223 @default.
• W2092752023 cites W2094969541 @default.
• W2092752023 cites W2101190658 @default.
• W2092752023 cites W2103093186 @default.
• W2092752023 cites W2104234386 @default.
• W2092752023 cites W2116177557 @default.
• W2092752023 cites W2116411255 @default.
• W2092752023 cites W2129055394 @default.
• W2092752023 cites W2130235018 @default.
• W2092752023 cites W2130731045 @default.
• W2092752023 cites W2130803582 @default.
• W2092752023 cites W2134786188 @default.
• W2092752023 cites W2154365800 @default.
• W2092752023 cites W2156346381 @default.
• W2092752023 cites W2161076328 @default.
• W2092752023 cites W2162473874 @default.
• W2092752023 cites W2163585457 @default.
• W2092752023 cites W2171783790 @default.
• W2092752023 cites W2178317988 @default.
• W2092752023 cites W2187782459 @default.
• W2092752023 cites W2417545467 @default.
• W2092752023 doi "https://doi.org/10.1074/jbc.m406201200" @default.
• W2092752023 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/15262999" @default.
• W2092752023 hasPublicationYear "2004" @default.
• W2092752023 type Work @default.
• W2092752023 sameAs 2092752023 @default.
• W2092752023 citedByCount "35" @default.
• W2092752023 countsByYear W20927520232012 @default.
• W2092752023 countsByYear W20927520232013 @default.
• W2092752023 countsByYear W20927520232015 @default.
• W2092752023 countsByYear W20927520232016 @default.
• W2092752023 countsByYear W20927520232018 @default.
• W2092752023 countsByYear W20927520232020 @default.
• W2092752023 countsByYear W20927520232021 @default.
• W2092752023 countsByYear W20927520232022 @default.
• W2092752023 countsByYear W20927520232023 @default.
• W2092752023 crossrefType "journal-article" @default.
• W2092752023 hasAuthorship W2092752023A5006672847 @default.
• W2092752023 hasAuthorship W2092752023A5027714194 @default.
• W2092752023 hasAuthorship W2092752023A5078948939 @default.
• W2092752023 hasAuthorship W2092752023A5086002793 @default.
• W2092752023 hasBestOaLocation W20927520231 @default.
• W2092752023 hasConcept C134018914 @default.
• W2092752023 hasConcept C142724271 @default.
• W2092752023 hasConcept C178790620 @default.
• W2092752023 hasConcept C185592680 @default.
• W2092752023 hasConcept C201571599 @default.
• W2092752023 hasConcept C2780395140 @default.
• W2092752023 hasConcept C519063684 @default.
• W2092752023 hasConcept C55493867 @default.
• W2092752023 hasConcept C62478195 @default.
• W2092752023 hasConcept C71924100 @default.
• W2092752023 hasConcept C86803240 @default.
• W2092752023 hasConcept C95444343 @default.
• W2092752023 hasConceptScore W2092752023C134018914 @default.
• W2092752023 hasConceptScore W2092752023C142724271 @default.
• W2092752023 hasConceptScore W2092752023C178790620 @default.

• next