FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2093185747> ?p ?o ?g. }

• W2093185747 endingPage "15158" @default.
• W2093185747 startingPage "15149" @default.
• W2093185747 abstract "Mitogen-activated protein kinases (MAPKs) regulate gene expression through transcription factors. However, the precise mechanisms in this critical signal event are largely unknown. Here, we show that the transcription factor c-Jun is activated by p38γ MAPK, and the activated c-Jun then recruits p38γ as a cofactor into the matrix metalloproteinase 9 (MMP9) promoter to induce its trans-activation and cell invasion. This signaling event was initiated by hyperexpressed p38γ that led to increased c-Jun synthesis, MMP9 transcription, and MMP9-dependent invasion through p38γ interacting with c-Jun. p38γ requires phosphorylation and its C terminus to bind c-Jun, whereas both c-Jun and p38γ are required for the trans-activation of MMP9. The active p38γ/c-Jun/MMP9 pathway also exists in human colon cancer, and there is a coupling of increased p38γ and MMP9 expression in the primary tissues. These results reveal a new paradigm in which a MAPK acts both as an activator and a cofactor of a transcription factor to regulate gene expression leading to an invasive response. Mitogen-activated protein kinases (MAPKs) regulate gene expression through transcription factors. However, the precise mechanisms in this critical signal event are largely unknown. Here, we show that the transcription factor c-Jun is activated by p38γ MAPK, and the activated c-Jun then recruits p38γ as a cofactor into the matrix metalloproteinase 9 (MMP9) promoter to induce its trans-activation and cell invasion. This signaling event was initiated by hyperexpressed p38γ that led to increased c-Jun synthesis, MMP9 transcription, and MMP9-dependent invasion through p38γ interacting with c-Jun. p38γ requires phosphorylation and its C terminus to bind c-Jun, whereas both c-Jun and p38γ are required for the trans-activation of MMP9. The active p38γ/c-Jun/MMP9 pathway also exists in human colon cancer, and there is a coupling of increased p38γ and MMP9 expression in the primary tissues. These results reveal a new paradigm in which a MAPK acts both as an activator and a cofactor of a transcription factor to regulate gene expression leading to an invasive response. MAPKs 3The abbreviations used are: MAPKmitogen-activated protein kinaseERKextracellular signal-regulated kinaseJNKc-Jun N-terminal kinasePDZPSD-95/Dlg/ZO-1 homologyMMP9matrix metalloproteinase 9MEFmouse embryonic fibroblastLucluciferaseWTwild typeTet-ontetracycline-inducibleChIPchromatin immunoprecipitationqRTquantitative reverse transcriptionshsmall hairpinWBWestern blotSBSB203580. (including extracellular signal-regulated kinases (ERKs), c-Jun N-terminal kinases (JNKs), and p38s) are critical signaling cascades that convert upstream signals into biological responses such as cell proliferation, invasion, and transformation (1Chang L. Karin M. Nature. 2001; 410: 37-40Crossref PubMed Scopus (4420) Google Scholar). MAPKs are believed to do so by phosphorylating and activating a group of transcription factors, which through binding regulatory DNA elements lead to altered gene transcription. c-Jun is a major component of the AP-1 transcription factor downstream of MAPKs, whereas AP-1 is composed of homodimers of the Jun family or its heterodimers with another transcription factor such as c-Fos to bind the consensus DNA elements TGAg/cTCA (2Shaulian E. Karin M. Nat. Cell Biol. 2002; 5: E131-E136Crossref Scopus (2251) Google Scholar). c-Jun is activated by JNK through phosphorylation at Ser-63, Ser-73, Thr-91, and Thr-93, and by ERK and p38 via increased gene expression. Activated c-Jun/AP-1 leads to a cell type-specific biological response through integrated gene expression (1Chang L. Karin M. Nature. 2001; 410: 37-40Crossref PubMed Scopus (4420) Google Scholar). However, the exact mechanism by which c-Jun converts a MAPK activity into a target gene expression remains mostly unknown. mitogen-activated protein kinase extracellular signal-regulated kinase c-Jun N-terminal kinase PSD-95/Dlg/ZO-1 homology matrix metalloproteinase 9 mouse embryonic fibroblast luciferase wild type tetracycline-inducible chromatin immunoprecipitation quantitative reverse transcription small hairpin Western blot SB203580. p38 MAPKs consist of four family members (α, β, γ, and δ) in which p38α is ubiquitously present, whereas p38γ is highly expressed in certain cancers (3Loesch M. Chen G. Front. Biosci. 2008; 13: 3581-3593Crossref PubMed Scopus (84) Google Scholar). In addition to well established regulatory effects in cytokine signaling and stress response, substantial evidence suggests that the p38α pathway functions as a tumor suppressor (4Chen G. Hitomi M. Han J. Stacey D.W. J. Biol. Chem. 2000; 275: 38973-38980Abstract Full Text Full Text PDF PubMed Scopus (153) Google Scholar, 5Brancho D. Tanaka N. Jaeschke A. Ventura J.J. Kelkar N. Tanaka Y. Kyuuma M. Takeshita T. Flavell R. Davis R.J. Genes Dev. 2003; 17: 1969-1978Crossref PubMed Scopus (406) Google Scholar, 6Qi X. Tang J. Pramanik R. Schultz R.M. Shirasawa S. Sasazuki T. Han J. Chen G. J. Biol. Chem. 2004; 279: 22138-22144Abstract Full Text Full Text PDF PubMed Scopus (56) Google Scholar, 7Dolado I. Swat A. Ajenjo N. De Vita G. Cuadrado A. Nebreda A.R. Cancer Cell. 2007; 11: 191-205Abstract Full Text Full Text PDF PubMed Scopus (326) Google Scholar, 8Sun P. Yoshizuka N. New L. Moser B.A. Li Y. Liao R. Xie C. Chen J. Deng Q. Yamout M. Dong M.-Q. Frangou C.G. Yates III, J.R. Wright P.E. Han J. Cell. 2007; 128: 295-308Abstract Full Text Full Text PDF PubMed Scopus (262) Google Scholar). p38γ, on the other hand, is a 43-kDa protein with an unique C-terminal motif, KETXL, that can dock with the PDZ (PSD-95/Dlg/ZO-1 homology) domain of other proteins (9Hasegawa M. Cuenda A. Spillantini M.G. Thomas G.M. Buée-Scherrer V. Cohen P. Goedert M. J. Biol. Chem. 1999; 274: 12626-12631Abstract Full Text Full Text PDF PubMed Scopus (145) Google Scholar, 10Sabio G. Arthur J.S. Kuma Y. Peggie M. Carr J. Murray-Tait V. Centeno F. Goedert M. Morrice N. Cuenda A. EMBO J. 2005; 24: 1134-1145Crossref PubMed Scopus (195) Google Scholar). In contrast to p38α, our recent studies showed that p38γ is induced by Ras and required for Ras transformation and invasion (11Tang J. Qi X. Mercola D. Han J. Chen G. J. Biol. Chem. 2005; 280: 23910-23917Abstract Full Text Full Text PDF PubMed Scopus (52) Google Scholar, 12Qi X. Tang J. Loesch M. Pohl N. Alkan S. Chen G. Cancer Res. 2006; 66: 7540-7547Crossref PubMed Scopus (37) Google Scholar), indicating its oncogenic activity. The underlying mechanisms for p38γ involvement in Ras tumorigenesis, however, have not been established. In this report, we show that p38γ acts both as an activator and a cofactor for c-Jun in trans-activating MMP9, a critical matrix metalloproteinase involved in cancer invasion and metastasis (13Ozanne B.W. Spence H.J. McGarry L.C. Hennigan R.F. Oncogene. 2007; 26: 1-10Crossref PubMed Scopus (206) Google Scholar, 14Lubbe W. Zhou Z.Y. Fu W. Zuzga D. Schulz S. Fridman R. Muschel R. Waldman S.A. Pitari G.M. Clin. Cancer Res. 2006; 12: 1876-1882Crossref PubMed Scopus (63) Google Scholar). These results reveal a novel paradigm by which p38γ increases c-Jun synthesis and activated c-Jun then recruits p38γ as a cofactor onto a target gene promoter through AP-1 recognition leading to an increased gene expression and invasion. Cell culture materials were supplied by Invitrogen and chemicals by Sigma. p38 isoform-specific antibodies were purchased from RD Systems. Glyceraldehyde-3-phosphate dehydrogenase, c-Jun, MMP9, and MMP2 antibodies were from Santa Cruz Biotechnology. Phosphorylated p38 (p-p38) and p-c-Jun (Ser-63/73) antibodies were from Cell Signaling. Mouse monoclonal antibodies against FLAG (M2) were from Sigma. IEC-6 cells as well as the procedure for establishing the Ras-transformed subline (IEC-6/K-Ras) were described previously (11Tang J. Qi X. Mercola D. Han J. Chen G. J. Biol. Chem. 2005; 280: 23910-23917Abstract Full Text Full Text PDF PubMed Scopus (52) Google Scholar). Human colon cancer cell lines were purchased from the American Type Culture Collection. p38γ+/+ and p38γ−/− mouse embryonic fibroblasts (MEFs) have been described previously (10Sabio G. Arthur J.S. Kuma Y. Peggie M. Carr J. Murray-Tait V. Centeno F. Goedert M. Morrice N. Cuenda A. EMBO J. 2005; 24: 1134-1145Crossref PubMed Scopus (195) Google Scholar), and early passages of these cells were immortalized by infection with retroviruses expressing H-Ras and E1A. c-Jun+/+ and c-Jun−/− cells were provided by R. Wisdom (15Johnson R. Spiegelman B. Hanahan D. Wisdom R. Mol. Cell. Biol. 1996; 16: 4504-4511Crossref PubMed Scopus (251) Google Scholar) and have been used previously in our laboratory (16Li Q.-P. Qi X. Pramanik R. Pohl N.M. Loesch M. Chen G. J. Biol. Chem. 2007; 282: 1544-1551Abstract Full Text Full Text PDF PubMed Scopus (25) Google Scholar). All cell cultures were maintained in minimum Eagle's medium or Dulbecco's modified Eagle's medium containing 10% serum and antibiotics at 37 °C, 5% CO2. An AP-1 luciferase reporter (AP-1 Luc, 3 AP-1 repeats fused to a lucifease reporter gene containing a minimal Fos promoter) was described previously (4Chen G. Hitomi M. Han J. Stacey D.W. J. Biol. Chem. 2000; 275: 38973-38980Abstract Full Text Full Text PDF PubMed Scopus (153) Google Scholar, 17Galang C.K. Der C.J. Hauser C.A. Oncogene. 1994; 9: 2913-2921PubMed Google Scholar), whereas the wild-type (WT) and mutant human MMP-9 promoter (MMP9-Luc) were reported before (18Behren A. Simon C. Schwab R.M. Loetzsch E. Brodbeck S. Huber E. Stubenrauch F. Zenner H.P. Iftner T. Cancer Res. 2005; 65: 11613-11621Crossref PubMed Scopus (39) Google Scholar). The Tet-on inducible expression system (T-Rex) was purchased from Invitrogen. A full-length human p38γ, its AGF mutant (p38γ/AGF), and the c-Jun luciferase promoter (c-Jun Luc, containing −225 to +150 of the promoter) were provided by J. Han (19Han J. Jiang Y. Li Z. Kravchenko V.V. Ulevitch R.J. Nature. 1997; 386: 296-299Crossref PubMed Scopus (688) Google Scholar, 20Li Z. Jiang Y. Ulevitch R.J. Han J. Biochem. Biophys. Res. Commun. 1996; 228: 334-340Crossref PubMed Scopus (353) Google Scholar) and used previously in our laboratory (21Pramanik R. Qi X. Borowicz S. Choubey D. Schultz R.M. Han J. Chen G. J. Biol. Chem. 2003; 278: 4831-4839Abstract Full Text Full Text PDF PubMed Scopus (125) Google Scholar). To generate a Tet-on system, a full-length human p38γ or p38γ/AGF cDNA was cloned into pcDNA4 vector, which was then cotransfected with pcDNA6/TR into IEC-6 cells and selected/maintained as we described previously (12Qi X. Tang J. Loesch M. Pohl N. Alkan S. Chen G. Cancer Res. 2006; 66: 7540-7547Crossref PubMed Scopus (37) Google Scholar). Expression of p38γ or p38γ/AGF was induced by addition of 1 μg/ml of tetracycline that alone has been shown to have no effects on cell invasion or endogenous p38γ protein expression (data not shown). The C-terminal truncated p38γ mutants (p38γΔ4 and p38γΔ13) were generated by PCR and cloned into FLAG-tagged pcDNA3 vector as described (22Hou S.W. Zhi H. Pohl N. Loesch M. Qi X. Li R. Basir Z. Chen G. Cancer Res. 2010; 70: 2901-2910Crossref PubMed Scopus (60) Google Scholar). Invasion assays were carried out using the BioCoat Matrigel Invasion Chamber (BD Biosciences, Bedford, MA) by using 20% fetal bovine serum as a chemoattractant according to the manufacturer's instruction, as we described previously (12Qi X. Tang J. Loesch M. Pohl N. Alkan S. Chen G. Cancer Res. 2006; 66: 7540-7547Crossref PubMed Scopus (37) Google Scholar). Invaded cells on the low surface of membrane were then fixed, stained, and counted. On the other hand, wound assays were used to assess the ability of the cell to migrate into a scratched area in serum-free medium. Immunohistochemistry analyses were conducted in accordance with Institutional Review Board approval from the Medical College of Wisconsin and were performed as described previously (22Hou S.W. Zhi H. Pohl N. Loesch M. Qi X. Li R. Basir Z. Chen G. Cancer Res. 2010; 70: 2901-2910Crossref PubMed Scopus (60) Google Scholar, 23Zhi H. Yang X.J. Kuhnmuench J. Berg T. Thill R. Yang H. See W.A. Becker C.G. Williams C.L. Li R. J. Pathol. 2009; 217: 389-397Crossref PubMed Scopus (22) Google Scholar). A rabbit anti-p38γ (1:1200; R&D catalog no. AF1644) and a goat anti-MMP9 (1:150; Santa Cruz Biotechnology) were used as primary antibodies. Staining results were scored by two observers (22Hou S.W. Zhi H. Pohl N. Loesch M. Qi X. Li R. Basir Z. Chen G. Cancer Res. 2010; 70: 2901-2910Crossref PubMed Scopus (60) Google Scholar), and a consensus score was assigned to each case, which were then analyzed for the relationship between p38γ and MMP9 by a double-blind procedure. The ChIP assay was performed essentially as described previously (16Li Q.-P. Qi X. Pramanik R. Pohl N.M. Loesch M. Chen G. J. Biol. Chem. 2007; 282: 1544-1551Abstract Full Text Full Text PDF PubMed Scopus (25) Google Scholar). Briefly, cells were fixed in 1% formaldehyde solution to cross-link DNA with associated proteins, which were then sonicated and incubated with a specific antibody or IgG. For ChIP-re-ChIP assays, the first precipitates were washed and incubated with second antibody as described (24Shang Y. Hu X. DiRenzo J. Lazar M.A. Brown M. Cell. 2000; 103: 843-852Abstract Full Text Full Text PDF PubMed Scopus (1457) Google Scholar). Precipitated DNA was then extracted and used as a template for PCR. DNA was phenol-chloroform-extracted, ethanol-precipitated, and used as a template for PCR with primers that cover the AP-1 site of the rat MMP-9 promoter within nucleotides −547 to −327 (5′-ATCCTGCTTCAAAGAGCCTG-3′ (sense) and 5′-GTCTGAAGGCCCTGAGTGGT-3′ (antisense). Total chromatin also was prepared in parallel and subjected to PCR as an input control. Total RNA was prepared using a TRIzol extraction kit, and the qRT-PCR was performed using the Express One-Step Syber GreenER qPCR kit (Invitrogen). Samples were analyzed by ΔΔCt method for fold changes in expression and the ratio of MMP9 or c-Jun over β-actin (rat and human cells) or 18 S (mouse cells) was used for comparison. All experiments were repeated at least three times. Some of qRT-PCR products were also visualized on agarose gels. All primers were obtained from Integrated DNA Technologies, and their sequences are as follows: rat β-actin, 5′-ATCTGCCACCACACCTTCTACAATG-3′ (sense) and 5′-CTTCATGAGGTAGTCAGTCAGGTC-3′ (antisense); rat MMP2, 5′-CATCGCTGCACCATCGCCCATCATC-3′ (sense) and 5′-CCCAGGGTCCACAGCTCATCATCATCAAAG-3′ (antisense); rat MMP9, 5′-GAAGACTTGCCGCGAGACCTGATCGATG-3′ (sense) and 5′-GCACCAGCGATAACCATCCGAGCGAC-3′ (antisense); human β-actin, 5′-GATATCGCCGCGCTCGTCGTCGAC-3′ (sense) and 5′-CAGGAAGGAAGGCTGGAAGAGTGC-3′ (antisense); human MMP9, 5′-TGGGCTACGTGACCTATGACAT-3′ (sense) and 5′-GCCCAGCCCACCTCCACTCCTC-3′ (antisense); rat c-Jun, 5′-GACCTTCTACGACGATGC-3′ (sense) and 5′-CAGCGCCAGCTACTGAGGC-3′ (antisense); mouse 18 S RNA, 5′-AGGAATTCCCAGTAAGTGCG-3′ (sense) and 5′-GCCTCACTAAACCATCCAA-3′ (antisense); mouse c-Jun, 5′-AGAGCGGTGCCTACGGCTACAGTAA-3′ (sense) and 5′-CGACGTGAGAAGGTCCGAGTTCTTG-3′ (antisense); mouse MMP9, 5′-CCAAGGGTACAGCCTGTTCCT-3′ (sense) and 5′-GCACGCTGGAATGATCTAAGC-3′ (antisense). To determine the level of MMP9 activity, Tet-on p38γ IEC-6 cells were plated in 100-mm dishes at a density to allow them to reach about 80% confluence within 24 h with and without Tet addition. Thereafter, the medium was replaced with 4 ml of fresh serum-free medium. To determine the effects on MMP9 activity by its inhibitors, Tet cells were treated with 10 nm ilomastat (Chemicon International) or 1 μm SB-3CT (Calbiochem) or a solvent control. After additional 24 h, the media were collected and concentrated by centrifugation using the Amicon Ultra-4 Ultracel-50k filters (Millipore). Concentrated samples were measured for the protein concentration by BCA protein assay reagents (Bio-Rad). Gelatin zymography was used to assess MMP9 activity (25Hu L. Roth J.M. Brooks P. Luty J. Karpatkin S. Cancer Res. 2008; 68: 4666-4673Crossref PubMed Scopus (86) Google Scholar). Briefly, 20 μg of protein from each sample was mixed with SDS sample buffer in the absence of reducing reagents, which were separated on 10% SDS-polyacrylamide gels containing 0.1% gelatin. The gels were incubated with 2.5% Triton X-100 buffer for 1 h and then incubated in digestion buffer (50 mm Tris, pH 7.5, 200 mm NaCl, 1 μm ZnCl2, and 5 mm CaCl2 overnight at 37 °C). Following staining with 5% Coomassie Brilliant Blue R-250, the gelatinolytic activities were detected as clear bands against a blue background. Endogenous p38γ was depleted by lentiviral-mediated shRNA delivery (with two separate target sequences by including a sequence from luciferase gene as a control) as described previously (22Hou S.W. Zhi H. Pohl N. Loesch M. Qi X. Li R. Basir Z. Chen G. Cancer Res. 2010; 70: 2901-2910Crossref PubMed Scopus (60) Google Scholar). The target sequences for individual genes are as follows: luciferase (shLuc), GTGCGTTGCTAGTACCAAC; #1shp38γ, CTCATGAAACATGAGAAGCTA; #2#1shp38γ, GAAGGAGATCATGAAGGTGAC. To produce virus, lentiviral constructs were transfected into packaging cells, and supernatants were collected and filtered 48 h later. To deplete p38γ protein expression, human colon cancer cells were double-infected with the viruses at a 2-h interval, which were processed for invasion assays and qRT-PCR/Western blot (WB) analyses 48 and 72 h later, respectively. For reporter and promoter assays, AP-1 Luc, c-Jun-Luc, or MMP9-Luc was transiently coexpressed with various constructs, and lysates were prepared for the luciferase activity assays 48 h later using a dual luciferase kit from Promega (12Qi X. Tang J. Loesch M. Pohl N. Alkan S. Chen G. Cancer Res. 2006; 66: 7540-7547Crossref PubMed Scopus (37) Google Scholar). The procedures for immunoprecipitation and WB have been described previously (11Tang J. Qi X. Mercola D. Han J. Chen G. J. Biol. Chem. 2005; 280: 23910-23917Abstract Full Text Full Text PDF PubMed Scopus (52) Google Scholar). Results of multiple variables were analyzed by two-way analysis of variance followed by the Bonferroni post-test. Two variables were analyzed by Student's t test. The immunohistochemistry results were analyzed by a χ2 test, and the linear regression analysis was used for assessing the relationship between the normalized p38γ content with the c-Jun or MMP9. A statistically significant difference is reached when a p value is less than 0.05. To investigate signaling mechanisms for p38γ oncogenic activity, we focused on how forced p38γ expression leads to an increased invasion. Because normal cells express little p38γ (11Tang J. Qi X. Mercola D. Han J. Chen G. J. Biol. Chem. 2005; 280: 23910-23917Abstract Full Text Full Text PDF PubMed Scopus (52) Google Scholar), a tetracycline-inducible (Tet-on) system was used to express WT p38γ and its nonphosphorable mutant p38γ/AGF (by changing the dual phosphorylation motif TGY to AGF) in rat intestinal epithelial IEC-6 cells. Following an overnight incubation with and without Tet, cells were seeded in Matrigel-coated invasion chambers and analyzed for invasion (12Qi X. Tang J. Loesch M. Pohl N. Alkan S. Chen G. Cancer Res. 2006; 66: 7540-7547Crossref PubMed Scopus (37) Google Scholar). Results in Fig. 1, A and B, show that Tet-induced p38γ stimulates invasion whereas its AGF mutant is without effect, which couples with its activity to increase c-Jun but not c-Fos protein expression. The invasion-stimulatory activity of p38γ is further confirmed by an increased migration in wound assays (Fig. 1C). These results indicate that p38γ stimulates cell invasion and/or migration by phosphorylation-dependent mechanisms. Recent studies indicate that the C-terminal PDZ motif is required for the invasive activity of c-Src (26Baumgartner M. Radziwill G. Lorger M. Weiss A. Moelling K. Mol. Cell. Biol. 2008; 28: 642-655Crossref PubMed Scopus (18) Google Scholar) and TAZ (tafazzin) proteins (27Chan S.W. Lim C.J. Guo K. Ng C.P. Lee I. Hunziker W. Zeng Q. Hong W. Cancer Res. 2008; 68: 2592-2598Crossref PubMed Scopus (381) Google Scholar), and we then explored whether the C-terminal PDZ sequence of p38γ plays a similar role. To remove the PDZ motif (-ETPL), FLAG-tagged C-terminal truncated p38γΔ4 and p38γΔ13 that lack the last four and 13 amino acids, respectively, were generated by PCR and stably expressed in IEC-6 cells by including FLAG-p38γ and FLAG-p38γ/AGF for comparison. To explore their potential roles in Ras tumorigenesis, resistant clones were pooled and infected with retrovirus expressing K-Ras and their invasive activity then compared. Consistent with the results in Tet-on cells, stable expression of p38γ significantly increases invasion over the vector control, whereas its AGF mutant has much less effect (Fig. 1, D and E). Interestingly, the invasive activity also was decreased in cells expressing both p38γΔ4 and p38γΔ13 (Fig. 1, D and E). These results together indicate that p38γ requires both phosphorylation and its C terminus to stimulate invasion. MMPs consist of at least 23 family members and have long been associated with cancer invasion and metastases because of their role in breaking down the extracellular matrix (28Egeblad M. Werb Z. Nat. Cell Biol. 2002; 2: 161-174Google Scholar). Among these family proteins, MMP9 is one of the best characterized AP-1 target genes involved in cancer invasion (13Ozanne B.W. Spence H.J. McGarry L.C. Hennigan R.F. Oncogene. 2007; 26: 1-10Crossref PubMed Scopus (206) Google Scholar). Because p38 MAPKs were previously shown to regulate the AP-1 target gene expression (29Qi X. Pramanik R. Wang J. Schultz R.M. Maitra R.K. Han J. DeLuca H.F. Chen G. J. Biol. Chem. 2002; 277: 25884-25892Abstract Full Text Full Text PDF PubMed Scopus (93) Google Scholar, 30Marinissen M.J. Chiariello M. Pallante M. Gutkind J.S. Mol. Cell. Biol. 1999; 19: 4289-4301Crossref PubMed Scopus (191) Google Scholar), an AP-1 reporter (4Chen G. Hitomi M. Han J. Stacey D.W. J. Biol. Chem. 2000; 275: 38973-38980Abstract Full Text Full Text PDF PubMed Scopus (153) Google Scholar) and a 670-bp human MMP9 promoter (18Behren A. Simon C. Schwab R.M. Loetzsch E. Brodbeck S. Huber E. Stubenrauch F. Zenner H.P. Iftner T. Cancer Res. 2005; 65: 11613-11621Crossref PubMed Scopus (39) Google Scholar) were transiently expressed in IEC-6 cells to assess whether p38γ increases their luciferase activity compared with p38α. Results in Fig. 2, A and B, show that both p38γ and p38α increase AP-1, but only p38γ stimulates the MMP9 promoter activity. These results are different from those previously published (31Simon C. Simon M. Vucelic G. Hicks M.J. Plinkert P.K. Koitschev A. Zenner H.P. Exp. Cell Res. 2001; 271: 344-355Crossref PubMed Scopus (105) Google Scholar), most likely as a result of the different cell line used. To determine whether p38γ stimulates MMP9 via AP-1, Tet-on cells were expressed with a WT or AP-1 or NF-κB site-mutated MMP9 promoter construct (18Behren A. Simon C. Schwab R.M. Loetzsch E. Brodbeck S. Huber E. Stubenrauch F. Zenner H.P. Iftner T. Cancer Res. 2005; 65: 11613-11621Crossref PubMed Scopus (39) Google Scholar), and luciferase activity was determined. Fig. 2C results show that Tet-p38γ has a similar MMP9 stimulatory activity toward the WT and NF-κB mutated promoter, which, however, was abolished by the mutations on two AP-1 sites, indicating a required role of the AP-1 in p38γ trans-activating MMP9. To demonstrate the MMP9 stimulatory effects further, RNA was prepared and analyzed by real-time qRT-PCR for MMP9 mRNA expression compared with MMP2. Results in Fig. 2D demonstrate that p38γ significantly increases MMP9 but not MMP2 expression; this is likely as a result of the lack of AP-1 site in the MMP2 promoter. Importantly, analyses of medium collected from cultured Tet-on p38γ cells revealed that there is an increased secreted MMP9 protein expression by WB and an elevated MMP9 gelatin activity by zymography (Fig. 2E), indicating the transcribed protein being functionally active. Consistent with these results, analysis of IEC-6/K-Ras cells stably transfected with p38γs also show that p38γ increases MMP9 RNA expression whereas all of its mutants have much less effects (Fig. 2F), which more or less correlates with their regulatory effects on AP-1 and/ or MMP9 transcriptional activity (supplemental Fig. S1, A and B, respectively). These results together indicate that p38γ requires both phosphorylation and the C terminus to stimulate AP-1-dependent MMP9 transcription. Both human (18Behren A. Simon C. Schwab R.M. Loetzsch E. Brodbeck S. Huber E. Stubenrauch F. Zenner H.P. Iftner T. Cancer Res. 2005; 65: 11613-11621Crossref PubMed Scopus (39) Google Scholar) and rat (32Eberhardt W. Schulze M. Engels C. Klasmeier E. Pfeilschifter J. Mol. Endocrinol. 2002; 16: 1752-1766Crossref PubMed Scopus (113) Google Scholar) MMP9 promoters contain two AP-1 sites, and ChIP assays were next performed to explore whether p38γ binds the endogenous MMP9 promoter around this region using primers that span the functional distal AP-1 site (see Fig. 6C). Following formaldehyde-induced DNA cross-linking with associated proteins, stably transfected p38γ in IEC-6/K-Ras cells was isolated with a FLAG antibody, and the precipitates were subjected to PCR analysis, as described previously (16Li Q.-P. Qi X. Pramanik R. Pohl N.M. Loesch M. Chen G. J. Biol. Chem. 2007; 282: 1544-1551Abstract Full Text Full Text PDF PubMed Scopus (25) Google Scholar). As a control, a set of plates were processed for FLAG immunoprecipitation and WB analyses to explore whether p38γ may be recruited into the MMP9 promoter through interaction with c-Jun and/or c-Fos proteins. Results in Fig. 3A (top) show that among these sublines, only precipitates from WT p38γ-expressed cells contain the MMP9 promoter. Of interest, the immunoprecipitation/WB analyses (Fig. 3A, bottom) revealed that p38γ, but not its mutants, increases c-Jun protein expression that couples with its c-Jun binding activity, whereas c-Fos remains undetectable. Because the MMP9 promoter binding couples with the p38γ activity to increase c-Jun expression and bind c-Jun protein, these results suggest a scenario in which p38γ first activates c-Jun by increasing its expression, and activated c-Jun then recruits p38γ onto the MMP9 promoter via a complex formation.FIGURE 3p38γ is recruited into the MMP9 promoter through interaction with c-Jun. A, p38γ depends on its phosphorylation and C terminus to bind c-Jun protein and MMP9 promoter. Stably transfected p38γs from IEC-6/K-Ras cells were isolated and precipitates subjected to PCR analyses for their activity in binding MMP9 promoter (top) with a set of cells in parallel analyzed by immunoprecipitation (IP)/Western blotting for p38γ interacting with c-Jun proteins (bottom). B and C, p38γ and c-Jun bind the MMP9 promoter through a complex formation. Tet-on p38γ IEC-6 cells were incubated with and without Tet and p38γ/c-Jun proteins isolated by their specific antibodies, and precipitates subjected to PCR (B, top), Western blotting (B, bottom) or a second IP/PCR for ChIP-re-ChIP (C). D, p38γ does not induce c-Jun/ATF2 phosphorylation or vitamin D receptor (VDR) expression in IEC-6 cells. Cells were incubated with and without a p38 inhibitor SB203580 (SB) for 24 h and then pulse-treated with a p38 activator arsenite (ARS) for 2 h, and analyzed by Western blotting (see supplemental Fig. S2A for the relationship between c-Jun expression and c-Jun phosphorylation in response to Tet addition). E, endogenous p38γ forms a complex with c-Jun on the MMP9 promoter in K-Ras-transformed IEC-6 cells. Cells were treated with SB or solvent control (Co) as previously described in these cells (33Qi X. Pohl N.M. Loesch M. Hou S. Li R. Qin J.Z. Cuenda A. Chen G. J. Biol. Chem. 2007; 282: 31398-31408Abstract Full Text Full Text PDF PubMed Scopus (49) Google Scholar), and p38γ and c-Jun proteins were isolated and assessed for their MMP9 promoter binding activity by ChIP and their complex formation by Western blotting.View Large Image Figure ViewerDownload Hi-res image Download (PPT) To demonstrate the c-Jun-mediated p38γ-MMP9 promoter binding further, Tet-on IEC-6 cells were next analyzed by ChIP and WB in which endogenous c-Jun was also purified and included as a positive control. Results in Fig. 3B show that in response to Tet addition, both p38γ and c-Jun precipitates contain the MMP9 promoter by ChIP and its partner by WB, and there is an increased c-Jun protein expression, further indicating that p38γ occupies the MMP9 promoter through interacting with c-Jun. Comparative analyses of c-Jun precipitates by ChIP and WB reveal another interesting phenomenon. Although c-Jun precipitates contain more c-Jun proteins in the absence of Tet, c-Jun alone, in the absence of Tet-induced p38γ expression, fails to bind the MMP9 promoter (Fig. 3B, top, lanes 6 and 7 versus bottom, lanes 1 and 2). In response to Tet, however, c-Jun binds both the p38γ protein and the MMP9 promoter, indicating a required role of p38γ in c-Jun binding to the MMP9 promoter. Moreover, the interdependent role of p38γ and c-Jun in the MMP9 promoter binding was further demonstrated by the ChIP-re-ChIP assay, and Tet-p38γ only activates MMP9 without increasing another AP-1 target gene vitamin D receptor expression (29Qi X. Pramanik R. Wang J. Schultz R.M. Maitra R.K. Han J. DeLuca H.F. Chen G. J. Biol. Chem. 2002; 277: 25884-25892Abstract Full Text Full Text PDF PubMed Scopus (93) Google Scholar) and without stimulating c-Jun and ATF-2 phosphorylation (FIGURE 2, FIGURE 3, B–D). Our previous studies have demonstrated an increased p38γ protein expression by a p38α/p38β inhibitor SB203580 (SB) in K-Ras" @default.
• W2093185747 created "2016-06-24" @default.
• W2093185747 creator A5008363264 @default.
• W2093185747 creator A5012648509 @default.
• W2093185747 creator A5013388394 @default.
• W2093185747 creator A5031102468 @default.
• W2093185747 creator A5037080712 @default.
• W2093185747 creator A5053197186 @default.
• W2093185747 creator A5054712690 @default.
• W2093185747 creator A5062259004 @default.
• W2093185747 creator A5076512271 @default.
• W2093185747 date "2010-05-01" @default.
• W2093185747 modified "2023-09-27" @default.
• W2093185747 title "p38γ MAPK Cooperates with c-Jun in trans-Activating Matrix Metalloproteinase 9" @default.
• W2093185747 cites W1895834181 @default.
• W2093185747 cites W1970195594 @default.
• W2093185747 cites W1971615144 @default.
• W2093185747 cites W1973184170 @default.
• W2093185747 cites W1974069439 @default.
• W2093185747 cites W1982024613 @default.
• W2093185747 cites W1984533562 @default.
• W2093185747 cites W1992623092 @default.
• W2093185747 cites W1994219871 @default.
• W2093185747 cites W1996405087 @default.
• W2093185747 cites W1997032085 @default.
• W2093185747 cites W2005467776 @default.
• W2093185747 cites W2006569711 @default.
• W2093185747 cites W2007352125 @default.
• W2093185747 cites W2009633597 @default.
• W2093185747 cites W2016610889 @default.
• W2093185747 cites W2024089966 @default.
• W2093185747 cites W2027263866 @default.
• W2093185747 cites W2034804703 @default.
• W2093185747 cites W2035444091 @default.
• W2093185747 cites W2039576757 @default.
• W2093185747 cites W2044424240 @default.
• W2093185747 cites W2048123277 @default.
• W2093185747 cites W2050690958 @default.
• W2093185747 cites W2054241093 @default.
• W2093185747 cites W2071113403 @default.
• W2093185747 cites W2075604614 @default.
• W2093185747 cites W2078650669 @default.
• W2093185747 cites W2086525709 @default.
• W2093185747 cites W2087430420 @default.
• W2093185747 cites W2088919762 @default.
• W2093185747 cites W2091253374 @default.
• W2093185747 cites W2094872845 @default.
• W2093185747 cites W2101919484 @default.
• W2093185747 cites W2111732181 @default.
• W2093185747 cites W2112849045 @default.
• W2093185747 cites W2122838799 @default.
• W2093185747 cites W2123994513 @default.
• W2093185747 cites W2131026799 @default.
• W2093185747 cites W2131871435 @default.
• W2093185747 cites W2141922619 @default.
• W2093185747 cites W2153154160 @default.
• W2093185747 cites W2161659151 @default.
• W2093185747 cites W2167006963 @default.
• W2093185747 cites W2169110374 @default.
• W2093185747 cites W2170299186 @default.
• W2093185747 cites W2181898446 @default.
• W2093185747 doi "https://doi.org/10.1074/jbc.m110.105429" @default.
• W2093185747 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/2865276" @default.
• W2093185747 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/20231272" @default.
• W2093185747 hasPublicationYear "2010" @default.
• W2093185747 type Work @default.
• W2093185747 sameAs 2093185747 @default.
• W2093185747 citedByCount "78" @default.
• W2093185747 countsByYear W20931857472012 @default.
• W2093185747 countsByYear W20931857472013 @default.
• W2093185747 countsByYear W20931857472014 @default.
• W2093185747 countsByYear W20931857472015 @default.
• W2093185747 countsByYear W20931857472016 @default.
• W2093185747 countsByYear W20931857472017 @default.
• W2093185747 countsByYear W20931857472018 @default.
• W2093185747 countsByYear W20931857472019 @default.
• W2093185747 countsByYear W20931857472020 @default.
• W2093185747 countsByYear W20931857472021 @default.
• W2093185747 countsByYear W20931857472022 @default.
• W2093185747 countsByYear W20931857472023 @default.
• W2093185747 crossrefType "journal-article" @default.
• W2093185747 hasAuthorship W2093185747A5008363264 @default.
• W2093185747 hasAuthorship W2093185747A5012648509 @default.
• W2093185747 hasAuthorship W2093185747A5013388394 @default.
• W2093185747 hasAuthorship W2093185747A5031102468 @default.
• W2093185747 hasAuthorship W2093185747A5037080712 @default.
• W2093185747 hasAuthorship W2093185747A5053197186 @default.
• W2093185747 hasAuthorship W2093185747A5054712690 @default.
• W2093185747 hasAuthorship W2093185747A5062259004 @default.
• W2093185747 hasAuthorship W2093185747A5076512271 @default.
• W2093185747 hasBestOaLocation W20931857471 @default.
• W2093185747 hasConcept C104317684 @default.
• W2093185747 hasConcept C106487976 @default.
• W2093185747 hasConcept C109523444 @default.
• W2093185747 hasConcept C184235292 @default.
• W2093185747 hasConcept C185592680 @default.
• W2093185747 hasConcept C2779087070 @default.
• W2093185747 hasConcept C2991819120 @default.

• next