Matches in SemOpenAlex for { <https://semopenalex.org/work/W2093272451> ?p ?o ?g. }
Showing items 1 to 81 of
81
with 100 items per page.
- W2093272451 endingPage "701" @default.
- W2093272451 startingPage "701" @default.
- W2093272451 abstract "Browne's Blechum (Blechum pyramidatum) is a common weed found in fields and waste grounds in the Philippines. A disease was observed causing begomovirus-like yellow/chlorotic leaf veins and shortened internodes of Browne's Blechum plants on the island of Luzon, Philippines; disease incidence ranged from 10 to 50% in fields in 2012. Samples were collected from two plants with symptoms from each of Laguna and Quezon provinces and one plant without symptoms from Laguna Province. All four samples from plants with symptoms tested positive for begomovirus by PCR using primer pair PAL1v1978B/PAR1c715H (2), but the symptomless plant sample did not. However, no virus DNA-B component was detected in any of the samples using either general detection primer pair DNABLC1/DNABLV2 or DNABLC2/DNABLV2 (1). Using abutting primers AFPH12W1-R2F (TCTGGATCCATTGTTGAACGAGT) and AFPH12W1-R2R (CCGGGATCCCACATTGTTAAACA), a complete DNA-A component sequence was obtained for a Laguna isolate (GenBank Accession No. KF446659) and for a Quezon isolate (KF446660). The Laguna and Quezon isolate sequences were 2,764 and 2,756 nucleotides, respectively, and shared 90.6% nucleotide sequence identity. Both had six open reading frames (ORFs)—two in the virus sense (V1 and V2) and four in the complementary sense (C1 to C4)—and the geminivirus conserved sequence (TAATATTAC). Based on BLASTn searching of GenBank and sequence analysis using MEGALIGN (DNASTAR), both isolates should be considered as a new begomovirus (tentatively named Blechum yellow vein virus, BlYVV) since their DNA-A sequences share less than 89% nucleotide identity with any other begomovirus. Both DNA sequences had the highest nucleotide identity (84.8 to 87.6%) with Papaya leaf curl Guangdong virus isolates (AJ558122, AY650283, FJ495184, FJ869907, and JN703795). To our knowledge, this is the first report of a previously unidentified begomovirus associated with yellow vein disease of this species. References: (1) S. K. Green et al. Plant Dis. 85:1286, 2001. (2) W. S. Tsai et al. Plant Pathol. 60:787, 2011." @default.
- W2093272451 created "2016-06-24" @default.
- W2093272451 creator A5034658876 @default.
- W2093272451 creator A5039514458 @default.
- W2093272451 creator A5053124541 @default.
- W2093272451 creator A5069287832 @default.
- W2093272451 creator A5073035751 @default.
- W2093272451 date "2014-05-01" @default.
- W2093272451 modified "2023-10-18" @default.
- W2093272451 title "First Report of a Novel Begomovirus Associated with Yellow Vein Disease of Browne's Blechum (<i>Blechum pyramidatum</i>)" @default.
- W2093272451 doi "https://doi.org/10.1094/pdis-10-13-1025-pdn" @default.
- W2093272451 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/30708545" @default.
- W2093272451 hasPublicationYear "2014" @default.
- W2093272451 type Work @default.
- W2093272451 sameAs 2093272451 @default.
- W2093272451 citedByCount "3" @default.
- W2093272451 countsByYear W20932724512019 @default.
- W2093272451 countsByYear W20932724512022 @default.
- W2093272451 crossrefType "journal-article" @default.
- W2093272451 hasAuthorship W2093272451A5034658876 @default.
- W2093272451 hasAuthorship W2093272451A5039514458 @default.
- W2093272451 hasAuthorship W2093272451A5053124541 @default.
- W2093272451 hasAuthorship W2093272451A5069287832 @default.
- W2093272451 hasAuthorship W2093272451A5073035751 @default.
- W2093272451 hasBestOaLocation W20932724511 @default.
- W2093272451 hasConcept C104317684 @default.
- W2093272451 hasConcept C109110057 @default.
- W2093272451 hasConcept C15190224 @default.
- W2093272451 hasConcept C159047783 @default.
- W2093272451 hasConcept C167625842 @default.
- W2093272451 hasConcept C178790620 @default.
- W2093272451 hasConcept C185592680 @default.
- W2093272451 hasConcept C2522874641 @default.
- W2093272451 hasConcept C2777563447 @default.
- W2093272451 hasConcept C2779263152 @default.
- W2093272451 hasConcept C2780530800 @default.
- W2093272451 hasConcept C47289529 @default.
- W2093272451 hasConcept C54355233 @default.
- W2093272451 hasConcept C552990157 @default.
- W2093272451 hasConcept C79029880 @default.
- W2093272451 hasConcept C84148353 @default.
- W2093272451 hasConcept C86803240 @default.
- W2093272451 hasConceptScore W2093272451C104317684 @default.
- W2093272451 hasConceptScore W2093272451C109110057 @default.
- W2093272451 hasConceptScore W2093272451C15190224 @default.
- W2093272451 hasConceptScore W2093272451C159047783 @default.
- W2093272451 hasConceptScore W2093272451C167625842 @default.
- W2093272451 hasConceptScore W2093272451C178790620 @default.
- W2093272451 hasConceptScore W2093272451C185592680 @default.
- W2093272451 hasConceptScore W2093272451C2522874641 @default.
- W2093272451 hasConceptScore W2093272451C2777563447 @default.
- W2093272451 hasConceptScore W2093272451C2779263152 @default.
- W2093272451 hasConceptScore W2093272451C2780530800 @default.
- W2093272451 hasConceptScore W2093272451C47289529 @default.
- W2093272451 hasConceptScore W2093272451C54355233 @default.
- W2093272451 hasConceptScore W2093272451C552990157 @default.
- W2093272451 hasConceptScore W2093272451C79029880 @default.
- W2093272451 hasConceptScore W2093272451C84148353 @default.
- W2093272451 hasConceptScore W2093272451C86803240 @default.
- W2093272451 hasIssue "5" @default.
- W2093272451 hasLocation W20932724511 @default.
- W2093272451 hasLocation W20932724512 @default.
- W2093272451 hasOpenAccess W2093272451 @default.
- W2093272451 hasPrimaryLocation W20932724511 @default.
- W2093272451 hasRelatedWork W2007828649 @default.
- W2093272451 hasRelatedWork W2043872272 @default.
- W2093272451 hasRelatedWork W2073636691 @default.
- W2093272451 hasRelatedWork W2093272451 @default.
- W2093272451 hasRelatedWork W2117684347 @default.
- W2093272451 hasRelatedWork W3148665847 @default.
- W2093272451 hasRelatedWork W4232266679 @default.
- W2093272451 hasRelatedWork W4248279890 @default.
- W2093272451 hasRelatedWork W4250512148 @default.
- W2093272451 hasRelatedWork W4299308435 @default.
- W2093272451 hasVolume "98" @default.
- W2093272451 isParatext "false" @default.
- W2093272451 isRetracted "false" @default.
- W2093272451 magId "2093272451" @default.
- W2093272451 workType "article" @default.