FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2093334583> ?p ?o ?g. }

• W2093334583 endingPage "47541" @default.
• W2093334583 startingPage "47530" @default.
• W2093334583 abstract "Signaling specificity of Rho GTPase pathways is achieved in part by selective interaction between members of the Dbl family guanine nucleotide exchange factors (GEFs) and their Rho GTPase substrates. For example, Trio, GEF-H1, and Tiam1 are a subset of GEFs that specifically activate Rac1 but not the closely related Cdc42. The Rac1 specificity of these GEFs appears to be governed by Rac1-GEF binding interaction. To understand the detailed mechanism underlying the GEF specificity issue, we have analyzed a panel of chimeras made between Rac1 and Cdc42 and examined a series of point mutants of Rac1 made at the switch I, switch II, and β2/β3 regions for their ability to interact with and to be activated by the GEFs. The results reveal that Rac1 residues of both the switch I and switch II regions are involved in GEF docking and GEF-mediated nucleotide disruption, because mutation of Asp38, Asn39, Gln61, Tyr64, or Arg66/Leu67 into Ala results in the loss of GEF binding, whereas mutation at Tyr32, Asp65, or Leu70/Ser71 leads to the loss of GEF catalysis while retaining the binding capability. The region between amino acids 53–72 of Rac1 is required for specific recognition and activation by the GEFs, and Trp56 in β3 appears to be the critical determinant. Introduction of Trp56 to Cdc42 renders it fully responsive to the Rac-specific GEF in vitro and in cells. Further, a polypeptide derived from the β3 region of Rac1 including the Trp56 residue serves as a specific inhibitor for Rac1 interaction with the GEFs. Taken together, these results indicate that Trp56 is the necessary and sufficient determinant of Rac1 for discrimination by the subset of Rac1-specific GEFs and suggest that a compound mimicking Trp56 action could be explored as an interfering reagent specifically targeting Rac1 activation. Signaling specificity of Rho GTPase pathways is achieved in part by selective interaction between members of the Dbl family guanine nucleotide exchange factors (GEFs) and their Rho GTPase substrates. For example, Trio, GEF-H1, and Tiam1 are a subset of GEFs that specifically activate Rac1 but not the closely related Cdc42. The Rac1 specificity of these GEFs appears to be governed by Rac1-GEF binding interaction. To understand the detailed mechanism underlying the GEF specificity issue, we have analyzed a panel of chimeras made between Rac1 and Cdc42 and examined a series of point mutants of Rac1 made at the switch I, switch II, and β2/β3 regions for their ability to interact with and to be activated by the GEFs. The results reveal that Rac1 residues of both the switch I and switch II regions are involved in GEF docking and GEF-mediated nucleotide disruption, because mutation of Asp38, Asn39, Gln61, Tyr64, or Arg66/Leu67 into Ala results in the loss of GEF binding, whereas mutation at Tyr32, Asp65, or Leu70/Ser71 leads to the loss of GEF catalysis while retaining the binding capability. The region between amino acids 53–72 of Rac1 is required for specific recognition and activation by the GEFs, and Trp56 in β3 appears to be the critical determinant. Introduction of Trp56 to Cdc42 renders it fully responsive to the Rac-specific GEF in vitro and in cells. Further, a polypeptide derived from the β3 region of Rac1 including the Trp56 residue serves as a specific inhibitor for Rac1 interaction with the GEFs. Taken together, these results indicate that Trp56 is the necessary and sufficient determinant of Rac1 for discrimination by the subset of Rac1-specific GEFs and suggest that a compound mimicking Trp56 action could be explored as an interfering reagent specifically targeting Rac1 activation. guanine nucleotide exchange factor glutathione S-transferase p21 cdc42/rac -activated kinase p21 cdc42/rac -binding domain Dbl homology pleckstrin homology polymerase chain reaction guanosine 5′-3-O-(thio)triphosphate green fluorescent protein 2′(3′)-O-(N-methylanthraniloyl)-GDP Rac1 and Cdc42 are members of the Rho subfamily of the Ras superfamily small GTP-binding proteins (1Van Aelst L. D'Souza-Schorey C. Genes Dev. 1997; 11: 2295-2322Crossref PubMed Scopus (2101) Google Scholar). They are close family members, sharing over 70% sequence identity. Among a broad spectrum of cellular functions, Rac1 is known to be involved in mediating membrane ruffling and lamellipodia formation elicited by growth factors and cytokines (1Van Aelst L. D'Souza-Schorey C. Genes Dev. 1997; 11: 2295-2322Crossref PubMed Scopus (2101) Google Scholar, 2Hall A. Science. 1998; 279: 509-514Crossref PubMed Scopus (5230) Google Scholar). Cdc42, on the other hand, appears to mediate the formation of filopodia and actin microspikes in multiple cell settings. It is well established that they can differentially respond to upstream stimulants and may cause diverse physiological effects in cell migration, adhesion, growth, and apoptosis (1Van Aelst L. D'Souza-Schorey C. Genes Dev. 1997; 11: 2295-2322Crossref PubMed Scopus (2101) Google Scholar, 2Hall A. Science. 1998; 279: 509-514Crossref PubMed Scopus (5230) Google Scholar). As in the case for Ras, the cycling between the active, GTP-bound and the inactive, GDP-bound states of these Rho family proteins is tightly regulated in cells. The guanine nucleotide exchange factors (GEFs)1 accelerate the release of GDP from the small G-proteins, thereby facilitating GTP binding and G-protein activation; the GTPase-activating proteins catalyze the conversion of the GTP-bound form of the G-proteins to the GDP-bound form by increasing their intrinsic rates of GTP hydrolysis, and GDP dissociation inhibitors might serve to stabilize the G-proteins at either state and to target them to specific intracellular locations (1Van Aelst L. D'Souza-Schorey C. Genes Dev. 1997; 11: 2295-2322Crossref PubMed Scopus (2101) Google Scholar, 2Hall A. Science. 1998; 279: 509-514Crossref PubMed Scopus (5230) Google Scholar). Signaling specificity of these Rho GTPases is controlled at multiple levels in the complex signal transduction chains. One of the signaling divergent points that might contribute to the specification of signal flows is at the small G-protein activation step (3Bar-Sagi D. Hall A. Cell. 2000; 103: 227-235Abstract Full Text Full Text PDF PubMed Scopus (706) Google Scholar). A large family of Dbl-like GEFs specific for Rho protein activation has emerged over the past decade (4Cerione R.A. Zheng Y. Curr. Opin. Cell Biol. 1996; 8: 216-222Crossref PubMed Scopus (466) Google Scholar, 5Zheng Y. Trends Biochem. Sci. 2001; 26: 724-732Abstract Full Text Full Text PDF PubMed Scopus (352) Google Scholar). Among the rapidly expanding Dbl family GEFs that share the structural arrangement of two tandemly located motifs of the Dbl homology (DH) and pleckstrin homology (PH) domains, the Dbl oncoprotein is the prototype member that was shown to interact with and catalyze the GDP/GTP exchange of many Rho proteins, including RhoA and Cdc42. The DH/PH domains have been demonstrated to represent the minimum structural module required for GEF activity and biological functions (6Hart M.J. Eva A. Zangrilli D. Aaronson S.A. Evans T. Cerione R.A. Zheng Y. J. Biol. Chem. 1994; 269: 16992-16995Google Scholar). The T-cell invasion and metastasis gene product Tiam1 of the Dbl family was shown to be an active GEF for Rac1 and may influence the invasive capacity of T cells in a Rac1-dependent manner (7Michiels F. Habets G.G.M. Stam J.C. van der Kammen R.A. Collard J.G. Nature. 1995; 375: 338-340Crossref PubMed Scopus (509) Google Scholar). Trio is a large multifunctional domain molecule containing two DH/PH domain modules, with the amino-terminal module (TrioN) displaying the Rac1- and RhoG-specific GEF activity and the carboxyl-terminal module exhibiting RhoA specific GEF activity (8Debant A. Serra-Pages C. Seipel K. O'Brien S. Tang M. Park S.H. Streuli M. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 5466-5471Crossref PubMed Scopus (399) Google Scholar). Recent biological studies in Drosophila and mouse have implicated Trio as a key component of the intracellular signaling pathway that regulates axon guidance and cell migration in the nervous system with the TrioN module playing an important role in the process (9Newsome T.P. Schmidt Dietzl G. Keleman K. Asling B. Debant A. Dickson B.J. Cell. 2000; 101: 283-294Abstract Full Text Full Text PDF PubMed Scopus (252) Google Scholar, 10Liebl E.C. Forsthoefel D.L. Franco L.S. Sample S.H. Hess J.E. Cowger J.A. Chandler M.P. Shupert A.M. Seeger M.A. Neuron. 2000; 26: 107-118Abstract Full Text Full Text PDF PubMed Scopus (162) Google Scholar, 11Awasaki T. Saito M. Sone M. Suzuki E. Sakai R. Ito K. Hama C. Neuron. 2000; 26: 119-131Abstract Full Text Full Text PDF PubMed Scopus (178) Google Scholar, 12O'Brien S.P. Seipel K. Medley Q.G. Bronson R. Segal R. Streuli M. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 12074-12078Crossref PubMed Scopus (141) Google Scholar). Another Dbl family member, GEF-H1, was identified as a microtubule-associated protein that is capable of stimulating the guanine nucleotide exchange of Rac1 but is inactive toward Cdc42 (13Ren Y. Li R. Zheng Y. Busch H. J. Biol. Chem. 1998; 273: 34954-34962Abstract Full Text Full Text PDF PubMed Scopus (248) Google Scholar). Therefore, among the Dbl family members, TrioN, GEF-H1, and Tiam1 constitute a subset of GEFs that share the property of acting as a Rac1-specific GEF without displaying much biochemical effect on the highly related Cdc42 GTPase. The mechanism for such exquisite substrate selectivity by the GEFs is not known. Previous mutagenesis studies of the Rho family GTPase-GEF pairs of RhoA-Lbc and Cdc42-Cdc24 have revealed that multiple sites of the Rho GTPases are involved in the regulation by GEFs, contributing to GEF binding or GEF catalysis (14Li R. Zheng Y. J. Biol. Chem. 1997; 272: 4671-4679Abstract Full Text Full Text PDF PubMed Scopus (60) Google Scholar). Specific recognition of Lbc by RhoA or Cdc24 by Cdc42 is achieved at least in part through the unique residues Lys27 of RhoA and Gln116 of Cdc42, respectively. These results raise the possibility that activation of each Rho family G-protein by a specific GEF may engage in a distinct mechanism. Recently published x-ray crystal structure of Rac1 in complex with the DH/PH domains of Tiam1 (15Worthylake D.K. Rossman K.L. Sondek J. Nature. 2000; 408: 682-688Crossref PubMed Scopus (307) Google Scholar) provides further insights into how Rac1 interacts with a GEF and what structural determinants might be involved in GEF substrate discrimination. The complex structure suggests an “induced fit” model in which Tiam1 first interacts with the conformationally rigid portions of Rac1 (β2/β3 region and residues 65–74 of switch II) to provide sufficient binding energy, followed by an alteration of the conformations in switch I and the remainder of switch II resulting in destabilization of the bound nucleotide. The residues of Rac1 in the β2/β3 region that would lose surface exposure upon complex formation with Tiam1 and are variable from those in the corresponding positions of Cdc42 are proposed as possible determinants that specify Tiam1 interaction in the activation reaction. In the present work, we have attempted to determine the exact determinants of Rac1 that specify the GEF interaction. First, we found that the Rac1 specificity of three GEFs, TrioN, GEF-H1, and Tiam1, is governed by Rac1-GEF binding interaction. Second, by using an extensive collection of point mutants generated at switch regions of Rac1, we have examined the contribution of the switch I and switch II of Rac1 to the GEF interaction and catalysis and concluded that both switches are important for the physical association with the GEFs and the efficient exchange of nucleotides catalyzed by the GEFs. Third, based on the results of the GEF binding and GEF-responsive profiles of a set of Cdc42/Rac1 chimeras and point mutants made in the β2/β3 area of Rac1, we pinpointed Trp56 of Rac1 as the necessary and sufficient determinant for the GEFs to discriminate against Cdc42. By introducing Trp56 into Cdc42, we were able to produce a Cdc42 mutant that is sensitive to Rac-specific GEF stimulation in vitroand in cells. Finally, we were successful in designing a polypeptide derived from the β3 region of Rac1 including Trp56 that serves as a specific inhibitor for Rac1 interaction with the GEFs. Overall, these studies provide a mechanistic basis for substrate discrimination by Rac1-specific GEFs and initiate an effort for exploring interfering reagents specifically targeting Rac1 activation that might constitute a worthy therapeutic target site. Cdc42/Rac1 chimeric cDNAs were produced as previously described (16Kwong C.H. Adams A.G. Leto T.L. J. Biol. Chem. 1995; 270: 19868-19872Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar) or by the polymerase chain reaction (PCR) method using the Pfu polymerase (Stratagene), which generates blunt-ended DNA fragments in PCRs followed by forced insertion of the ligation product of the blunt-ended fragments into the pGEX-KG vector (14Li R. Zheng Y. J. Biol. Chem. 1997; 272: 4671-4679Abstract Full Text Full Text PDF PubMed Scopus (60) Google Scholar). Site-directed mutants described in this work were generated by the PCR-based second extension amplification technique using the Pfu polymerase with internal primers that contained the desired mutations (14Li R. Zheng Y. J. Biol. Chem. 1997; 272: 4671-4679Abstract Full Text Full Text PDF PubMed Scopus (60) Google Scholar). cDNAs of mutant/chimera forms of Rac1 and Cdc42 were subcloned into the BamHI andEcoRI sites of pGEX-KG vector to express as a glutathioneS-transferase (GST) fusion protein in Escherichia coli DH5α strain. The sequences of mutagenized Rac1 and Cdc42 or Cdc42/Rac1 chimeras were confirmed by automated sequencing prior to protein expression. All point mutations used are described by single-letter amino acid denominations. Based on a Blast search in the human expressed sequence tag data base using the published Tiam1 sequences (17Crompton A.M. Foley L.H. Wood A. Roscoe W. Stokoe D. McCormick F. Symons M. Bollag G. J. Biol. Chem. 2000; 275: 25751-25759Abstract Full Text Full Text PDF PubMed Scopus (50) Google Scholar), two clones encoding the human Tiam1 DH/PH sequences were identified; the first one, with GenBankTM accession number AA233606, contains Tiam1 amino acids 1060–1259, while the second one, with accession number AA723139, includes residues 1288–1435. The two cDNA clones were obtained from Incyte Genomics, Inc. and were used as template to piece together an intact Tiam1 DH/PH domain module by the PCR method. To obtain the missing N-terminal sequences of the DH domain of Tiam1, an N-primer with a BglII cleavage site was designed with the sequence 5′-GGGAGATCTAGACAACTCTCGGATGCAGATAAGCTGCGCAAGGTGATCTGCGAGCTCCTGGAGACGGAGCGCACCTACGTGAAGGATTTAAACTGTCTTATGGA-3′, and a C-primer was designed (5′-GCAACCTCTTTTTTCTCA-3′). To fill in the missing sequences between the DH domain and PH domain, an N-primer (5′-AGATCTGAGCATGGGAGACCTGCTTTTGCACACTACCGTGATCTGGCTGAACCCGCCGGCCTCGCTGGGCAAGTGGAAAAAGGAACCAGAGTTGGCAGC-3′) and a C-primer containing an EcoRI digestion site (5′-GGAATTACTCGGTTTTGAGGAGCTG-3′) were used to perform a second round PCR. The two PCR products were digested by BglII andEcoRI, respectively, and were ligated into a modified pET15b vector at the BamHI and EcoRI sites, creating a Tiam1 DH/PH clone (containing residues 1033–1406) with an N-terminal His6 tag. Recombinant TrioN (residues 1225–1537 containing the N-terminal DH/PH module), GEF-H1 (residues 226–643 containing the DH/PH module), Tiam1 (residues 1033–1606, DH/PH module), and PAK1 p21-binding domain (PBD) domain (residues 51–135) were expressed in E. coli BL21(DE3) strain as N-terminal His6-tagged fusion proteins by using the pET expression system (Novagen). Rac1, Cdc42, and Cdc42/Rac1 chimeras and their mutants were expressed in E. coli DH5α strain as GST fusions using the pGEX-KG vector (14Li R. Zheng Y. J. Biol. Chem. 1997; 272: 4671-4679Abstract Full Text Full Text PDF PubMed Scopus (60) Google Scholar). The N-terminal tagged GST or His6 fusion proteins were purified by glutathione- or Ni2+-agarose affinity chromatography (14Li R. Zheng Y. J. Biol. Chem. 1997; 272: 4671-4679Abstract Full Text Full Text PDF PubMed Scopus (60) Google Scholar, 18Zhang B. Zhang Y. Wang Z. Zheng Y. J. Biol. Chem. 2000; 275: 25299-25307Abstract Full Text Full Text PDF PubMed Scopus (137) Google Scholar). GST-GTPases on glutathione beads were eluted off bound guanine nucleotides by washing three times with a buffer containing 50 mmTris-HCl, pH 7.4, 100 mm NaCl, 10 mm EDTA, and 1 mm dithiothreitol. 0.5 mm GTPγS or GDP was added to the G-proteins after a 10-min incubation together with 12 mm MgCl2 to generate the GTPγS- or GDP-bound small G-proteins. The [3H]GDP/GTP exchanges of Rac1, Cdc42, and different Cdc42/Rac1 chimeras were measured at 25 °C by a filter binding assay as described previously (19Zheng Y. Hart M. Cerione R.A. Methods Enzymol. 1995; 256: 77-84Crossref PubMed Scopus (70) Google Scholar). The exchange reactions were carried out in a buffer containing 20 mm Tris-HCl, pH 7.4, 100 mm NaCl, 10 mm MgCl2, and 500 μm GTP in the presence or absence of the indicated amount of purified GEFs. The reactions were terminated at the 5-min time point by nitrocellulose filtration, and the amounts of [3H]GDP remaining bound to the Rho GTPases were normalized as the percentage of [3H]GDP bound at time 0. Fluorescence measurement of mant-GDP/GTP exchange was carried out using an LS 50B Luminescent Spectrometer (PerkinElmer Life Sciences) in an exchange buffer including 200 nm concentrations of respective GTPases and 200 nm GEF as described before (18Zhang B. Zhang Y. Wang Z. Zheng Y. J. Biol. Chem. 2000; 275: 25299-25307Abstract Full Text Full Text PDF PubMed Scopus (137) Google Scholar). The mant-GDP fluorescence changes during the exchange reactions were monitored with an excitation wavelength at 360 nm and the emission wavelength at 440 nm. All measurements were performed at 25 °C in the exchange buffer containing 20 mm Tris-HCl, pH 7.4, 100 mm NaCl, 0.3 mm MgCl2, 0.5 mm GTP, and 0.2 μm mant-GDP-bound G-protein. The exchange assays of each mutant/chimera were carried out at least three times. ∼2 μg of GST-tagged, nucleotide-free small GTPases and 0.5 μg of His6-TrioN, His6-GEF-H1 or 1 μg of His6-Tiam1 were added to 200 μl of incubation buffer (20 mm Tris-HCl, pH 7.4, 100 mm NaCl, 1 mm dithiothreitol, 200 μg/ml bovine serum albumin, 1% Triton X-100, and 1 mm MgCl2) containing 10 μl of glutathione-agarose suspension. After incubation for 1 h at 4 °C under constant agitation, the glutathione beads were washed twice in the incubation buffer, boiled in Laemmli sample buffer, and analyzed by immunoblotting with anti-His monoclonal antibodies similar to that described (6Hart M.J. Eva A. Zangrilli D. Aaronson S.A. Evans T. Cerione R.A. Zheng Y. J. Biol. Chem. 1994; 269: 16992-16995Google Scholar, 13Ren Y. Li R. Zheng Y. Busch H. J. Biol. Chem. 1998; 273: 34954-34962Abstract Full Text Full Text PDF PubMed Scopus (248) Google Scholar). In peptide inhibition assays, different amounts of peptides were preincubated with the respective GEFs in the incubation buffer for 10 min prior to mixing with the GST-GTPase and glutathione-agarose beads. Each set of binding experiments was carried out three times independently. The Myc-tagged full-length PAK1 cloned in pCMV6 vector (20Li R. Debreceni B. Jia B. Gao Y. Tigyi G. Zheng Y. J. Biol. Chem. 1999; 274: 29648-29654Abstract Full Text Full Text PDF PubMed Scopus (54) Google Scholar) was transfected into COS-7 cells by using LipofectAMINE reagent (Life Technologies, Inc.). After 48 h, cells were lysed in a buffer containing 20 mm Tris-HCl, pH 7.4, 100 mm NaCl, 2 mm MgCl2, 1 mm dithiothreitol, 1% Triton X-100, and the protease inhibitor mixtures (10 μg/ml aprotinin, 10 μg/ml leupeptin, and 1 mm phenylmethylsulfonyl fluoride). Lysates were cleared by brief centrifugation and incubated for 1 h at 4 °C with 2 μg of different GST-GTPases that were preloaded with GTPγS and immobilized on glutathione-agarose beads. The GST beads were washed twice in the wash buffer and subjected to analysis by immunoblotting with anti-Myc monoclonal antibodies (Santa Cruz Biotechnology, Inc., Santa Cruz, CA). The polypeptide W56 was added to 250 μmin the incubation buffer where it is indicated. Wild type Rac1, Cdc42, and their mutant cDNAs were subcloned into pCEFL-GST vector at the BamHI andEcoRI sites to be expressed as GST-tagged proteins. TrioN cDNA encoding the DH/PH module was cloned into the pMX-IRES-GFP vector, which expresses the TrioN and the green fluorescent protein (GFP) as a bicistronic mRNA (21Zhu K. Debreceni B. Li R. Zheng Y. J. Biol. Chem. 2000; 275: 25993-26001Abstract Full Text Full Text PDF PubMed Scopus (45) Google Scholar). Retroviral packaging and infection were carried out according to described methods (21Zhu K. Debreceni B. Li R. Zheng Y. J. Biol. Chem. 2000; 275: 25993-26001Abstract Full Text Full Text PDF PubMed Scopus (45) Google Scholar). NIH 3T3 fibroblasts were infected with the retroviruses, and cells were harvested 72 h postinfection. GFP-positive cells were sorted by fluorescence-activated cell sorting and were used for analysis immediately after sorting. For transient expression, the NIH 3T3 GFP/TrioN cells were seeded in 6-cm dishes at a density of 5 × 105 cells in Dulbecco's modified Eagle's medium, supplemented with 10% calf serum. The next day, different pCEFL vectors were transfected into the cells by using LipofectAMINE Plus (Life Technologies) following the manufacturer's instructions. In the following day, transfected cells were harvested and replated onto glass coverslips. 12 h prior to fixation, serum was withdrawn from the medium. To create cell lines stably expressing the GST fusion proteins, 80% confluent NIH 3T3 GFP/TrioN cells in 10-cm dishes were transfected with different pCEFL vectors. 48 h post-transfection, cells were selected on growth medium supplemented with 400 μg/ml G418. ∼3 weeks later, cell clones were pooled, and the expression of the GST fusions was checked by anti-GST immunoblotting of the cell lysates. The cells were serum-starved for another 12 h with serum-free Dulbecco's modified Eagle's medium before the effector PAK1 pull-down assay was carried out. For the His6-PAK1 PBD pull-down assay, cell lysates expressing comparable levels of various GST fusions were incubated with Ni2+-agarose-immobilized His6-PAK1 PBD domain (∼1 μg each) purified fromE. coli for 30 min as described (21Zhu K. Debreceni B. Li R. Zheng Y. J. Biol. Chem. 2000; 275: 25993-26001Abstract Full Text Full Text PDF PubMed Scopus (45) Google Scholar). The Ni2+-agarose co-precipitates were washed twice in the wash buffer and analyzed by immunoblotting with anti-GST monoclonal antibody. Cells grown on coverslips were fixed with 3.7% formaldehyde in phosphate-buffered saline for 15 min, washed, and permeabilized with 0.1% Triton X-100 for 20 min (21Zhu K. Debreceni B. Li R. Zheng Y. J. Biol. Chem. 2000; 275: 25993-26001Abstract Full Text Full Text PDF PubMed Scopus (45) Google Scholar). After washes, the fixed cells were blocked with phosphate-buffered saline containing 2% bovine serum albumin for 1 h. The cells were then incubated with monoclonal anti-GST antibody in phosphate-buffered saline containing 0.1% bovine serum albumin for 90 min, followed by incubation with tetramethylrhodamine isothiocyanate-conjugated anti-mouse IgG antibody. The coverslips with cells were mounted onto slides in Vectamount and viewed under a Zeiss fluorescence microscope. Simulation of the amino acid substitutions in the structural coordinates of the Rac1-Tiam1 complex was made using Insight II software (Molecular Simulations Inc.). After the substitution was introduced, energy minimizations of the resulting structure were carried out by applying the Biopolymer and Discover modules of Insight II, respectively. Unlike the Dbl family GEFs Bcr and Ect2, which are capable of indiscriminately activating the two closely related Rho GTPases Rac1 and Cdc42 (22Chuang T. Xu X. Kaartinen V. Heisterkamp N. Groffen J. Bokoch G.M. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 10282-10286Crossref PubMed Scopus (153) Google Scholar, 23Tatsumoto T. Xie X. Blumenthal R. Okamoto I. Miki T. J. Cell Biol. 1999; 147: 921-927Crossref PubMed Scopus (346) Google Scholar), a subset of Dbl family members, including TrioN, GEF-H1, and Tiam1, appears to be specifically involved in Rac1, but not Cdc42, activation. Fig. 1 A shows that purified TrioN protein acts as a Rac1-specific GEF by stimulating the rate of mant-GDP dissociation from Rac1 while displaying only marginal activity in accelerating the time courses of mant-GDP dissociation from Cdc42 under similar conditions. Similarly, GEF-H1 and Tiam1 also favor Rac1 over Cdc42 as a GEF reaction substrate (Fig. 1, B andC, upper panels). To determine whether the observed Rac1 specificity of the GEFs is reflected in their direct binding interaction, a complex formation assay was performed by using immobilized GST-Rac1 or GST-Cdc42 as a probe to pull down the respective GEFs. As shown in Fig. 1 A (lower panel), TrioN selectively binds to GST-Rac1 without detectable affinity toward GST-Cdc42 or GST, indicating that substrate binding discrimination may be the governing factor in determining the GEF reaction specificity. Similar binding results were obtained in the case of GEF-H1 or Tiam1 interaction with Rac1 and Cdc42 (Figs. 1,B and C, lower panels). Of the three GEFs, GEF-H1 appears to be the most potent activator of nucleotide exchange on Rac1, whereas Tiam1 is the weakest. As described previously (17Crompton A.M. Foley L.H. Wood A. Roscoe W. Stokoe D. McCormick F. Symons M. Bollag G. J. Biol. Chem. 2000; 275: 25751-25759Abstract Full Text Full Text PDF PubMed Scopus (50) Google Scholar), we found that human Tiam1 requires the phosphoinositol lipid phosphatidylinositol (4,5)-bisphosphate for activation of its GEF activity, which differs from that found for the constitutively active murine Tiam1. Overall, TrioN, GEF-H1, and Tiam1 are able to discriminate Rac1 from Cdc42 as a substrate in their respective GEF reactions based on their binding preferences. Structural complexes and mutagenesis data obtained between Ras, ADP-ribosylation factor, and Ran and their respective GEFs have shown that the switch regions of the small GTPases play important roles in the GEF binding interaction and in the subsequent nucleotide dissociation (24Boriack-Sjodin P.A. Margarit S.M. Bar-Sagi D. Kuriyan J. Nature. 1998; 394: 337-343Crossref PubMed Scopus (627) Google Scholar, 25Goldberg J. Cell. 1998; 95: 237-248Abstract Full Text Full Text PDF PubMed Scopus (439) Google Scholar, 26Renault L. Kuhlmann J. Henkel A. Wittinghofer A. Cell. 2001; 105: 245-255Abstract Full Text Full Text PDF PubMed Scopus (199) Google Scholar, 27Hall B.E. Yang S.S. Boriack-Sjodin P.A. Kuriyan J. Bar-Sagi D. J. Biol. Chem. 2001; 276: 27629-27637Abstract Full Text Full Text PDF PubMed Scopus (105) Google Scholar). Switch II, in particular, has been proposed to contribute to the substrate docking, while switch I is thought to be involved in the subsequent step of stimulation of GDP dissociation. This feature is probably conserved in Rho GTPase-GEF interaction, although it may differ in details. Previous structural studies have shown that both switch I and II regions of Rac1 appear to be in broad contact with the GEF domain of Tiam1 (15Worthylake D.K. Rossman K.L. Sondek J. Nature. 2000; 408: 682-688Crossref PubMed Scopus (307) Google Scholar), while the mutagenesis data has shown that many switch II residues of RhoA and Cdc42 do not seem to be required for the functional interaction with their respective GEFs, Lbc and Cdc24 (14Li R. Zheng Y. J. Biol. Chem. 1997; 272: 4671-4679Abstract Full Text Full Text PDF PubMed Scopus (60) Google Scholar). To further investigate the contribution of Rac1 switch regions to the GEF reaction, we have generated a panel of point mutants at both switch I (E31A, Y32A, I33A, T35A, D38A, and N39A) and switch II (A59G, Q61L, Y64A, D65A, R66A/L67A, L70A/S71A, and Q74D) positions at which most of the mutated residues are highly conserved among Rho family GTPases. The abilities of the mutants to bind to and to be activated by the GEFs, TrioN, GEF-H1, and Tiam1 were analyzed. Under similar conditions, the switch I mutants E31A, I33A, and T35A maintained both the binding activity and GEF responsiveness to TrioN and GEF-H1, Y32A retained the binding but lost the GEF sensitivity, and D38A and N39A were inactive in either binding or catalysis toward TrioN or GEF-H1 (Figs. 2, A and B). Similar results were also obtained for Tiam1 binding and catalysis (data not shown). These results indicate that the switch I residues are probably involved in both aspects of the GEF reactions, the GEF binding (residues Asp38 and Asn39) and the nucleotide exchange catalysis (residue Tyr32). When the switch II mutants of Rac1 were examined in the similar assays, we found that A59G, D65A, L70A/S71A, and Q74D remained capable of binding to TrioN and GEF-H1, whereas Q61L, Y64A, and R66A/L67A lost binding activity to the GEFs (Fig. 2 C). In the GDP/GTP exchange reactions, Q61L, Y64A, D65A, R66A/L67A, and L70A/S71A failed to undergo nucleotide exchange when incubated with TrioN or GEF-H1 (Fig. 2 D). Tiam1 acted similarly to TrioN or GEF-H1 in both aspects (data not shown). Like the switch I situation, we conclude that switch II of Rac1 is also important for both the physical association with the GEFs (residues Gln61, Tyr64, and Arg66/Leu67) and the efficient exchange of nucleotides catalyzed by the GEFs (residues Asp65 and Leu70/Ser71). Rac1 and Cdc42 share over 70% sequence identity throughout their sequences (Fig. 3 A). Since the switch resid" @default.
• W2093334583 created "2016-06-24" @default.
• W2093334583 creator A5020584779 @default.
• W2093334583 creator A5044564994 @default.
• W2093334583 creator A5051880377 @default.
• W2093334583 creator A5059396663 @default.
• W2093334583 creator A5060384504 @default.
• W2093334583 date "2001-12-01" @default.
• W2093334583 modified "2023-09-30" @default.
• W2093334583 title "Trp56 of Rac1 Specifies Interaction with a Subset of Guanine Nucleotide Exchange Factors" @default.
• W2093334583 cites W1484050792 @default.
• W2093334583 cites W1598659248 @default.
• W2093334583 cites W1824220821 @default.
• W2093334583 cites W1887383255 @default.
• W2093334583 cites W1966732663 @default.
• W2093334583 cites W1967691264 @default.
• W2093334583 cites W1970170695 @default.
• W2093334583 cites W1973535514 @default.
• W2093334583 cites W1977612304 @default.
• W2093334583 cites W1980821707 @default.
• W2093334583 cites W1983657784 @default.
• W2093334583 cites W1989143807 @default.
• W2093334583 cites W1992763171 @default.
• W2093334583 cites W1999538252 @default.
• W2093334583 cites W2004373826 @default.
• W2093334583 cites W2010779754 @default.
• W2093334583 cites W2021374902 @default.
• W2093334583 cites W2024619839 @default.
• W2093334583 cites W2030616863 @default.
• W2093334583 cites W2036887265 @default.
• W2093334583 cites W2037610353 @default.
• W2093334583 cites W2038894510 @default.
• W2093334583 cites W2044681890 @default.
• W2093334583 cites W2058403655 @default.
• W2093334583 cites W2066622533 @default.
• W2093334583 cites W2067541328 @default.
• W2093334583 cites W2069177549 @default.
• W2093334583 cites W2075497451 @default.
• W2093334583 cites W2077190796 @default.
• W2093334583 cites W2077792958 @default.
• W2093334583 cites W2096791952 @default.
• W2093334583 cites W2106993162 @default.
• W2093334583 cites W2113157712 @default.
• W2093334583 cites W2116463110 @default.
• W2093334583 cites W2133486542 @default.
• W2093334583 cites W2140882934 @default.
• W2093334583 cites W2157767412 @default.
• W2093334583 doi "https://doi.org/10.1074/jbc.m108865200" @default.
• W2093334583 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/11595749" @default.
• W2093334583 hasPublicationYear "2001" @default.
• W2093334583 type Work @default.
• W2093334583 sameAs 2093334583 @default.
• W2093334583 citedByCount "96" @default.
• W2093334583 countsByYear W20933345832012 @default.
• W2093334583 countsByYear W20933345832013 @default.
• W2093334583 countsByYear W20933345832014 @default.
• W2093334583 countsByYear W20933345832015 @default.
• W2093334583 countsByYear W20933345832016 @default.
• W2093334583 countsByYear W20933345832017 @default.
• W2093334583 countsByYear W20933345832018 @default.
• W2093334583 countsByYear W20933345832019 @default.
• W2093334583 countsByYear W20933345832020 @default.
• W2093334583 countsByYear W20933345832021 @default.
• W2093334583 countsByYear W20933345832022 @default.
• W2093334583 countsByYear W20933345832023 @default.
• W2093334583 crossrefType "journal-article" @default.
• W2093334583 hasAuthorship W2093334583A5020584779 @default.
• W2093334583 hasAuthorship W2093334583A5044564994 @default.
• W2093334583 hasAuthorship W2093334583A5051880377 @default.
• W2093334583 hasAuthorship W2093334583A5059396663 @default.
• W2093334583 hasAuthorship W2093334583A5060384504 @default.
• W2093334583 hasBestOaLocation W20933345831 @default.
• W2093334583 hasConcept C104317684 @default.
• W2093334583 hasConcept C126619667 @default.
• W2093334583 hasConcept C185592680 @default.
• W2093334583 hasConcept C207332259 @default.
• W2093334583 hasConcept C2778301229 @default.
• W2093334583 hasConcept C512185932 @default.
• W2093334583 hasConcept C54355233 @default.
• W2093334583 hasConcept C55493867 @default.
• W2093334583 hasConcept C86803240 @default.
• W2093334583 hasConceptScore W2093334583C104317684 @default.
• W2093334583 hasConceptScore W2093334583C126619667 @default.
• W2093334583 hasConceptScore W2093334583C185592680 @default.
• W2093334583 hasConceptScore W2093334583C207332259 @default.
• W2093334583 hasConceptScore W2093334583C2778301229 @default.
• W2093334583 hasConceptScore W2093334583C512185932 @default.
• W2093334583 hasConceptScore W2093334583C54355233 @default.
• W2093334583 hasConceptScore W2093334583C55493867 @default.
• W2093334583 hasConceptScore W2093334583C86803240 @default.
• W2093334583 hasIssue "50" @default.
• W2093334583 hasLocation W20933345831 @default.
• W2093334583 hasOpenAccess W2093334583 @default.
• W2093334583 hasPrimaryLocation W20933345831 @default.
• W2093334583 hasRelatedWork W1485381313 @default.
• W2093334583 hasRelatedWork W1607176723 @default.
• W2093334583 hasRelatedWork W2016777141 @default.
• W2093334583 hasRelatedWork W2032964163 @default.

• next