FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2093545874> ?p ?o ?g. }

• W2093545874 endingPage "23455" @default.
• W2093545874 startingPage "23445" @default.
• W2093545874 abstract "Human DNA polymerase N (POLN or pol ν) is the most recently discovered nuclear DNA polymerase in the human genome. It is an A-family DNA polymerase related to Escherichia coli pol I, human POLQ, and Drosophila Mus308. We report the first purification of the recombinant enzyme and examination of its biochemical properties, as a step toward understanding the functions of POLN. Unusual for an A-family DNA polymerase, POLN is a low fidelity enzyme incorporating T opposite template G with a frequency of 0.45 and G opposite template T with a frequency of 0.021. The frequency of misincorporation of T opposite template G is higher than any other known DNA polymerase. POLN has a processivity of DNA synthesis (1–100 nucleotides) similar to the exonuclease-deficient Klenow fragment of E. coli pol I, is inhibited by dideoxynucleotides, and resistant to aphidicolin. The strand displacement activity of POLN was higher than exonuclease-deficient Klenow fragment. Furthermore, POLN can perform translesion synthesis past thymine glycol, a common endogenous and radiation-induced product of reactive oxygen species damage to DNA. Thymine glycol blocks DNA synthesis by most DNA polymerases, but POLN was particularly adept at efficient and accurate translesion synthesis past a 5S-thymine glycol. Human DNA polymerase N (POLN or pol ν) is the most recently discovered nuclear DNA polymerase in the human genome. It is an A-family DNA polymerase related to Escherichia coli pol I, human POLQ, and Drosophila Mus308. We report the first purification of the recombinant enzyme and examination of its biochemical properties, as a step toward understanding the functions of POLN. Unusual for an A-family DNA polymerase, POLN is a low fidelity enzyme incorporating T opposite template G with a frequency of 0.45 and G opposite template T with a frequency of 0.021. The frequency of misincorporation of T opposite template G is higher than any other known DNA polymerase. POLN has a processivity of DNA synthesis (1–100 nucleotides) similar to the exonuclease-deficient Klenow fragment of E. coli pol I, is inhibited by dideoxynucleotides, and resistant to aphidicolin. The strand displacement activity of POLN was higher than exonuclease-deficient Klenow fragment. Furthermore, POLN can perform translesion synthesis past thymine glycol, a common endogenous and radiation-induced product of reactive oxygen species damage to DNA. Thymine glycol blocks DNA synthesis by most DNA polymerases, but POLN was particularly adept at efficient and accurate translesion synthesis past a 5S-thymine glycol. The human genome contains 15 distinct known DNA polymerase genes, and these are classified into four families A, B, X, and Y based on their amino acid sequences (1Hübscher U. Maga G. Spadari S. Annu. Rev. Biochem. 2002; 71: 133-163Crossref PubMed Scopus (583) Google Scholar). Human DNA polymerase N (POLN), 2The abbreviations used are: POLN, human DNA polymerase N; pol, polymerase; BER, base excision repair; NER, nucleotide excision repair; Tg, thymine glycol; CPD, cyclobutane pyrimidine dimer; 6-4 PP, (6-4) photoproduct; NEM, N-ethylmaleimide; Kf (exo-), exonuclease-deficient Klenow fragment of E. coli DNA polymerase I; DTT, dithiothreitol; BSA, bovine serum albumin. 2The abbreviations used are: POLN, human DNA polymerase N; pol, polymerase; BER, base excision repair; NER, nucleotide excision repair; Tg, thymine glycol; CPD, cyclobutane pyrimidine dimer; 6-4 PP, (6-4) photoproduct; NEM, N-ethylmaleimide; Kf (exo-), exonuclease-deficient Klenow fragment of E. coli DNA polymerase I; DTT, dithiothreitol; BSA, bovine serum albumin. the most recently discovered nuclear DNA polymerase, is an A-family enzyme with unknown function. The gene on chromosome 4p16.2 encodes a protein of 900 amino acid residues with a molecular mass of 100 kDa (2Marini F. Kim N. Schuffert A. Wood R.D. J. Biol. Chem. 2003; 278: 32014-32019Abstract Full Text Full Text PDF PubMed Scopus (93) Google Scholar). The prototypical A-family DNA polymerase, Escherichia coli pol I is a high fidelity DNA polymerase that contributes to the maturation of Okazaki fragments during DNA replication and in gap-filling during base excision repair (BER), nucleotide excision repair (NER), and repair of DNA interstrand cross-links. Human POLQ, another A-family DNA polymerase, is similar to the Drosophila nuclear DNA polymerase Mus308 (3Pang M. McConnell M. Fisher P.A. DNA Repair (Amst). 2005; 4: 971-982Crossref PubMed Scopus (12) Google Scholar) in that it encodes both a DNA/RNA helicase domain and an A-family DNA polymerase domain (4Seki M. Marini F. Wood R.D. Nucleic Acids Res. 2003; 31: 6117-6126Crossref PubMed Scopus (144) Google Scholar, 5Seki M. Masutani C. Yang L.W. Schuffert A. Iwai S. Bahar I. Wood R.D. EMBO J. 2004; 23: 4484-4494Crossref PubMed Scopus (161) Google Scholar). By contrast, POLN has only the DNA polymerase domain. The POLN gene is encoded only in vertebrate genomes, but not in invertebrates or any lower eukaryotes. Possibly POLN has a role related to organ systems that are especially developed in vertebrates, such as the adaptive immune system or the brain. Expression studies of POLN are limited, but expression of the gene has been detected by Northern blotting in testes, heart and skeletal muscle tissue (2Marini F. Kim N. Schuffert A. Wood R.D. J. Biol. Chem. 2003; 278: 32014-32019Abstract Full Text Full Text PDF PubMed Scopus (93) Google Scholar) and by expression sequence tagging in prostate, muscle, brain, and other organs. In cells from a human neuroblastoma patient, a chromosome fusion (1Hübscher U. Maga G. Spadari S. Annu. Rev. Biochem. 2002; 71: 133-163Crossref PubMed Scopus (583) Google Scholar, 4Seki M. Marini F. Wood R.D. Nucleic Acids Res. 2003; 31: 6117-6126Crossref PubMed Scopus (144) Google Scholar) disrupting the DNA polymerase domain coding sequence of POLN was observed at diagnosis and at relapse. A (4Seki M. Marini F. Wood R.D. Nucleic Acids Res. 2003; 31: 6117-6126Crossref PubMed Scopus (144) Google Scholar, 17Clark J.M. Nucleic Acids Res. 1988; 16: 9677-9686Crossref PubMed Scopus (721) Google Scholar) fusion was detected at relapse only (6Schleiermacher G. Bourdeaut F. Combaret V. Picrron G. Raynal V. Aurias A. Ribeiro A. Janoueix-Lerosey I. Delattre O. Oncogene. 2005; 24: 3377-3384Crossref PubMed Scopus (21) Google Scholar). It is possible that POLN might serve as a tumor suppressor in some cell types and that loss of its function could accelerate genome instability. To understand the functions of human POLN, we examined the fidelity and the activity of DNA damage bypass. We find that POLN has very low fidelity and a remarkable insertion preference different from any other known human DNA polymerase. Further, POLN can perform accurate translesion synthesis past a common product of reactive oxygen species damage to DNA, the thymine glycol. The properties of POLN indicate a function distinct from that of POLQ. Enzyme Purification—To construct a human POLN sequence construct for expression in E. coli, POLN with a short truncation of the C-terminal proline-rich tail was purified. This enzyme, previously referred to as POLN ΔP (2Marini F. Kim N. Schuffert A. Wood R.D. J. Biol. Chem. 2003; 278: 32014-32019Abstract Full Text Full Text PDF PubMed Scopus (93) Google Scholar) shows no difference in activity from full-length POLN and is the same length as rodent POLN. This POLN and the corresponding D623A mutant were amplified by PCR from the plasmid pEGFP-C1 containing full-length wild type or D623A mutant POLN (2Marini F. Kim N. Schuffert A. Wood R.D. J. Biol. Chem. 2003; 278: 32014-32019Abstract Full Text Full Text PDF PubMed Scopus (93) Google Scholar) using the primers 5′-CACCGAAAATTATGAGGCATTGGTAGGC-3′ (for the 5′-end) and 5′-ATATATGAATTCCTACTTGTCGTCATCGTCTTTGTAGTCCATGCCCCAGGCCTCCTGCAGTGGCACC-3′ (for the 3′-end), and cloned into plasmid pENTR/d-TOPO (Invitrogen). After DNA sequencing, the cDNA was transferred into plasmid pDEST17 (Invitrogen) resulting in a protein tagged with six His residues at the N terminus (contributed by the pDEST17 vector), and a FLAG tag at the C terminus. The plasmid was transformed into an E. coli strain BL21 star (DE3), mutated for RNaseE (Invitrogen) and containing a plasmid (pRARE, Novagen) encoding 7 tRNAs for rare codons and the lysS+ gene. A single colony was incubated in 25 ml of Luria-Bertani medium (LB) containing 40 mm glucose, 50 μg/ml carbenicillin, and 50 μg/ml chloramphenicol at 37 °C. The culture was grown overnight and transferred into 500 ml of fresh LB containing 40 mm glucose, 50 μg/ml carbenicillin, and 50 μg/ml chloramphenicol. The culture was grown at 37 °C to an optical density at 600 nm of 0.5 and cooled down on ice for 30 min. The culture was incubated with 1 mm isopropyl-β-d-thiogalactopyranoside at 16 °C for 16 h. Incubation at 16 °C improved soluble protein expression relative to incubation at 37 °C. Cells were harvested by centrifugation (3000 × g for 10 min) and washed with ice-cold phosphate-buffered saline. After centrifugation (3000 × g for 10 min), 10 volumes of FLAG binding buffer (100 mm sodium phosphate pH 7.6, 10% glycerol, 5 mm EDTA, 0.1% Triton X-100, 0.1 mg/ml BSA, 100 nm desferrioxamine, and EDTA-free protease inhibitor mixture from Roche Applied Science was added to the pellet. The resuspended mixture was sonicated on ice (20 cycles of 10 s with a 20 s pause), and 0.25% polyethyleneimine was added and incubated for 15 min at 4 °C. DNA and debris were removed by centrifugation (15,000 × g for 15 min) and the supernatant incubated overnight at 4 °C with 200 μl of FLAG resin (Sigma). The resin was washed five times with 10 volumes of FLAG washing buffer (100 mm sodium phosphate, pH 7.6, 10% glycerol, 0.01% Nonidet P-40, and EDTA-free protease inhibitor mixture) and then three times with 10 volumes of TALON binding buffer (50 mm sodium phosphate, pH 7.0, 300 mm NaCl, 10% glycerol, 0.01% Nonidet P-40, and EDTA-free protease inhibitor mixture). The protein was eluted by incubating with 200 μg/ml FLAG peptide in 500 μl of TALON binding buffer for 1 h at 4 °C. The elution was incubated with 500 μl of TALON resin (BD Biosciences Clontech) for 1 h at 4 °C. The resin was washed five times with 10 volumes of TALON binding buffer and the protein eluted with 1 ml of TALON binding buffer containing 150 mm imidazole. Rabbit polyclonal antibody PA434, raised against an N-terminal 500-amino acid fragment of human POLN produced in E. coli (2Marini F. Kim N. Schuffert A. Wood R.D. J. Biol. Chem. 2003; 278: 32014-32019Abstract Full Text Full Text PDF PubMed Scopus (93) Google Scholar) was used for immunoblotting. DNA polymerase Q (POLQ) was as reported (5Seki M. Masutani C. Yang L.W. Schuffert A. Iwai S. Bahar I. Wood R.D. EMBO J. 2004; 23: 4484-4494Crossref PubMed Scopus (161) Google Scholar). RB69 (gp43) was expressed from a plasmid provided by W. Konigsberg and purified as described (7Yang G. Franklin M. Li J. Lin T.C. Konigsberg W. Biochemistry. 2002; 41: 10256-10261Crossref PubMed Scopus (75) Google Scholar). Human DNA polymerase β (POLB) was provided by R. Sobol, and human DNA polymerase η (POLH) by C. Masutani and F. Hanaoka. Kf (exo-) and E. coli pol I were obtained from Promega. Oligonucleotide Substrates—Primer oligonucleotides were purchased from Bio-Synthesis or Sigma GenoSys, purified by HPLC or gel extraction, and 5′-labeled using polynucleotide kinase and [γ-32P]dATP. For 3′-labeling, the oligonucleotides were incubated with terminal deoxynucleotidyl transferase (TdT) and [α-32P]ddATP. Oligonucleotides containing a single thymine-thymine CPD, thymine-thymine 6–4 photoproduct, or 5S-thymine glycol were synthesized as detailed earlier (8Murata T. Iwai S. Ohtsuka E. Nucleic Acids Res. 1990; 18: 7279-7286Crossref PubMed Scopus (91) Google Scholar, 9Iwai S. Shimizu M. Kamiya H. Ohtsuka E. J. Am. Chem. Soc. 1996; 118: 7642-7643Crossref Scopus (99) Google Scholar, 10Shimizu T. Manabe K. Yoshikawa S. Kawasaki Y. Iwai S. Nucleic Acids Res. 2006; 34: 313-321Crossref PubMed Scopus (23) Google Scholar). The oligonucleotide containing a 1,2 d(GpG) cisplatin intrastrand adduct was as described (11Szymkowski D.E. Yarema K.J. Essigmann J.E. Lippard S.J. Wood R.D. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 10772-10776Crossref PubMed Scopus (103) Google Scholar). The oligonucleotide containing an AP site or 5R-thymine glycol were purchased from Glen Research. 5′-32P-Labeled primers were annealed to these oligonucleotides to create substrates for bypass assays (lesions highlighted by bold letters) as follows: Non-damaged substrate: CACTGACTGTATGATGGTGACTGACATACTACTTCTACGACTGCTC-5′. This substrate was also used for the 3′-5′ exonuclease assay. 5′-AAGATGCTGACGAG or 5′-AGATGCTGACGAG were annealed to the non-damaged substrate to create the nicked substrate or single-gapped substrates, respectively. CPD- and (6–4)PP substrate: CACTGACTGTATGATGGTGACTGACATACTACTTCTACGACTGCTC-5′. AP site-substrate (site of the AP-analog denoted by X): CACTGACTGTATGATGGTGACTGACATACTACXTCTACGACTGCTC-5′. Tg-substrate (5S-Tg or 5R-Tg is denoted by Tg): CACTGACTGTATGATGGTGACTGACATACTAC(Tg)TCTACGACTGCTC. 1,2 d(GpG) cisplatin intrastrand adduct substrate: AGAAGAAGAAGGTCTTCTTCTTCCGGATCTTCTTCT-5′. For processivity assays, the 24-mer primer oligonucleotide 5′-[32P]TCTTCTTCTGTGCACTCTTCTTCT was annealed to M13mp18GTGx single-stranded DNA (12Moggs J.G. Yarema K.J. Essigmann J.M. Wood R.D. J. Biol. Chem. 1996; 271: 7177-7186Abstract Full Text Full Text PDF PubMed Scopus (182) Google Scholar). For strand displacement assays, A 60-mer oligonucleotide with either a 5′-phosphoryl or 5′-hydroxyl, 5′-CCCCAGGAATTCGGTCATAGCTGTTTCCTGCTCGAGGGCGCCAGGGTGGTTTTTCTTTTC was annealed together with the 24-mer oligomer to M13mp18GTGx ssDNA. For assay of TdT activity, the 14-mer oligomer 5′-[32P]AAGATGCTGACGAG was tested as a single strand or annealed to 5′-CTCGTCAGCATCTT as a blunt end duplex. DNA Polymerase Assays—A 5′-labeled 16-mer primer and a 30-mer template (sequences given above) were annealed at a molar ratio of 1:1 to detect DNA polymerase activity. The oligonucleotides were heated for 5 min at 65 °C and cooled down slowly for self-annealing. Standard reaction mixtures (10 μl) contained 20 mm Tris-HCl pH 8.8, 4% glycerol, 2 mm DTT, 80 μg/ml BSA, 8 mm Mg(C2H3O2)2, 300 fmol of the primer template (30 nm), 100 μm each dNTP, and the indicated amount of POLN. dATP, dTTP, dGTP, and dCTP (100 μm) each were also present unless otherwise indicated. Before the addition of POLN, the reaction mixture was preincubated at 37 °C for 1 min. After incubation at 37 °C for 10 min (unless otherwise indicated), reactions were terminated by adding 10 μl of gel loading buffer (98% deionized formamide, 0.025% xylene cyanol, 0.025% bromphenol blue, and 20 mm EDTA) and boiling at 95 °C for 3 min. Products were electrophoresed on a denaturing 20% polyacrylamide-7 m urea gel and exposed to BioMax MS film or analyzed with a Fuji FLA3000 Phosphor Imager. For translesion synthesis, the same amounts of templates containing specific lesions were used. For steady-state kinetics, 1 pmol of primer template (100 nm) was used, and the procedure was as previously described (13Creighton S. Bloom L.B. Goodman M.F. Methods Enzymol. 1995; 262: 232-256Crossref PubMed Scopus (225) Google Scholar, 14Kusumoto R. Masutani C. Iwai S. Hanaoka F. Biochemistry. 2002; 41: 6090-6099Crossref PubMed Scopus (118) Google Scholar). This procedure utilizes extensive titration of nucleotide concentration (1.0–1000 μm) and three appropriate time points (1–10 min), and produces results valid for a considerable range of enzyme concentration. The velocity (v) was determined by dividing the amount of reaction product by the reaction time. Vmax and Km were determined from a Hanes-Woolf plot of [dNTP]/v versus [dNTP]. The nucleotide misincorporation ratio, finc was determined by dividing (Vmax/Km)incorrect by (Vmax/Km)correct. To optimize conditions and assay sensitivity to aphidicolin (Fisher), N-ethylmaleimide (NEM) (Sigma) or ddTTP (2′,3′-dideoxythymidine-5′-triphosphate, Amersham Biosciences), a poly(dA)-oligo(dT)10:1 template was used instead of the 5′-labeled 16-mer primer annealed to the 30-mer template. Reaction mixtures (25 μl) contained 20 mm Tris-HCl pH 8.8 (unless otherwise indicated), 4% glycerol, 2 mm DTT, 80 μg/ml BSA, 8 mm Mg(C2H3O2)2 (unless otherwise indicated), 8 μg/ml of poly(dA)-oligo(dT)10:1, 10 μm dTTP, 1 μCi of [α-32P]dTTP, 23 nm POLN (unless otherwise indicated), and NaCl, aphidicolin, NEM or ddTTP as specified. After incubation at 37 °C for 20 min, reactions were stopped by adding 25 μl of 40 mm EDTA and placed on ice. A 10-μl aliquot of each mixture was spotted onto DE81 paper (Whatman), and washed three times with 0.5 m Na2HPO4 for 5 min and twice with ethanol. The paper was dried, and radioactivity was quantified with a Fuji Phosphor Imager. One unit of DNA polymerase activity was defined as the amount catalyzing the incorporation of 10 nmol of dTTP into poly(dA)/oligo(dT)10:1 template at 37 °C for 30 min. Processivity Assay—Single-primed phagemid DNA templates were prepared by annealing the 5′-32P-labeled 24-mer primer to single-stranded M13mp18GTGx at a molar ratio of 2:1. POLN or Kf (exo-) was incubated with 500 fmol of the singly primed template at 37 °C in 10μl of polymerase buffer. For Kf (exo-) the buffer contained 50 mm Tris-HCl pH 7.2, 100 μm DTT, 10 mm MgSO4, and 100 μm each dNTP. Reactions were terminated by adding 10 μl of gel loading buffer and boiling at 95 °C for 3 min. Products were electrophoresed on a denaturing 10% polyacrylamide-7 m urea gel and exposed to BioMax MS film. Translesion Synthesis Assays—The 5′-32P-labeled 16-mer primer annealed to the 30-mer template at a molar ratio of 1:1 was used as primer template. POLN, RB69 (gp43), POLB, pol I, Kf (exo-), POLH, or POLQ was incubated with 300 fmol of the primer template at 37 °C in 10 μl reactions. The buffer for POLN or Kf (exo-) was the same as given above. The buffer for RB69 (gp43) contained 10 mm Tris-HCl pH 7.9, 50 mm NaCl, 1 mm DTT, 200 μg/ml BSA, 10 mm MgCl2, and 100 μm each dNTP. The buffer for POLB contained 50 mm Tris-HCl pH 8.0, 50 mm NaCl, 1.5 mm DTT, 100 μg/ml BSA, 200 μm EDTA, 10 mm MgCl2, and 100 μm each dNTP. The buffer for E. coli pol I contained 50 mm Tris-HCl pH 7.2, 100 μm DTT, 10 mm MgSO4, and 100 μm each dNTP. The buffer for POLH contained 40 mm Tris-HCl pH 8.0, 2.5% glycerol, 45 mm KCl, 10 mm DTT, 250 μg/ml BSA, 5 mm MgCl2, and 100 μm each dNTP. The buffer for POLQ contained 20 mm Tris-HCl, pH 8.8, 4% glycerol, 80 μg/ml BSA, 100 μm EDTA, 8 mm MgCl2, and 100 μm each dNTP. Reactions were terminated by adding 10 μl of the gel loading buffer and boiling at 95 °C for 3 min. Products were electrophoresed on a denaturing 20% polyacrylamide-7 m urea gel and exposed to BioMax MS film. Strand Displacement Assay—Substrates were prepared by mixing 5′-32P-labeled 16-mer primer, a downstream oligomer (5′-AAGATGCTGACGAG or 5′-AGATGCTGACGAG), and the 30-mer template at a molar ratio of 1:5:2 for use as a nicked substrate or 1-nt gap substrate, respectively. Reactions were performed under the same conditions as translesion synthesis assays. To measure the processivity of strand displacement, substrates were prepared by mixing the 5′-32P-labeled 24-mer primer, the downstream 60-mer oligomer with a 5′-phosphoryl or 5′-hydroxyl group (blocked at the 3′-end from priming using TdT and ddATP), and the single-stranded M13mp18GTGx at a molar ratio of 1:5:2. Purification and Biochemical Properties of Human DNA Polymerase N—The human POLN cDNA was expressed in E. coli and tagged with six His residues at the N terminus and a FLAG epitope at the C terminus. Protein sequentially purified on FLAG antibody beads and TALON resin migrated near the expected Mr of 102,000 (Fig. 1, A and B). POLN could extend DNA on a primed template whereas the active site mutant (D623A) showed no DNA polymerase activity (Fig. 1C). This residue is highly conserved in motif 3 of A-family DNA polymerases and is important in coordinating bivalent metal ions to interact with an incoming nucleotide (15Li Y. Korolev S. Waksman G. EMBO J. 1998; 17: 7514-7525Crossref PubMed Scopus (651) Google Scholar). The DNA binding activity of POLN was not influenced by this substitution (data not shown). POLN lacks sequences corresponding to a 3′-5′ exonuclease domain, and no exonuclease activity was detected when enzyme and substrate were incubated without dNTPs (Fig. 1D). POLN showed limited TdT activity and was able to add one nucleotide, particularly dAMP, to the 3′-end of a double-stranded template, but not on a single-stranded template (Fig. 1E). Non-templated addition at a blunt end is a common feature of A-family DNA polymerases (16Clark J.M. Joyce C.M. Beardsley G.P. J. Mol. Biol. 1987; 198: 123-128Crossref PubMed Scopus (132) Google Scholar, 17Clark J.M. Nucleic Acids Res. 1988; 16: 9677-9686Crossref PubMed Scopus (721) Google Scholar). The optimal reaction conditions for human POLN were determined using a poly(dA)/oligo(dT)10:1 substrate. The optimal pH was 8.8, the same as POLQ (5Seki M. Masutani C. Yang L.W. Schuffert A. Iwai S. Bahar I. Wood R.D. EMBO J. 2004; 23: 4484-4494Crossref PubMed Scopus (161) Google Scholar) (data not shown). Like POLQ (4Seki M. Marini F. Wood R.D. Nucleic Acids Res. 2003; 31: 6117-6126Crossref PubMed Scopus (144) Google Scholar), the DNA polymerase activity of POLN was highest in reaction mixtures that contained no salt, and increasing concentrations of NaCl inhibited the activity with 50% inhibition at 200 mm. POLN required a bivalent cation, and the optimal concentration was 8 mm Mg2+. Mn2+ at 4 mm provided 29% of the optimal activity. There was no difference between Mg(C2H3O2)2 and MgCl2 (not shown). Aphidicolin, which is an inhibitor of B-family DNA polymerases such as T4 DNA polymerase, had no inhibitory effect on POLN or Kf (exo-), respectively (Fig. 2A). Like Kf (exo-), POLN was relatively insensitive to NEM, whereas T4 DNA polymerase was sensitive (Fig. 2B). The specific activity of POLN with these optimal conditions was 125 units/mg. A single aromatic residue in motif 4 of A-family DNA polymerases, either Phe or Tyr, is highly conserved and critical for ddNTPs selectivity (Fig. 2D). Replacing Tyr526 of T7 DNA polymerase with Phe increases discrimination against ddNTPs, whereas replacing Phe667 of Taq pol I or Phe762 of E. coli pol I with Tyr decreases discrimination against ddNTPs (18Tabor S. Richardson C.C. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 6339-6343Crossref PubMed Scopus (299) Google Scholar). POLN has a Tyr682 at the homologous position, and the DNA polymerase activity of POLN was inhibited by ddTTP on the poly(dA)-oligo(dT) template (Fig. 2C). Human POLQ with Tyr2389 (4Seki M. Marini F. Wood R.D. Nucleic Acids Res. 2003; 31: 6117-6126Crossref PubMed Scopus (144) Google Scholar) or Drosophila Mus308 with Tyr1882 (19Harris P.V. Mazina O.M. Leonhardt E.A. Case R.B. Boyd J.B. Burtis K.C. Mol. Cell. Biol. 1996; 16: 5764-5771Crossref PubMed Scopus (96) Google Scholar) is also inhibited by ddNTP. Processivity of Human DNA Polymerase N—To examine the processivity of POLN, a 5′-labeled 24-mer oligonucleotide was annealed to single-stranded circular M13 phage DNA and extension analyzed. The assay was performed in several ways to favor products resulting from a single binding event of POLN to the primer template. In an enzyme titration, POLN could elongate DNA chains as much as ∼100–150 nt (Fig. 3A). The product distribution was retained in the presence of an excess amount of poly(dA)/oligo(dT)10:1 as a trapping agent (Fig. 3B), and products of >100 nt were observed after only 5 min (Fig. 3C). The pattern was similar to that produced by Kf (exo-) (Fig. 5, A–C), which also gives products of 1–100 nt (20Eckert K.A. Kunkel T.A. J. Biol. Chem. 1993; 268: 13462-13471Abstract Full Text PDF PubMed Google Scholar). Thus, the processsivity of human POLN is considerably greater than the processivity of 1–10 nt typically observed for X and Y family DNA polymerases.FIGURE 5Translesion synthesis by human POLN. Increasing amounts of RB69 (gp43) (2.4, 4.8, and 9.5 pm in lanes 2–4), POLB (75, 150, and 300 pm in lanes 6–8), pol I (2.3, 4.6, and 9.2 pm in lanes 10–12), Kf (exo-) (0.23, 0.46, and 0.92 pm in lanes 14–16), POLH (0.27, 0.54, and 1.08 nm in lanes 18–20), POLQ (2.8, 5.7, and 11.3 nm in lanes 22–24) or POLN (5.7, 11.3, and 23 nm in lanes 26–28) were incubated with the 5′-32P-labeled primer templates indicated beside each panel at 37 °C for 10 min. Lanes 1, 5, 9, 13, 17, 21, and 25 contained no enzyme. A, undamaged control; B, 1,2-d(GpG) cisplatin adduct; C, AP analog; D, 5S-Tg; E, 5R-Tg; F, T-T CPD; G, T-T 6–4 PP. In part A the percent (%) extension of the primer is shown below each lane.View Large Image Figure ViewerDownload Hi-res image Download (PPT)FIGURE 5Translesion synthesis by human POLN. Increasing amounts of RB69 (gp43) (2.4, 4.8, and 9.5 pm in lanes 2–4), POLB (75, 150, and 300 pm in lanes 6–8), pol I (2.3, 4.6, and 9.2 pm in lanes 10–12), Kf (exo-) (0.23, 0.46, and 0.92 pm in lanes 14–16), POLH (0.27, 0.54, and 1.08 nm in lanes 18–20), POLQ (2.8, 5.7, and 11.3 nm in lanes 22–24) or POLN (5.7, 11.3, and 23 nm in lanes 26–28) were incubated with the 5′-32P-labeled primer templates indicated beside each panel at 37 °C for 10 min. Lanes 1, 5, 9, 13, 17, 21, and 25 contained no enzyme. A, undamaged control; B, 1,2-d(GpG) cisplatin adduct; C, AP analog; D, 5S-Tg; E, 5R-Tg; F, T-T CPD; G, T-T 6–4 PP. In part A the percent (%) extension of the primer is shown below each lane.View Large Image Figure ViewerDownload Hi-res image Download (PPT) Unusual Fidelity Properties of POLN—Prokaryotic A-family DNA polymerases have relatively high fidelities and contribute to error-free DNA synthesis. The human A-family DNA polymerase POLQ has low fidelity, however (5Seki M. Masutani C. Yang L.W. Schuffert A. Iwai S. Bahar I. Wood R.D. EMBO J. 2004; 23: 4484-4494Crossref PubMed Scopus (161) Google Scholar). We analyzed the fidelity of POLN using a 30-mer template with a 16-mer primer (Fig. 4). When the first template base was G, POLN frequently incorporated the incorrect nucleotide T when dTTP was the only deoxynucleotide present, (Fig. 4, lane 4). Incorporation of G across from template G and further extension past a noncomplementary G-T base pair was also observed (Fig. 4, lane 3). With template T, POLN usually incorporated A but also frequently incorporated the incorrect base G (Fig. 4, lane 7). When the first template base was A, POLN usually incorporated the correct base T but also incorporated an extra incorrect T opposite the following template T (Fig. 4, lane 12). With template C, POLN frequently incorporated the correct choice G opposite the first template C, and extended further by incorporating G opposite the following template T (Fig. 4, lane 15). These experiments indicated that POLN catalyzes considerable misincorporation, particularly by incorporating T opposite G and G opposite T. To examine the fidelity of POLN, kinetic parameters were determined. We examined the template (first template base G) on which POLN appeared to incorporate incorrect bases most frequently (Fig. 4). Measurements were obtained with other incoming nucleotides, and from the ratio Vmax/Km (13Creighton S. Bloom L.B. Goodman M.F. Methods Enzymol. 1995; 262: 232-256Crossref PubMed Scopus (225) Google Scholar), a misincorporation frequency (finc) was calculated. Compared with a value of 1.0 for correct utilization of dCTP opposite template G, these were 8.2 × 10–3 for dATP, 3.6 × 10–2 for dGTP and 4.5 × 10–1 for dTTP (Table 1). These values are about 100 times higher than the misincorporation frequency of ∼10–5 to 10–4 found for Kf (exo-) or Taq pol I (21Bebenek K. Joyce C.M. Fitzgerald M.P. Kunkel T.A. J. Biol. Chem. 1990; 265: 13878-13887Abstract Full Text PDF PubMed Google Scholar, 22Minnick D.T. Bebenek K. Osheroff W.P. Turner Jr., R.M. Astatke M. Liu L. Kunkel T.A. Joyce C.M. J. Biol. Chem. 1999; 274: 3067-3075Abstract Full Text Full Text PDF PubMed Scopus (114) Google Scholar, 23Suzuki M. Yoshida S. Adman E.T. Blank A. Loeb L.A. J. Biol. Chem. 2000; 275: 32728-32735Abstract Full Text Full Text PDF PubMed Scopus (62) Google Scholar) and are closer to the values found for Y-family DNA polymerases (24Goodman M.F. Annu. Rev. Biochem. 2002; 71: 17-50Crossref PubMed Scopus (620) Google Scholar). The finc value for misincorporation of T opposite template G was especially remarkable.TABLE 1Fidelity of POLN on normal DNA and at a TgDNA substratedNTPKmVmaxVmax/Kmfincμmnm/min×10-4Insertion opposite GdATP299 ± 6.00.24 ± 0.018.1 ± 0.28.2 × 10-35′-ATGdCTP8.2 ± 0.60.79 ± 0.22993 ± 3461 -TACGTCdGTP148 ± 180.51 ± 0.1636.0 ± 15.23.6 × 10-2dTTP18.8 ± 4.60.74 ± 0.16442 ± 1944.5 × 10-1Insertion opposite TdATP7.0 ± 1.42.2 ± 0.33210 ± 15215′-ATGdCTP538 ± 870.04 ± 0.010.7 ± 0.12.1 × 10-4 -TACTTCdGTP101 ± 100.69 ± 0.1068.1 ± 3.02.1 × 10-2dTTP410 ± 590.43 ± 0.0410.4 ± 0.63.2 × 10-3POLH (insertion opposite T)dATP4.9 ± 0.82.1 ± 0.24320 ± 317Kf (exo-) (insertion opposite T)dATP4.4 ± 0.53.6 ± 0.58300 ± 1980Insertion opposite AdTTP7.3 ± 0.61.2 ± 0.01680 ± 2005′-ATG -TACATCInsertion opposite CdGTP7.7 ± 1.00.91 ± 0.011200 ± 1515′-ATG -TACCTCInsertion opposite 5S-TgdATP11.8 ± 1.10.63 ± 0.02535 ± 28.915′-ATGdGTP313 ± 600.08 ± 0.012.5 ± 0.14.7 × 10-3 -TACTgTCInsertion opposite 5S-TgdATP26.9 ± 8.00.58 ± 0.21210 ± 1415′-ATGdGTP247 ± 290.28 ± 0.0611.2 ± 1.35.3 × 10-2 -TACTgTC" @default.
• W2093545874 created "2016-06-24" @default.
• W2093545874 creator A5031616404 @default.
• W2093545874 creator A5051937560 @default.
• W2093545874 creator A5065003651 @default.
• W2093545874 creator A5075490359 @default.
• W2093545874 date "2006-08-01" @default.
• W2093545874 modified "2023-10-09" @default.
• W2093545874 title "Human DNA Polymerase N (POLN) Is a Low Fidelity Enzyme Capable of Error-free Bypass of 5S-Thymine Glycol" @default.
• W2093545874 cites W1493170168 @default.
• W2093545874 cites W1523286387 @default.
• W2093545874 cites W1551009163 @default.
• W2093545874 cites W1562498242 @default.
• W2093545874 cites W1594838223 @default.
• W2093545874 cites W1595027863 @default.
• W2093545874 cites W1608869439 @default.
• W2093545874 cites W1908705633 @default.
• W2093545874 cites W1967634425 @default.
• W2093545874 cites W1968679294 @default.
• W2093545874 cites W1972437107 @default.
• W2093545874 cites W1976471833 @default.
• W2093545874 cites W1977668555 @default.
• W2093545874 cites W1981313684 @default.
• W2093545874 cites W1994876630 @default.
• W2093545874 cites W1995689010 @default.
• W2093545874 cites W2003726790 @default.
• W2093545874 cites W2013980088 @default.
• W2093545874 cites W2016872564 @default.
• W2093545874 cites W2017738521 @default.
• W2093545874 cites W2021236910 @default.
• W2093545874 cites W2022120140 @default.
• W2093545874 cites W2025735321 @default.
• W2093545874 cites W2031515890 @default.
• W2093545874 cites W2043792457 @default.
• W2093545874 cites W2046175921 @default.
• W2093545874 cites W2048292104 @default.
• W2093545874 cites W2051676864 @default.
• W2093545874 cites W2056802283 @default.
• W2093545874 cites W2063502275 @default.
• W2093545874 cites W2063891676 @default.
• W2093545874 cites W2064477710 @default.
• W2093545874 cites W2066600899 @default.
• W2093545874 cites W2087254340 @default.
• W2093545874 cites W2088203208 @default.
• W2093545874 cites W2106452314 @default.
• W2093545874 cites W2112656683 @default.
• W2093545874 cites W2125625919 @default.
• W2093545874 cites W2142112049 @default.
• W2093545874 cites W2142513910 @default.
• W2093545874 cites W2145124885 @default.
• W2093545874 cites W2149410625 @default.
• W2093545874 cites W2155768425 @default.
• W2093545874 cites W2157637410 @default.
• W2093545874 cites W2162528126 @default.
• W2093545874 cites W2163221081 @default.
• W2093545874 cites W2165406289 @default.
• W2093545874 cites W2168116907 @default.
• W2093545874 cites W2470508052 @default.
• W2093545874 doi "https://doi.org/10.1074/jbc.m604317200" @default.
• W2093545874 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/16787914" @default.
• W2093545874 hasPublicationYear "2006" @default.
• W2093545874 type Work @default.
• W2093545874 sameAs 2093545874 @default.
• W2093545874 citedByCount "129" @default.
• W2093545874 countsByYear W20935458742012 @default.
• W2093545874 countsByYear W20935458742013 @default.
• W2093545874 countsByYear W20935458742014 @default.
• W2093545874 countsByYear W20935458742015 @default.
• W2093545874 countsByYear W20935458742016 @default.
• W2093545874 countsByYear W20935458742017 @default.
• W2093545874 countsByYear W20935458742018 @default.
• W2093545874 countsByYear W20935458742019 @default.
• W2093545874 countsByYear W20935458742020 @default.
• W2093545874 countsByYear W20935458742021 @default.
• W2093545874 countsByYear W20935458742022 @default.
• W2093545874 countsByYear W20935458742023 @default.
• W2093545874 crossrefType "journal-article" @default.
• W2093545874 hasAuthorship W2093545874A5031616404 @default.
• W2093545874 hasAuthorship W2093545874A5051937560 @default.
• W2093545874 hasAuthorship W2093545874A5065003651 @default.
• W2093545874 hasAuthorship W2093545874A5075490359 @default.
• W2093545874 hasBestOaLocation W20935458741 @default.
• W2093545874 hasConcept C153911025 @default.
• W2093545874 hasConcept C181199279 @default.
• W2093545874 hasConcept C185592680 @default.
• W2093545874 hasConcept C2756471 @default.
• W2093545874 hasConcept C2776858809 @default.
• W2093545874 hasConcept C552990157 @default.
• W2093545874 hasConcept C55493867 @default.
• W2093545874 hasConcept C82381507 @default.
• W2093545874 hasConcept C86803240 @default.
• W2093545874 hasConceptScore W2093545874C153911025 @default.
• W2093545874 hasConceptScore W2093545874C181199279 @default.
• W2093545874 hasConceptScore W2093545874C185592680 @default.
• W2093545874 hasConceptScore W2093545874C2756471 @default.
• W2093545874 hasConceptScore W2093545874C2776858809 @default.
• W2093545874 hasConceptScore W2093545874C552990157 @default.
• W2093545874 hasConceptScore W2093545874C55493867 @default.

• next