SemOpenAlex |

SemOpenAlex

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2093885105> ?p ?o ?g. }

Showing items 1 to 100 of ±123 with 100 items per page.

W2093885105 endingPage "6345" @default.
W2093885105 startingPage "6337" @default.
W2093885105 abstract "The controlled export of solutes is crucial for cellular adaptation to hypotonic conditions. In the yeastSaccharomyces cerevisiae glycerol export is mediated by Fps1p, a member of the major intrinsic protein (MIP) family of channel proteins. Here we describe a short regulatory domain that restricts glycerol transport through Fps1p. This domain is required for retention of cellular glycerol under hypertonic stress and hence acquisition of osmotolerance. It is located in the N-terminal cytoplasmic extension close to the first transmembrane domain. Several residues within that domain and its precise position are critical for channel control while the proximal residues 13–215 of the N-terminal extension are not required. The sequence of the regulatory domain and its position are perfectly conserved in orthologs from other yeast species. The regulatory domain has an amphiphilic character, and structural predictions indicate that it could fold back into the membrane bilayer. Remarkably, this domain has structural similarity to the channel forming loops B and E of Fps1p and other glycerol facilitators. Intragenic second-site suppressor mutations of the sensitivity to high osmolarity conferred by truncation of the regulatory domain caused diminished glycerol transport, confirming that elevated channel activity is the cause of the osmosensitive phenotype. The controlled export of solutes is crucial for cellular adaptation to hypotonic conditions. In the yeastSaccharomyces cerevisiae glycerol export is mediated by Fps1p, a member of the major intrinsic protein (MIP) family of channel proteins. Here we describe a short regulatory domain that restricts glycerol transport through Fps1p. This domain is required for retention of cellular glycerol under hypertonic stress and hence acquisition of osmotolerance. It is located in the N-terminal cytoplasmic extension close to the first transmembrane domain. Several residues within that domain and its precise position are critical for channel control while the proximal residues 13–215 of the N-terminal extension are not required. The sequence of the regulatory domain and its position are perfectly conserved in orthologs from other yeast species. The regulatory domain has an amphiphilic character, and structural predictions indicate that it could fold back into the membrane bilayer. Remarkably, this domain has structural similarity to the channel forming loops B and E of Fps1p and other glycerol facilitators. Intragenic second-site suppressor mutations of the sensitivity to high osmolarity conferred by truncation of the regulatory domain caused diminished glycerol transport, confirming that elevated channel activity is the cause of the osmosensitive phenotype. Accumulation of osmolytes is a ubiquitous strategy of cellular osmoadaptation (1Somero G.N. Yancey P.H. Hoffmann J.F. Jamieson J.D. Handbook of Physiology, Section 14: Cell Physiology. Oxford University Press, Oxford, New York1997: 441-484Google Scholar). Cells produce or actively take up osmolytes in order to increase their solute content and thereby maintain turgor and volume under hypertonic conditions (high extracellular osmolarity). Upon shift to hypotonic conditions, i.e. when the extracellular osmolarity drops, cells export solutes to prevent excessive swelling or bursting in a process termed regulated volume decrease (2Kwon H.M. Handler J.S. Curr. Opin. Cell Biol. 1995; 7: 465-471Google Scholar). While proteins that mediate solute export from mammalian cells have not been identified yet, such channels have been described in bacteria and yeast (3Wood J.M. Microbiol. Mol. Biol. Rev. 1999; 63: 230-262Google Scholar, 4Wood J.M. Bremer E. Csonka L.N. Kraemer R. Poolman B. van der Heide T. Smith L.T. Comp Biochem. Physiol. A Mol. Integr. Physiol. 2001; 130: 437-460Google Scholar, 5Poolman B. Blount P. Folgering J.H.A. Friesen R.H.E. Moe P.C. van der Heide T. Mol. Microbiol. 2002; 44: 889-902Google Scholar, 6Hohmann S. Microbiol. Mol. Biol. Rev. 2002; 66: 300-372Google Scholar). The MscL channel from Escherichia coli has been particularly well studied, and the structural basis for gating by osmotic changes has been discussed in detail (5Poolman B. Blount P. Folgering J.H.A. Friesen R.H.E. Moe P.C. van der Heide T. Mol. Microbiol. 2002; 44: 889-902Google Scholar,7Biggin P.C. Sansom M.S. Curr. Biol. 2001; 11: R364-R366Google Scholar, 8Sukharev S. Betanzos M. Chiang C.S. Guy H.R. Nature. 2001; 409: 720-724Google Scholar, 9Perozo E. Cortes D.M. Sompornpisut P. Kloda A. Martinac B. Nature. 2002; 418: 942-948Google Scholar, 10Betanzos M. Chiang C.S. Guy H.R. Sukharev S. Nat. Struct. Biol. 2002; 9: 704-710Google Scholar, 11Perozo E. Kloda A. Cortes D.M. Martinac B. Nat. Struct. Biol. 2002; 9: 696-703Google Scholar). Proliferating yeast (Saccharomyces cerevisiae) cells employ glycerol as osmolyte, which they produce in two steps from the glycolytic intermediate dihydroxyacetonephosphate (12Brown A.D. Microbial water stress physiology. Principles and perspectives. J. Wiley and Sons Ltd., Chichester1990Google Scholar). We have previously demonstrated that Fps1p mediates export of glycerol across the yeast plasma membrane (13Van Aelst L. Hohmann S. Zimmermann F.K. Jans A.W. Thevelein J.M. EMBO J. 1991; 10: 2095-2104Google Scholar, 14Luyten K. Albertyn J. Skibbe W.F. Prior B.A. Ramos J. Thevelein J.M. Hohmann S. EMBO J. 1995; 14: 1360-1371Google Scholar, 15Tamás M.J. Luyten K. Sutherland F.C.W. Hernandez A. Albertyn J. Valadi H. Li H. Prior B.A. Kilian S.G. Ramos J. Gustafsson L. Thevelein J.M. Hohmann S. Mol. Microbiol. 1999; 31: 1087-1104Google Scholar, 16Tamás M.J. Rep M. Thevelein J.M. Hohmann S. FEBS Lett. 2000; 472: 159-165Google Scholar). Mutants lacking Fps1p are unable to rapidly export glycerol upon hypo-osmotic shock and only a fraction of such cells survive under these conditions (14Luyten K. Albertyn J. Skibbe W.F. Prior B.A. Ramos J. Thevelein J.M. Hohmann S. EMBO J. 1995; 14: 1360-1371Google Scholar, 15Tamás M.J. Luyten K. Sutherland F.C.W. Hernandez A. Albertyn J. Valadi H. Li H. Prior B.A. Kilian S.G. Ramos J. Gustafsson L. Thevelein J.M. Hohmann S. Mol. Microbiol. 1999; 31: 1087-1104Google Scholar). We have also provided evidence that transmembrane glycerol flux is regulated by osmotic changes. Glycerol flux is diminished within seconds after a shift to high osmolarity and it increases again at an apparently similar time scale when cells are shifted to low osmolarity (15Tamás M.J. Luyten K. Sutherland F.C.W. Hernandez A. Albertyn J. Valadi H. Li H. Prior B.A. Kilian S.G. Ramos J. Gustafsson L. Thevelein J.M. Hohmann S. Mol. Microbiol. 1999; 31: 1087-1104Google Scholar). The N-terminal extension of Fps1p appears to be required for controlling glycerol transport as its deletion renders the channel hyperactive. Yeast cells expressing such a hyperactive channel are sensitive to high osmolarity because they need much longer to build up high intracellular glycerol levels due to a higher level of glycerol leakage (15Tamás M.J. Luyten K. Sutherland F.C.W. Hernandez A. Albertyn J. Valadi H. Li H. Prior B.A. Kilian S.G. Ramos J. Gustafsson L. Thevelein J.M. Hohmann S. Mol. Microbiol. 1999; 31: 1087-1104Google Scholar). Fps1p belongs to the MIP 1The abbreviations used are: MIP, major intrinsic protein; MES, 4-morpholineethanesulfonic acid; TMD, transmembrane domain 1The abbreviations used are: MIP, major intrinsic protein; MES, 4-morpholineethanesulfonic acid; TMD, transmembrane domain(major intrinsic protein) family of channel proteins. Members of this ancient family have been identified in organisms ranging from Archea to human (17Borgnia M. Nielsen S. Engel A. Agre P. Annu. Rev. Biochem. 1999; 68: 425-458Google Scholar, 18Johansson I. Karlsson M. Johanson U. Larsson C. Kjellbom P. Biochim. Biophys. Acta. 2000; 1465: 324-342Google Scholar, 19Hohmann S. Kayingo G. Bill R.M. Prior B.A. Trends Microbiol. 2000; 8: 33-38Google Scholar, 20Hohmann S. Nielsen S. Agre P. Benos D.J. Simon S.A. Aquaporins, Current Topics in Membranes. Academic Press, San Diego, CA2001: 51Google Scholar). MIP channels comprise water channels (aquaporins) and glycerol facilitators (aquaglyceroporins) (17Borgnia M. Nielsen S. Engel A. Agre P. Annu. Rev. Biochem. 1999; 68: 425-458Google Scholar). Water channels are highly specific to water (17Borgnia M. Nielsen S. Engel A. Agre P. Annu. Rev. Biochem. 1999; 68: 425-458Google Scholar, 21de Groot B.L. Engel A. Grubmuller H. FEBS Lett. 2001; 504: 206-211Google Scholar, 22Sui H. Han B.G. Lee J.K. Walian P. Jap B.K. Nature. 2001; 414: 872-878Google Scholar), although transport of ions has also been reported (23Yasui M. Hazama A. Kwon T.H. Nielsen S. Guggino W.B. Agre P. Nature. 1999; 402: 184-187Google Scholar, 24Yool A.J. Weinstein A.M. News Physiol. Sci. 2002; 17: 68-72Google Scholar). Glycerol facilitators commonly transport small polyols and a range of other uncharged molecules (25Fu D. Libson A. Miercke L.J. Weitzman C. Nollert P. Krucinski J. Stroud R.M. Science. 2000; 290: 481-486Google Scholar), and apparently even metalloid ions (26Wysocki R. Chery C.C. Wawrzycka D. Van Hulle M. Cornelis R. Thevelein J.M. Tamás M.J. Mol. Microbiol. 2001; 40: 1391-1401Google Scholar, 27Tamás M.J. Wysocki R. Curr. Genet. 2001; 40: 2-12Google Scholar). The three-dimensional structure of human aquaporin AQP1 and of the E. coliglycerol facilitator GlpF have been determined (21de Groot B.L. Engel A. Grubmuller H. FEBS Lett. 2001; 504: 206-211Google Scholar, 22Sui H. Han B.G. Lee J.K. Walian P. Jap B.K. Nature. 2001; 414: 872-878Google Scholar, 25Fu D. Libson A. Miercke L.J. Weitzman C. Nollert P. Krucinski J. Stroud R.M. Science. 2000; 290: 481-486Google Scholar, 28Fujiyoshi Y. Mitsuoka K. de Groot B. Philippsen A. Grubmuller H. Agre P. Engel A. Curr. Opin. Struct. Biol. 2002; 12: 509-515Google Scholar). MIP channels consist of six transmembrane domains (TMDs) comprised of an internal repeat of three TMDs. Loops B and E form two half TMDs that interact within the membrane and are part of the selective pore. These two loops contain the canonical NPA (asparagine-proline-alanine) motifs that are part of the MIP channel signature sequence, which is conserved in almost all of the presently known 300 MIP channels (17Borgnia M. Nielsen S. Engel A. Agre P. Annu. Rev. Biochem. 1999; 68: 425-458Google Scholar, 29Heymann J.B. Engel A. J. Mol. Biol. 2000; 295: 1039-1053Google Scholar, 30Stahlberg H. Heymann B. Mitsuoka K. Fuyijoshi Y. Engel A. Hohmann S. Nielsen S. Agre P. Aquaporins. 51. Academic Press, San Diego2001: 39-119Google Scholar). Fps1p is an unusual MIP channel. The NPA motifs in loops B and E are replaced by NLA and NPS, respectively. This observation together with mutational analyses suggests that the channel architecture of Fps1p differs from that of other glycerol facilitators (31Bill R.M. Hedfalk K. Karlgren S. Mullins J.G. Rydström J. Hohmann S. J. Biol. Chem. 2001; 276: 36543-36549Google Scholar). In addition, Fps1p has unusually long N- and C-terminal extensions of 255 and 139 amino acids, respectively. These extensions have no obvious similarity to other proteins in the databases. In this study we identified a regulatory domain within the N-terminal extension. It is located close to the first TMD and restricts transmembrane glycerol flux both under high osmolarity and under normal growth conditions. The regulatory domain shows structural similarity to the channel forming loops B and E suggesting that it might itself dip into the membrane. We discuss implications for the mechanisms by which this domain could be involved in controlling channel function. The S. cerevisiaestrains used in this study were wild-type W303-1A (MATa leu2-3/112 ura3-1 trp1-1 his3-11/15 ade2-1 can1-100 GAL SUC2 mal0) (32Thomas B.J. Rothstein R.J. Cell. 1989; 56: 619-630Google Scholar) and an isogenic fps1Δ::HIS3 (YMT2). Yeast cells were routinely grown on a rotary shaker at 30 °C in YNB (yeast nitrogen base) medium (33Sherman F. Fink G.R. Hicks J.B. Methods in Yeast Genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1983Google Scholar) containing 2% glucose as a carbon source. Plate growth assays were performed by pregrowing cells either in medium without salt (for hyperosmotic shock) or in medium supplemented with 1m sorbitol (for hypo-osmotic shock). Cells were suspended in the same medium to an OD600 of 1.0. Five microliters of each dilution of 10-fold serial dilutions were spotted onto agar plates supplemented with 2% glucose and 0.8 m NaCl (hyperosmotic shock) or lacking osmoticum (hypo-osmotic shock). Growth was monitored after 2–3 days at 30 °C. YEpmyc-FPS1 is a 2μ LEU2 plasmid expressing a c-mycepitope-tagged Fps1p (15Tamás M.J. Luyten K. Sutherland F.C.W. Hernandez A. Albertyn J. Valadi H. Li H. Prior B.A. Kilian S.G. Ramos J. Gustafsson L. Thevelein J.M. Hohmann S. Mol. Microbiol. 1999; 31: 1087-1104Google Scholar). The FPS1 alleles containing larger truncations (constructs fps1-Δ6 tofps1-Δ11), pairwise amino acid replacements (constructsfps1-12 to fps1-24) or insertions/deletions (constructs fps1-25 to fps1-28) were constructed by completely amplifying YEpmyc-FPS1 except for the region to be deleted or altered (15Tamás M.J. Luyten K. Sutherland F.C.W. Hernandez A. Albertyn J. Valadi H. Li H. Prior B.A. Kilian S.G. Ramos J. Gustafsson L. Thevelein J.M. Hohmann S. Mol. Microbiol. 1999; 31: 1087-1104Google Scholar). The primers used contained either aSacII site (constructs fps1-Δ6 tofps1-Δ11) or a SpeI site (constructsfps1-12 to fps1-28) and three additional nucleotides at their 5′-end. Ligation results in the insertion of a proline and an arginine residue (SacII) or a threonine and a serine residue (SpeI) at the site of the deletion. All constructs were confirmed by sequencing. FPS1 alleles containing alanine or phenylalanine point mutations were constructed using the megaprimer polymerase method (34Sarkar G. Sommer S.S. BioTechniques. 1990; 8: 404-407Google Scholar) with YEpmyc-FPS1 as template and the mutagenesis and flanking (M5 and M6) primers listed in TableI. The resultant PCR products were co-transformed into S. cerevisiae with KpnI- andCspI-digested YEpmyc-FPS1. The resulting gap-repaired plasmids (35Muhlrad D. Hunter R. Parker R. Yeast. 1992; 8: 79-82Google Scholar) were propagated in E. coli TOP 10F′ and confirmed by sequencing. All other molecular biological manipulations were performed using standard techniques (36Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar).Table IPrimers used for mutagenesisName of primerSequence 5′–3′P222ACCCATTATGGTGAAGGCAAAGACATTATACCAGT224AATGGTGAAGCCAAAGGCATTATACCAGAACCCTL225ATGAAGCCAAAGACAGCATACCAGAACCCTCY226FGTGAAGCCAAAGACATTATTCCAGAACCCTCAAACACCTQ227ACAAAGACATTATACGCGAACCCTCAAACACN228AGACATTATACCAGGCCCCTCAAACACCTACP229ACCAAAGACATTATACCAGAACGCTCAAACACCTACAGTCQ230ATACCAGAACCCTGCAACACCTACAGTCTT231ATACCAGAACCCTCAAGCACCTACAGTCTTGCCCP232ACAGAACCCTCAAACAGCTACAGTCTTGCCCTCCT233ACAGAACCCTCAAACACCTGCAGTCTTGCCCTCCACAP236ACAAACACCTACAGTCTTGGCCTCCACATACCATCCAS237AACACCTACAGTCTTGCCCGCCACATACCATCCAT238ACCTACAGTCTTGCCCTCCGCATACCATCCAATTM5f.CCTACTCCCACGTATGTTCCAM6r.CAGGGGAAAACCTCTATACACC Open table in a new tab Intracellular glycerol levels were determined essentially as described previously (15Tamás M.J. Luyten K. Sutherland F.C.W. Hernandez A. Albertyn J. Valadi H. Li H. Prior B.A. Kilian S.G. Ramos J. Gustafsson L. Thevelein J.M. Hohmann S. Mol. Microbiol. 1999; 31: 1087-1104Google Scholar). To determine the proportion of produced glycerol that is retained, cells were grown in liquid YNB medium to an OD600 of 0.5–1.0, sedimented, and resuspended in medium containing 0.8 m NaCl, and samples were collected by filtration. To determine glycerol influx following its concentration gradient, cells were grown in liquid YNB medium to an OD600 of ∼2.0. Cells were harvested, washed, and suspended in ice-cold MES buffer (10 mm MES, pH 6.0) to a density of 40–60 mg of cells ml−1. Glycerol influx in the presence or absence of hyperosmotic stress was measured by adding glycerol to a final concentration of 100 mm “cold” glycerol plus 40 μm [14C]glycerol (160mCi/mmol; AmershamBiosciences) in a total volume of 250 μl (15Tamás M.J. Luyten K. Sutherland F.C.W. Hernandez A. Albertyn J. Valadi H. Li H. Prior B.A. Kilian S.G. Ramos J. Gustafsson L. Thevelein J.M. Hohmann S. Mol. Microbiol. 1999; 31: 1087-1104Google Scholar). Aliquots of 50 μl were collected by filtration and washed twice, and the radioactivity retained on the filters was determined. Filters with cells were dried at 80 °C overnight for dry weight determination. Transport experiments were performed in triplicate. Yeast membranes were prepared as previously described (15Tamás M.J. Luyten K. Sutherland F.C.W. Hernandez A. Albertyn J. Valadi H. Li H. Prior B.A. Kilian S.G. Ramos J. Gustafsson L. Thevelein J.M. Hohmann S. Mol. Microbiol. 1999; 31: 1087-1104Google Scholar). 10 μg of total protein were separated by SDS-PAGE and blotted onto nitrocellulose filters. The filters were probed with mouse monoclonal anti-c-myc (9E10, Santa Cruz Biotechnology) as primary antibody and alkaline phosphatase-conjugated anti-mouse IgG as secondary antibody. For detection, the membrane filters were incubated with 50 mg of 5-bromo-4-chloro-3-indolyl phosphate and 75 mg of nitroblue tetrazolium salts per ml. Protein was quantified using the method of Bradford (37Bradford M.M. Anal. Biochem. 1976; 72: 248-254Google Scholar) with bovine serum albumin as standard. Sequence alignments were carried out using ClustalW (38Thompson J.D. Higgins D.G. Gibson T.J. Nucleic Acids Res. 1994; 22: 4673-4680Google Scholar). Mean values for hydrophobicity were obtained as described (39Kyte J. Doolittle R.F. J. Mol. Biol. 1982; 157: 105-132Google Scholar, 40Eisenberg D. Schwarz E. Komaromy M. Wall R. J. Mol. Biol. 1984; 179: 125-142Google Scholar). Propensity for α and β conformation was predicted by a sliding window calculation of the cumulative index for three successive residues, using previously reported scales (41Deleage G. Roux B. Protein Eng. 1987; 1: 289-294Google Scholar). The models of the putative membrane dipping regions were generated by extraction of the Cα atom coordinates of loop B of E. coliGlpF from the Brookhaven Protein Data bank (PDB) file, 1FX8, using appropriate commands in RASMOL (42Sayle R.A. Milner-White E.J. Trends Biochem. Sci. 1995; 20: 374Google Scholar), followed by replacement with corresponding amino acid residues of the aligned Fps1p regulatory domain and construction of the loop using the MaxSprout algorithm (43Holm L. Sander C. J. Mol. Biol. 1991; 218: 183-194Google Scholar). Predicted secondary structure was corroborated by analysis of the modeled structures using TMAlpha (44Sarakinou K.S. Antoniw J.F. Togawa R.C. Mullins J.G.L. Biochem. Soc. Trans. 2001; 29 (36): A74Google Scholar). The predicted Fps1 protein consists of a hydrophilic N-terminal extension (amino acids 1–255), the core of six transmembrane domains (TMDs 1–6) with their connecting loops A–E (amino acids 256–530), and a hydrophilic C-terminal extension (amino acids 531–669) (13Van Aelst L. Hohmann S. Zimmermann F.K. Jans A.W. Thevelein J.M. EMBO J. 1991; 10: 2095-2104Google Scholar, 31Bill R.M. Hedfalk K. Karlgren S. Mullins J.G. Rydström J. Hohmann S. J. Biol. Chem. 2001; 276: 36543-36549Google Scholar). Previously we have shown that deletion of the N-terminal extension between positions 13 and 230 renders Fps1p hyperactive (15Tamás M.J. Luyten K. Sutherland F.C.W. Hernandez A. Albertyn J. Valadi H. Li H. Prior B.A. Kilian S.G. Ramos J. Gustafsson L. Thevelein J.M. Hohmann S. Mol. Microbiol. 1999; 31: 1087-1104Google Scholar). Deletion of residues 76–230 and 151–230 also increased transport through Fps1p while truncation upstream of position 145 did not cause any obvious effect. These data indicated that the segment important for control of Fps1p is located between positions 150 and 231 (15Tamás M.J. Luyten K. Sutherland F.C.W. Hernandez A. Albertyn J. Valadi H. Li H. Prior B.A. Kilian S.G. Ramos J. Gustafsson L. Thevelein J.M. Hohmann S. Mol. Microbiol. 1999; 31: 1087-1104Google Scholar). To define this regulatory domain in more detail we generated a further six deletions (Fig. 1 A). Those deletions were constructed in an FPS1 gene cloned under control of its own promoter into a multicopy plasmid and then expressed in an fps1Δ mutant. All constructs carried a C-terminal c-myc tag. By Western blot analysis of membrane preparations we confirmed that all constructs were expressed and that the gene products were located in fractions containing the plasma membrane (Fig.1 C). The amount of protein located in the plasma membrane seemed to differ between different alleles. Since we did not observe any correlation between the apparent amounts of membrane-localized Fps1p and functionality we assumed that the different protein levels did not affect the interpretation of the experiments. Similar observations were reported previously (31Bill R.M. Hedfalk K. Karlgren S. Mullins J.G. Rydström J. Hohmann S. J. Biol. Chem. 2001; 276: 36543-36549Google Scholar). For unknown reasons in some samples two bands appeared. Neither evidence for phosphorylation (15Tamás M.J. Luyten K. Sutherland F.C.W. Hernandez A. Albertyn J. Valadi H. Li H. Prior B.A. Kilian S.G. Ramos J. Gustafsson L. Thevelein J.M. Hohmann S. Mol. Microbiol. 1999; 31: 1087-1104Google Scholar) nor glycosylation 2K. Hedfalk, Roslyn M. Bill, J. Rydström, and S. Hohmann, unpublished data. of the protein, which could possibly explain the nature of the two bands, has been obtained so far. We then tested the functionality of the Fps1p constructs. Thefps1Δ mutant is sensitive to hypo-osmotic shock because it is unable to rapidly release accumulated glycerol (15Tamás M.J. Luyten K. Sutherland F.C.W. Hernandez A. Albertyn J. Valadi H. Li H. Prior B.A. Kilian S.G. Ramos J. Gustafsson L. Thevelein J.M. Hohmann S. Mol. Microbiol. 1999; 31: 1087-1104Google Scholar). In order to test if the constructs could complement the hypo-osmosensitivity of thefps1Δ mutant cells were pregrown in medium containing 1m sorbitol and then plated in serial dilutions on medium lacking sorbitol (Fig. 1 D). It appeared that all constructs could complement the hypo-osmosensitivity of the fps1Δmutant and hence encoded functional glycerol export channels located in the plasma membrane. To test if channel function was controlled normally we tested transformants for hyperosmosensitivity on plates with 0.8 mNaCl. Cells expressing FPS1 alleles 6–9 grew on high osmolarity plates like transformants carrying wild type FPS1(Fig. 1 B; see also left panel in Fig.1 D). This indicated efficient retention of glycerol produced by the cell and successful adaptation to high osmolarity and hence normal restriction of Fps1p-mediated glycerol export. The largest such truncation, FPS1-Δ9, lacks amino acids 13–215, which hence seemed to be dispensable for channel control. However, cells expressing constructs 10 and 11 grew only poorly on high osmolarity plates (Fig. 1, B and D), very much like we observed previously for cells expressing Fps1p lacking amino acids 13–230 (15Tamás M.J. Luyten K. Sutherland F.C.W. Hernandez A. Albertyn J. Valadi H. Li H. Prior B.A. Kilian S.G. Ramos J. Gustafsson L. Thevelein J.M. Hohmann S. Mol. Microbiol. 1999; 31: 1087-1104Google Scholar). The poor growth on high osmolarity plates was associated with a pronounced delay in building up high intracellular glycerol levels (data not shown). This is in line with previous observations with other N-terminal truncations (15Tamás M.J. Luyten K. Sutherland F.C.W. Hernandez A. Albertyn J. Valadi H. Li H. Prior B.A. Kilian S.G. Ramos J. Gustafsson L. Thevelein J.M. Hohmann S. Mol. Microbiol. 1999; 31: 1087-1104Google Scholar) and indicated an inability to restrict glycerol transport under hyperosmotic stress. Alleles 10 and 11 lack a segment immediately upstream of position 230 and the smallest truncation, FPS1-Δ11, lacks amino acids 217–230 but retains all 216 amino acids upstream. Hence, amino acids relevant for channel control are contained within the region covered by residues 217–230. All sequences upstream of this position seem to be dispensable for this control, and their function remains unknown for the moment. To further analyze this regulatory domain we scanned the sequence between 217 and 244 (except for residues Ser-237 and Thr-238) by pairwise replacement of amino acids with threonine and serine (Fig. 2). We chose this combination of amino acids because they are fairly neutral in their effect on secondary structure while we expected their insertion to affect the amphiphilic character of the region. All mutated genes were again expressed from the endogenous FPS1 promoter on a multicopy plasmid. The mutated proteins were detected in the plasma membrane fraction, they were all functional glycerol exporters as judged from their ability to complement the hypo-osmosensitivity of thefps1Δ mutant, and they grew like wild type on control plates lacking osmoticum (data not shown). Several of the mutations conferred strong osmosensitivity (Fig. 2); some did not have any effect at all while others resulted in intermediate sensitivity. Again, we interpret hyperosmosensitivity as an inability to restrict channel function under high osmolarity stress. Mutation of amino acids Pro-217, Ile-218, Met-219, Val-220 caused moderate osmosensitivity while mutation of the subsequent two amino acids caused strong osmosensitivity, indicative of a hyperactive channel. While exchange of amino acids 223 and 224 again did not seem to affect channel control, all mutations in the region 225–232 caused strong osmosensitivity, identifying this area as being of crucial importance. Note that 231 and 232 are threonine-proline and hence mutagenesis only changed Pro-232. Exchanges at positions 233–236 resulted in partial osmosensitivity suggesting that these residues also contribute to the function of the regulatory domain. Residues 233 and 234 are threonine-valine and hence mutagenesis only affected Val-234. Based on these observations we decided to focus further mutagenesis on the region between residues 222 and 238. We exchanged individual amino acids to alanine (with the exception of Tyr-226, which was replaced by phenylalanine) and expressed and analyzed the mutant alleles in the same way as described above. All mutated proteins were detected in the plasma membrane fraction, complemented the hypo-osmosensitivity of thefps1Δ mutant and grew like wild type on control plates without osmoticum (data not shown). We noted that the region between 217 and 244 contains a total of six proline residues, which could be of structural importance. Hence we first focused on the prolines in positions 222, 229, 232, and 236. Replacement of Pro-232 caused strong osmosensitivity, confirming the observation from the TS-scanning mutagenesis. However, replacement of Pro-222 had no effect. Since TS replacement of residues Lys-221 and Pro-222 caused strong osmosensitivity it appears that either Lys-221 is critical for channel control and/or that position Pro-222 tolerates alanine but not serine. Replacement of Pro-229 and Pro-236 caused moderate osmosensitivity, suggesting that the exchange with alanine affected channel control only to a certain extent. We further noted that the region under study contained phosphorylatable amino acids. Previous attempts to link different signaling pathways and protein kinases to channel control had not provided any evidence for a role of phosphorylation of Fps1p in channel regulation (15Tamás M.J. Luyten K. Sutherland F.C.W. Hernandez A. Albertyn J. Valadi H. Li H. Prior B.A. Kilian S.G. Ramos J. Gustafsson L. Thevelein J.M. Hohmann S. Mol. Microbiol. 1999; 31: 1087-1104Google Scholar) but could not exclude such a possibility. We replaced all four threonine residues and the serine residue by alanine and the tyrosine residue by phenylalanine. Only replacement of Thr-231 and Thr-233 caused intermediate or moderate osmosensitivity. These two residues immediately flank the critical Pro-232. Finally, replacement of residues Asn-228, Gln-230, and Leu-225 resulted in different degrees of osmosensitivity. Taken together, it appears that residues Leu-225, Asn-228, Gln-230, Thr-231, and Pro-232 are of particular importance for channel control. We then chose a subset of the mutants representing different types of mutations for a more detailed analysis of the effects on glycerol transport: the shortest truncation (Fig. 1) that caused osmosensitivity (FPS1-Δ11, residues 217–230), the longest truncation that did not cause osmosensitivity (FPS1-Δ9, residues 13–215) and alanine mutations (Fig. 3) that caused different degrees of osmosensitivity: L225A, N228A, T231A, and P232A. We observed that the alleles that conferred osmosensitivity could less well retain the glycerol they produced, suggesting that they had a higher capacity of glycerol transmembrane flux (data not shown). To monitor this effect more directly, we determined the influx of radiolabelled glycerol following its concentration gradient in unstressed cells and during the first minute after shifting cells to 0.8 m NaCl. The different transformants displayed very different profiles of glycerol influx (Fig.4; note that the two graphs have different scales). Truncation of the regulatory domain (FPS1-Δ11) as well as mutations of Thr-231 and Pro-232 caused the highest levels of glycerol influx while mutation of Leu-225 caused intermediately high glycerol influx. These data correlate well with the degree of sensitivity to 0.8 m NaCl of cells expressing the same alleles (Figs." @default.
W2093885105 created "2016-06-24" @default.
W2093885105 creator A5026938415 @default.
W2093885105 creator A5035778660 @default.
W2093885105 creator A5056057480 @default.
W2093885105 creator A5059686822 @default.
W2093885105 creator A5061796285 @default.
W2093885105 creator A5068258493 @default.
W2093885105 creator A5071924854 @default.
W2093885105 creator A5079347888 @default.
W2093885105 creator A5085722901 @default.
W2093885105 creator A5091204611 @default.
W2093885105 date "2003-02-01" @default.
W2093885105 modified "2023-10-10" @default.
W2093885105 title "A Short Regulatory Domain Restricts Glycerol Transport through Yeast Fps1p" @default.
W2093885105 cites W1504082382 @default.
W2093885105 cites W1508596864 @default.
W2093885105 cites W1550202981 @default.
W2093885105 cites W1580434367 @default.
W2093885105 cites W1622986665 @default.
W2093885105 cites W1968917541 @default.
W2093885105 cites W1975304761 @default.
W2093885105 cites W1975593876 @default.
W2093885105 cites W1986572128 @default.
W2093885105 cites W1987204795 @default.
W2093885105 cites W1990580982 @default.
W2093885105 cites W1992192666 @default.
W2093885105 cites W1999165043 @default.
W2093885105 cites W2008305695 @default.
W2093885105 cites W2015454830 @default.
W2093885105 cites W2019244478 @default.
W2093885105 cites W2019931636 @default.
W2093885105 cites W2026258231 @default.
W2093885105 cites W2026582002 @default.
W2093885105 cites W2038270621 @default.
W2093885105 cites W2048009063 @default.
W2093885105 cites W2053686704 @default.
W2093885105 cites W2061946066 @default.
W2093885105 cites W2063088501 @default.
W2093885105 cites W2068642950 @default.
W2093885105 cites W2075651068 @default.
W2093885105 cites W2078936885 @default.
W2093885105 cites W2092398899 @default.
W2093885105 cites W210226531 @default.
W2093885105 cites W2104223187 @default.
W2093885105 cites W2106882534 @default.
W2093885105 cites W2123642970 @default.
W2093885105 cites W2136288803 @default.
W2093885105 cites W2137178857 @default.
W2093885105 cites W2158944498 @default.
W2093885105 cites W2159100436 @default.
W2093885105 cites W2169600966 @default.
W2093885105 cites W2921162121 @default.
W2093885105 cites W4293247451 @default.
W2093885105 doi "https://doi.org/10.1074/jbc.m209792200" @default.
W2093885105 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/12486125" @default.
W2093885105 hasPublicationYear "2003" @default.
W2093885105 type Work @default.
W2093885105 sameAs 2093885105 @default.
W2093885105 citedByCount "90" @default.
W2093885105 countsByYear W20938851052012 @default.
W2093885105 countsByYear W20938851052013 @default.
W2093885105 countsByYear W20938851052014 @default.
W2093885105 countsByYear W20938851052015 @default.
W2093885105 countsByYear W20938851052016 @default.
W2093885105 countsByYear W20938851052017 @default.
W2093885105 countsByYear W20938851052018 @default.
W2093885105 countsByYear W20938851052019 @default.
W2093885105 countsByYear W20938851052020 @default.
W2093885105 countsByYear W20938851052021 @default.
W2093885105 countsByYear W20938851052022 @default.
W2093885105 crossrefType "journal-article" @default.
W2093885105 hasAuthorship W2093885105A5026938415 @default.
W2093885105 hasAuthorship W2093885105A5035778660 @default.
W2093885105 hasAuthorship W2093885105A5056057480 @default.
W2093885105 hasAuthorship W2093885105A5059686822 @default.
W2093885105 hasAuthorship W2093885105A5061796285 @default.
W2093885105 hasAuthorship W2093885105A5068258493 @default.
W2093885105 hasAuthorship W2093885105A5071924854 @default.
W2093885105 hasAuthorship W2093885105A5079347888 @default.
W2093885105 hasAuthorship W2093885105A5085722901 @default.
W2093885105 hasAuthorship W2093885105A5091204611 @default.
W2093885105 hasBestOaLocation W20938851051 @default.
W2093885105 hasConcept C134306372 @default.
W2093885105 hasConcept C185592680 @default.
W2093885105 hasConcept C2779222958 @default.
W2093885105 hasConcept C2780881558 @default.
W2093885105 hasConcept C33923547 @default.
W2093885105 hasConcept C36503486 @default.
W2093885105 hasConcept C55493867 @default.
W2093885105 hasConcept C86803240 @default.
W2093885105 hasConcept C95444343 @default.
W2093885105 hasConceptScore W2093885105C134306372 @default.
W2093885105 hasConceptScore W2093885105C185592680 @default.
W2093885105 hasConceptScore W2093885105C2779222958 @default.
W2093885105 hasConceptScore W2093885105C2780881558 @default.
W2093885105 hasConceptScore W2093885105C33923547 @default.
W2093885105 hasConceptScore W2093885105C36503486 @default.