FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2093912250> ?p ?o ?g. }

• W2093912250 endingPage "21731" @default.
• W2093912250 startingPage "21724" @default.
• W2093912250 abstract "A low level of UDP-Glc occurs in cells exposed to hypoxia or glucose starvation. This work reveals that a 65% reduction in the cellular UDP-Glc level causes up-regulation of the mitochondrial chaperone GRP75 and the endoplasmic reticulum (ER) resident chaperones GRP58, ERp72, GRP78, GRP94, GRP170, and calreticulin. Conditions that cause misfolding of proteins within the ER activate the transcription factors ATF6α/β and induce translation of the transcription factors XBP-1/TREB5 and ATF4/CREB2. These transcription factors induce the overexpression of ER chaperones and CHOP/GADD153. However, the 65% decrease in the cellular UDP-Glc level does not cause activation of ATF6α, splicing of XBP-1/TREB5, induction of ATF4/CREB2, or expression of CHOP/GADD153. The activity of the promoters of the ER chaperones is increased in UDP-Glcdeficient cells, but the activity of the CHOP/GADD153 promoter is not affected, in comparison with their respective activities in cells having compensated for the UDP-Glc deficiency. The results demonstrate that the unfolded protein response remains functionally intact in cells with a 65% decrease in the cellular UDP-Glc level and provide evidence that this decrease is a stress signal in mammalian cells, which triggers the coordinate overexpression of mitochondrial and ER chaperones, independently of the ER stress elements. A low level of UDP-Glc occurs in cells exposed to hypoxia or glucose starvation. This work reveals that a 65% reduction in the cellular UDP-Glc level causes up-regulation of the mitochondrial chaperone GRP75 and the endoplasmic reticulum (ER) resident chaperones GRP58, ERp72, GRP78, GRP94, GRP170, and calreticulin. Conditions that cause misfolding of proteins within the ER activate the transcription factors ATF6α/β and induce translation of the transcription factors XBP-1/TREB5 and ATF4/CREB2. These transcription factors induce the overexpression of ER chaperones and CHOP/GADD153. However, the 65% decrease in the cellular UDP-Glc level does not cause activation of ATF6α, splicing of XBP-1/TREB5, induction of ATF4/CREB2, or expression of CHOP/GADD153. The activity of the promoters of the ER chaperones is increased in UDP-Glcdeficient cells, but the activity of the CHOP/GADD153 promoter is not affected, in comparison with their respective activities in cells having compensated for the UDP-Glc deficiency. The results demonstrate that the unfolded protein response remains functionally intact in cells with a 65% decrease in the cellular UDP-Glc level and provide evidence that this decrease is a stress signal in mammalian cells, which triggers the coordinate overexpression of mitochondrial and ER chaperones, independently of the ER stress elements. The cellular response to stressful conditions includes metabolic adjustments and changes in gene expression. In mammalian cells the proteins most commonly overproduced in response to stress are molecular chaperones, which during normal cellular growth play essential roles in folding, oligomerization, and membrane translocation of newly synthesized polypeptides (1Morimoto R.I. Santoro M.G. Nature Biotech. 1998; 16: 833-838Crossref PubMed Scopus (505) Google Scholar, 2Kaufman R.J. Genes Dev. 1999; 13: 1211-1233Crossref PubMed Scopus (1912) Google Scholar). During stress, chaperones bind to misfolded polypeptides hence avoiding their aggregation and facilitating their repair (1Morimoto R.I. Santoro M.G. Nature Biotech. 1998; 16: 833-838Crossref PubMed Scopus (505) Google Scholar, 2Kaufman R.J. Genes Dev. 1999; 13: 1211-1233Crossref PubMed Scopus (1912) Google Scholar). Chaperones induced by heat shock, heavy metals, or exposure to amino acid analogues are termed heat shock proteins (HSPs) 1The abbreviations used are: HSPs, heat shock proteins; GRPs, glucose-regulated proteins; ORPs, oxygen-regulated proteins; ER, endoplasmic reticulum; ERSE, endoplasmic reticulum stress response element; UPR, unfolded protein response; ATF, activating transcription factor; XBP-1, X-box binding protein 1; UDPG:PP, UDP-Glc pyrophosphorylase; BiP, immunoglobulin-binding protein; CHOP/GADD153, C/EBP homologous protein/growth arrest and DNA damage 153; UPRE, unfolded protein response element; wt, wild type; CREB, cAMP-response element-binding protein. 1The abbreviations used are: HSPs, heat shock proteins; GRPs, glucose-regulated proteins; ORPs, oxygen-regulated proteins; ER, endoplasmic reticulum; ERSE, endoplasmic reticulum stress response element; UPR, unfolded protein response; ATF, activating transcription factor; XBP-1, X-box binding protein 1; UDPG:PP, UDP-Glc pyrophosphorylase; BiP, immunoglobulin-binding protein; CHOP/GADD153, C/EBP homologous protein/growth arrest and DNA damage 153; UPRE, unfolded protein response element; wt, wild type; CREB, cAMP-response element-binding protein. (1Morimoto R.I. Santoro M.G. Nature Biotech. 1998; 16: 833-838Crossref PubMed Scopus (505) Google Scholar). Another set of chaperones, overproduced upon exposure to glucose starvation or hypoxia, are termed glucose/oxygen-regulated proteins (GRPs/ORPs) (2Kaufman R.J. Genes Dev. 1999; 13: 1211-1233Crossref PubMed Scopus (1912) Google Scholar, 3Lee A.S. Trends Biochem. Sci. 2001; 26: 504-510Abstract Full Text Full Text PDF PubMed Scopus (914) Google Scholar). Several of the GRPs/ORPs are residents of the endoplasmic reticulum (ER), and their overproduction is induced through a signal transduction pathway referred to as the unfolded protein response (UPR) (4Mori K. Cell. 2000; 10: 451-454Abstract Full Text Full Text PDF Scopus (783) Google Scholar, 5Kaufman R.J. Scheuner D. Schröder M. Shen X. Lee K. Liu C.Y. Arnold S.M. Nature Mol. Cell. Biol. Rev. 2002; 3: 411-421Crossref PubMed Scopus (490) Google Scholar). This pathway is activated by exposure to conditions that cause accumulation of misfolded proteins within the ER, such as treatment with glycosylation inhibitors or substances that perturb the oxidative milieu or calcium homeostasis in the ER (4Mori K. Cell. 2000; 10: 451-454Abstract Full Text Full Text PDF Scopus (783) Google Scholar, 5Kaufman R.J. Scheuner D. Schröder M. Shen X. Lee K. Liu C.Y. Arnold S.M. Nature Mol. Cell. Biol. Rev. 2002; 3: 411-421Crossref PubMed Scopus (490) Google Scholar). The promoter region of the GRP genes possesses a cis-regulatory element, known as the ERSE (ER stress response element) (6Yoshida H. Haze K. Yanagi H. Yura T. Mori K. J. Biol. Chem. 1998; 273: 33741-33749Abstract Full Text Full Text PDF PubMed Scopus (995) Google Scholar), with the consensus sequence CCAATN9CCACG. This is recognized by the general transcription factor NF-Y/CBF on its CCAAT part and by the basic leucine zipper-type transcription factors ATF6α/β and XBP-1/TREB5 on its CCACG part (6Yoshida H. Haze K. Yanagi H. Yura T. Mori K. J. Biol. Chem. 1998; 273: 33741-33749Abstract Full Text Full Text PDF PubMed Scopus (995) Google Scholar, 7Yoshida H. Okada T. Haze K. Yanagi H. Yura T. Negishi M. Mori K. Mol. Cell. Biol. 2000; 20: 6755-6767Crossref PubMed Scopus (770) Google Scholar, 8Yoshida H. Okada T. Haze K. Yanagi H. Yura T. Negishi M. Mori K. Mol. Cell. Biol. 2001; 21: 1239-1248Crossref PubMed Scopus (257) Google Scholar). ATF6α/β are expressed constitutively as glycoproteins anchored in the ER membrane (9Haze K. Yoshida H. Yanagi H. Yura T. Mori K. Mol. Biol. Cell. 1999; 10: 3787-3799Crossref PubMed Scopus (1488) Google Scholar, 10Haze K. Okada T. Yoshida H. Yanagi H. Yura T. Negishi M. Mori K. Biochem. J. 2001; 355: 19-28Crossref PubMed Scopus (198) Google Scholar). Upon ER stress they undergo proteolysis, which releases their N-terminal fragments (p50ATF6α and p60ATF6β) that enter into the nucleus, dimerize, and bind to the promoters of the ER-resident GRP/ORP genes inducing their transcription (9Haze K. Yoshida H. Yanagi H. Yura T. Mori K. Mol. Biol. Cell. 1999; 10: 3787-3799Crossref PubMed Scopus (1488) Google Scholar, 10Haze K. Okada T. Yoshida H. Yanagi H. Yura T. Negishi M. Mori K. Biochem. J. 2001; 355: 19-28Crossref PubMed Scopus (198) Google Scholar). Proteolysis of ATF6 also induces transcription of the genes encoding the transcription factors XBP-1/TREB5 and CHOP/GADD153, the promoters of which contain ERSE sequences (7Yoshida H. Okada T. Haze K. Yanagi H. Yura T. Negishi M. Mori K. Mol. Cell. Biol. 2000; 20: 6755-6767Crossref PubMed Scopus (770) Google Scholar, 11Yoshida H. Matsui T. Yamamoto A. Okada T. Mori K. Cell. 2001; 107: 881-891Abstract Full Text Full Text PDF PubMed Scopus (2870) Google Scholar). Another response to the accumulation of misfolded proteins within the ER lumen is the dimerization and autophosphorylation of the ER transmembrane protein kinases IRE1α/β, which leads to activation of their endoribonuclease function (12Tirasophon W. Lee K. Callaghan B. Welihinda A. Kaufman R.J. Genes Dev. 2000; 14: 2725-2736Crossref PubMed Scopus (200) Google Scholar, 13Wang X.Z. Harding H.P. Zhang Y. Jolicoeur E.M. Kuroda M. Ron D. EMBO J. 1998; 17: 5708-5717Crossref PubMed Scopus (650) Google Scholar). The endoribonuclease activity of IRE1α/β is required to splice XBP-1/TREB5 mRNA resulting in the production of a potent transcriptional activator that enhances further the activity of its own promoter as well as those of the ER-resident GRPs/ORPs and CHOP/GADD153 (11Yoshida H. Matsui T. Yamamoto A. Okada T. Mori K. Cell. 2001; 107: 881-891Abstract Full Text Full Text PDF PubMed Scopus (2870) Google Scholar, 14Calfon M. Zeng H.Q. Urano F. Till J.H. Hubbard S.R. Harding H.P. Clark S.G. Ron D. Nature. 2002; 415: 92-96Crossref PubMed Scopus (2067) Google Scholar, 15Lee K. Tirasophon W. Shen X. Michalak M. Prywes R. Okada T. Yoshida H. Mori K. Kaufman R.J. Genes Dev. 2002; 16: 452-466Crossref PubMed Scopus (810) Google Scholar). Besides binding ERSE, the product encoded by the spliced XBP-1/TREB5 mRNA broadens the spectrum of genes induced by ER stress, as it also binds with high affinity to another regulatory site known as the unfolded protein response element (UPRE) with consensus sequence TGACGTG(G/A) (11Yoshida H. Matsui T. Yamamoto A. Okada T. Mori K. Cell. 2001; 107: 881-891Abstract Full Text Full Text PDF PubMed Scopus (2870) Google Scholar, 15Lee K. Tirasophon W. Shen X. Michalak M. Prywes R. Okada T. Yoshida H. Mori K. Kaufman R.J. Genes Dev. 2002; 16: 452-466Crossref PubMed Scopus (810) Google Scholar, 16Yoshida H. Matsui T. Hosokawa N. Kaufman R.J. Nagata K. Mori K. Dev. Cell. 2003; 4: 265-271Abstract Full Text Full Text PDF PubMed Scopus (553) Google Scholar, 17Wang Y. Shen J. Arenzana N. Tirasophon W. Kaufman R.J. Prywes R. J. Biol. Chem. 2000; 275: 27013-27020Abstract Full Text Full Text PDF PubMed Google Scholar). The activation of Ire1α/β and the splicing of the XBP-1/TREB5 mRNA are absolutely required for signaling through this transcription factor because overexpression of the product encoded by the unspliced XBP-1 mRNA cannot activate UPRE (15Lee K. Tirasophon W. Shen X. Michalak M. Prywes R. Okada T. Yoshida H. Mori K. Kaufman R.J. Genes Dev. 2002; 16: 452-466Crossref PubMed Scopus (810) Google Scholar). Accumulation of misfolded proteins within the ER lumen can also lead to a prompt activation of the ER transmembrane protein kinase PERK, which phosphorylates the α-subunit of eukaryotic translation initiation factor 2 (18Harding H.P. Zhang Y. Ron D. Nature. 1999; 397: 271-274Crossref PubMed Scopus (2457) Google Scholar). This results in a transient and general translational attenuation, which, however, is accompanied by an increased synthesis of ATF4/CREB2 (5Kaufman R.J. Scheuner D. Schröder M. Shen X. Lee K. Liu C.Y. Arnold S.M. Nature Mol. Cell. Biol. Rev. 2002; 3: 411-421Crossref PubMed Scopus (490) Google Scholar, 19Okada T. Yoshida H. Akazawa R. Negishi M. Mori K. Biochem. J. 2002; 366: 585-594Crossref PubMed Scopus (403) Google Scholar, 20Harding H.P. Novoa I. Zhang Y. Zeng H. Wek R. Schapira M. Ron D. Mol. Cell. 2000; 6: 1099-1108Abstract Full Text Full Text PDF PubMed Scopus (2350) Google Scholar). This transcription factor directly contributes to the transcriptional induction of the GRP78 and CHOP/GADD153 genes by binding to their promoters in a site different from ERSEs and UPRE (21Ma Y. Brewer J.W. Diehl J.A. Hendershot L.M. J. Mol. Biol. 2002; 318: 1351-1365Crossref PubMed Scopus (544) Google Scholar, 22Luo S. Baumeister P. Yang S. Abcower S.F. Lee A.S. J. Biol. Chem. 2003; 278: 37375-37385Abstract Full Text Full Text PDF PubMed Scopus (220) Google Scholar). UDP-Glc is a required precursor in the synthesis of the carbohydrate moiety of N-glycoproteins. Furthermore, it is required in the quality control of newly synthesized glycoproteins within the ER (23Flores-Díaz M. Alape-Girón A. Persson B. Pollesello P. Moos M. von Eichel-Streiber C. Thelestam M. Florin I. J. Biol. Chem. 1997; 272: 23784-23791Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar). A low level of UDP-Glc occurs in mammalian cells exposed to hypoxia or glucose starvation (for references see Ref. 23Flores-Díaz M. Alape-Girón A. Persson B. Pollesello P. Moos M. von Eichel-Streiber C. Thelestam M. Florin I. J. Biol. Chem. 1997; 272: 23784-23791Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar). In Escherichia coli a low UDP-Glc level seems to be a signal that induces the expression of a set of stress proteins required for survival under adverse conditions (24Bohringer J. Fischer D. Mosler G. Hengee-Aronis R. J. Bacteriol. 1995; 177: 413-432Crossref PubMed Google Scholar). Similarly, in plant cells a low UDP-Glc level due to hypoxia or sugar starvation induced the synthesis of at least one stress protein (25Maas C. Schaal S. Werr W. EMBO J. 1990; 9: 3447-3452Crossref PubMed Scopus (91) Google Scholar). However, whether a low UDP-Glc level is a stress signal in mammalian cells has not yet been determined. We previously isolated a Chinese hamster mutant cell line, Don Q, having a permanent low level of UDP-Glc because of a recessive point mutation affecting the UDP-Glc pyrophosphorylase gene (UDPG:PP) (23Flores-Díaz M. Alape-Girón A. Persson B. Pollesello P. Moos M. von Eichel-Streiber C. Thelestam M. Florin I. J. Biol. Chem. 1997; 272: 23784-23791Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar). From Don Q we isolated a spontaneous revertant cell, Don QR, in which the mutation was reverted in one allele, partially compensating for the UDP-Glc deficiency (23Flores-Díaz M. Alape-Girón A. Persson B. Pollesello P. Moos M. von Eichel-Streiber C. Thelestam M. Florin I. J. Biol. Chem. 1997; 272: 23784-23791Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar). These cells provide a unique opportunity to investigate how mammalian cells are affected by fluctuations in the cellular UDP-Glc content. In this work we used them as a model system to determine whether a decrease in the cellular UDP-Glc level induces up-regulation of stress proteins. Materials—The Chinese hamster lung fibroblasts of the cell line Don, referred to here as Don wt, were from ATCC (CCL 16). The UDP-Glc-deficient mutant cell, referred to here as Don Q, and the spontaneous revertant, referred to here as Don QR, and the transfectant clones QC, B9, and G3 were previously isolated (23Flores-Díaz M. Alape-Girón A. Persson B. Pollesello P. Moos M. von Eichel-Streiber C. Thelestam M. Florin I. J. Biol. Chem. 1997; 272: 23784-23791Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar, 26Flores-Díaz M. Alape-Girón A. Titball R.W. Moos M. Guillouard I. Cole S. Howells A.M. von Eichel-Streiber C. Florin I. Thelestam M. J. Biol. Chem. 1998; 273: 24433-24438Abstract Full Text Full Text PDF PubMed Scopus (32) Google Scholar). Chemicals were from Sigma unless otherwise stated. Lipofectin, LipofectAMINE 2000, cell culture media, and supplements were from Invitrogen. Pharmalytes® were from Amersham Biosciences and all other electrophoresis reagents were from Bio-Rad. Protein sequencing reagents were from Applied Biosystems. Enzymes for molecular biology were from Fermentas AB (Graciuno, Lithuania). Polyclonal antibodies against GRP58/endoplasmic reticulum protein 57 (ERp57), ERp72/calcium-binding protein 2 (CaBP2), GRP94/ERp99/endoplasmin, GRP170/oxygen-regulated protein 150 (ORP150), the ER-resident peptidyl-prolyl cis-trans isomerase cyclophilin 2 (CPH2), the UDP-Glc:glycoprotein glucosyltransferase, and calreticulin were kindly provided by Drs. M. Kito (University of Kyoto), D. Ferrari (Georg-August Universität), P. Csermely (Semmelweis University), J. R. Subjeck (State University of New York College), G. Stucliffe (Research Institute of Scripps Clinic), A. J. Parodi (Instituto de Investigaciones Fundación Campomar), and M. Michalak (University of Alberta), respectively. Polyclonal antibodies against ATF6 were produced and purified as described (7Yoshida H. Okada T. Haze K. Yanagi H. Yura T. Negishi M. Mori K. Mol. Cell. Biol. 2000; 20: 6755-6767Crossref PubMed Scopus (770) Google Scholar); the monoclonal antibody JG1 against GRP75/peptide-binding protein 74 (PBP74)/mortalin (27Green J.M. Gu L. Ifkovits C. Kaumaya P.T.P. Conrad S. Pierce S. Hybridoma. 1995; 14: 347-353Crossref PubMed Scopus (10) Google Scholar) was kindly provided by Dr. S. Pierce (Northwestern University, Chicago, IL); polyclonal antibodies against GRP78/immunoglobulin-binding protein (BiP)/ORP80, and protein-disulfide isomerase were from Affinity Bioreagents Inc., against C/EBP homologous protein/growth arrest and DNA damage 153 (CHOP/GADD153) and ATF4/CREB2 were from Santa Cruz Biotechnology, Inc. (Santa, Cruz, CA), against HSP60, HSP25, and heme oxygenase 1/HSP32 were from Stressgene Biotechnologies Corp. (Victoria, Canada), as well as the monoclonal antibody SPA-815 against a cytosolic HSP70. Secondary antibodies conjugated to horseradish peroxidase were from Dako A/S (Glostrup, Denmark). Two-dimensional Polyacrylamide Gel Electrophoresis, N-terminal Sequencing, and Western Blot Analyses—Cells were cultivated at 37 °C in Eagle's minimum essential medium supplemented with 10% fetal bovine serum, 5 mml-glutamine, penicillin (100 units/ml), and streptomycin (100 μg/ml) in a humid atmosphere containing 5% CO2. Proteins in cell lysates were analyzed by two-dimensional gel electrophoresis (isoelectric focusing using pH 3–10 Pharmalytes® followed by SDS-PAGE in 7.5–20% (w/v) gradient gels) and visualized by staining with Coomassie Brilliant Blue. Each cell line was analyzed at least seven times. N-terminal sequence analysis of proteins separated on two-dimensional gels (28Bergman T. Jörnvall H. Eur. J. Biochem. 1987; 169: 9-12Crossref PubMed Scopus (73) Google Scholar, 29Matsudaira P. J. Biol. Chem. 1987; 262: 10035-10038Abstract Full Text PDF PubMed Google Scholar) was performed using Applied Biosystems 470A or 477A instruments. Homology searches in SwissProt were done using BLAST. For induction of the UPR, cells were treated with 7 μg/ml tunicamycin for 3–24 h before harvesting. Cell lysates (30 μg of protein/lane) were subjected to electrophoresis under reducing conditions on a 10% (w/v) SDS-polyacrylamide gel, electroblotted onto 0.45-μm nitrocellulose membranes, and subjected to Western blot analyses as described (23Flores-Díaz M. Alape-Girón A. Persson B. Pollesello P. Moos M. von Eichel-Streiber C. Thelestam M. Florin I. J. Biol. Chem. 1997; 272: 23784-23791Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar). Immunoreactive bands were detected and quantified with a densitometer using ImageQuant (Amersham Biosciences). Each immunoblot analysis was repeated 2–4 times with similar results. 1H NMR Spectroscopy—Cell metabolites were extracted from confluent monolayers of 75-cm2 culture flasks of each cell line using a dual-phase extraction method (20Harding H.P. Novoa I. Zhang Y. Zeng H. Wek R. Schapira M. Ron D. Mol. Cell. 2000; 6: 1099-1108Abstract Full Text Full Text PDF PubMed Scopus (2350) Google Scholar). The methanol/water phase was freeze-dried and resuspended in a buffer with 8 mm Na2HPO4 and 2 mm KH2PO4, pH 7.2 (prepared with D2O). Spectra were acquired, and adenine nucleotides and UDP-Glc were quantified as described (23Flores-Díaz M. Alape-Girón A. Persson B. Pollesello P. Moos M. von Eichel-Streiber C. Thelestam M. Florin I. J. Biol. Chem. 1997; 272: 23784-23791Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar, 30Pollesello P. Eriksson O. Vittur F. Paoletti S. Geimonen E. Toffanin R. NMR Biomed. 1995; 8: 190-196Crossref PubMed Scopus (11) Google Scholar). The measurements were performed at least three times for each cell line. Plasmids and Luciferase Assays—A 311-bp fragment of the human GRP78 promoter (–304 to +7 region; numbers indicate nucleotide positions relative to the transcription start site), a 397-bp fragment of the human GRP94 promoter (–363 to +34 region), a 1099-bp fragment of the human GRP58 promoter (–1081 to +18 region), a 511-bp fragment of the human calreticulin promoter (–459 to +52 region), a 668-bp fragment of the murine ERp72 promoter (–647 to +21 region), a 887-bp fragment of the human CHOP promoter (–870 to +17 region), and a 459-bp fragment of the XBP-1 promoter (–330 to +129 region) were amplified by polymerase chain reaction and cloned immediately upstream of the luciferase coding sequence of the pGL3-basic vector (Promega), as described (6Yoshida H. Haze K. Yanagi H. Yura T. Mori K. J. Biol. Chem. 1998; 273: 33741-33749Abstract Full Text Full Text PDF PubMed Scopus (995) Google Scholar, 7Yoshida H. Okada T. Haze K. Yanagi H. Yura T. Negishi M. Mori K. Mol. Cell. Biol. 2000; 20: 6755-6767Crossref PubMed Scopus (770) Google Scholar). Mutants of the GRP78, GRP94, and calreticulin promoters with disrupted ERSE sequences were prepared by site-directed mutagenesis as described (6Yoshida H. Haze K. Yanagi H. Yura T. Mori K. J. Biol. Chem. 1998; 273: 33741-33749Abstract Full Text Full Text PDF PubMed Scopus (995) Google Scholar). ERSE1, ERSE2, and ERSE3 of the GRP78 promoter, ERSE1 and ARSE3 of the GRP94 promoter, and ERSE2 and ERSE3 of the calreticulin promoter were disrupted by mutating their sequences to gatcTN9aacat, CtcgaN9aacac, gagcTN9aacgc, atgttN9Agctc, gatcTN9aacat, agctcN9aactc, and atgttN9Agatc, respectively (where lowercase letters indicate mutated nucleotides). Mutated promoters were cloned in the pGL3-basic vector (Promega), as described (6Yoshida H. Haze K. Yanagi H. Yura T. Mori K. J. Biol. Chem. 1998; 273: 33741-33749Abstract Full Text Full Text PDF PubMed Scopus (995) Google Scholar). A reporter plasmid containing a 1288-bp fragment of the human ORP150 gene (–332 to +956 region) cloned in the pGL3-basic vector (31Kaneda S. Yura T. Yanagi H. J. Biochem. (Tokyo). 2000; 128: 529-538Crossref PubMed Scopus (32) Google Scholar) was kindly provided by Dr. H. Yanagi (HSP Research Institute, Kyoto, Japan). The reporter plasmid p5XUPREGL3 containing five repeats of the oligonucleotide CTCGAGACAGGTGCTGACGTGGCATTC cloned into pOFLuc-GL3 in front of the c-fos minimal promoter and the firefly luciferase gene (17Wang Y. Shen J. Arenzana N. Tirasophon W. Kaufman R.J. Prywes R. J. Biol. Chem. 2000; 275: 27013-27020Abstract Full Text Full Text PDF PubMed Google Scholar) was kindly provided by Dr. R. Prywes (Columbia University, New York). The reporter plasmids –457/LUC and –457(mut)/LUC containing the rat GRP78 wild type promoter and the modified version with the mutated ATF/CRE site, respectively (22Luo S. Baumeister P. Yang S. Abcower S.F. Lee A.S. J. Biol. Chem. 2003; 278: 37375-37385Abstract Full Text Full Text PDF PubMed Scopus (220) Google Scholar), were kindly provided by Prof. A. Lee (University of Southern California, Los Angeles, CA). The expression plasmid encoding a dominant negative mutant of the A subunit of the transcription factor NF-Y (32Mantovani R. Li X.Y. Pessara U. Hooft van Huisjduijnen R. Benoist C. Mathis D. J. Biol. Chem. 1994; 269: 20340-20346Abstract Full Text PDF PubMed Google Scholar) was kindly provided by Dr. M. Pitarque (Karolinska Institute). The expression plasmids pCGNATF6-(1–373), encoding the wild type cytoplasmic region of the human ATF6α, and pCGNATF6-(1–373)m1, encoding a mutant version of this protein harboring a replacement of amino acids 315–317 from KNR to TAA and lacking DNA binding activity (17Wang Y. Shen J. Arenzana N. Tirasophon W. Kaufman R.J. Prywes R. J. Biol. Chem. 2000; 275: 27013-27020Abstract Full Text Full Text PDF PubMed Google Scholar), were kindly provided by Dr. R. Prywes. The reference plasmid pRL-SV40, which carries the Renilla luciferase gene under the control of the SV40 enhancer and promoter, was from Promega. Cells cultured in 48-well plates were cotransfected with reporter plasmids (1 μg) carrying the firefly luciferase gene, the reference plasmid pRL-SV40 (0.05 μg), and without or with an expression plasmid (3 μg) using LipofectAMINE 2000. Cells were incubated with 100 ml of the lipid-DNA complex in Opti-MEM at 37 °C for 5 h and then incubated in supplemented Eagle's minimum essential medium at 37 °C for 24 h. Cells were then lysed in 200 μl of passive lysis buffer (Promega) and firefly, as well as Renilla, luciferase activity was measured with 5 μl of the cell lysate by using the dual luciferase reporter assay system (Promega) and a TD2020 luminometer (Turner Designs, Sunnyvale, CA). Assessment of XBP-1 Splicing—Total RNA from QC, B9, and G3 cells treated with or without tunicamycin (10 μg/ml, 20 h) was isolated using the SV total RNA isolation system (Promega), and XBP-1 RNA splicing was assessed by semi-quantitative reverse transcriptase-PCR (33Vondracek M. Weaver D.A. Sarang Z. Hedberg J.J. Willey J.C. Wärngard L. Grafström R.C. Int. J. Cancer. 2002; 99: 776-782Crossref PubMed Scopus (38) Google Scholar) using the following primers: β-actin-192, 5′-GATTCCTATGTGGGCGACGAG-3′; β-actin-704, 5′-CCATCTCTTGCTCGAAGTCC-3′; XBP-(1–354), 5′-CCTTGTGGTTGAGAACCAGG-3′; unspliced XBP-(1–804), 5′-CTAGAGGCTTGGTGTATAC-3′; spliced XBP-(1–1150), 5′-CGAATTCTTAGACACTAATCAGC-3′. The amplified fragments were then subjected to electrophoresis on a 3% NuSieve 1% Sea Kem-agarose gel, followed by ethidium bromide staining and densitometric quantification of band intensities. A Cellular UDP-Glc Deficiency Is Associated with Overproduction of a Specific Set of Stress Proteins—To determine whether the mutant Don Q has any specific changes in the cellular protein pattern, whole cell lysates of Don wt, the mutant Don Q, and the revertant QR were analyzed by two-dimensional gel electrophoresis (Fig. 1). Several protein spots were consistently detected in higher amounts in Don Q than in Don wt and QR cell lysates. The molecular masses of the four most conspicuously overproduced proteins were ∼59, 62, 70, and 74 kDa, and their isoelectric points were 7, 4.5, 6, and 5, respectively. These four overproduced proteins were identified by their N-terminal amino acid sequences as GRP58/ERp61/ERp57 (34Ferrari D.M. Söling H.-D. Biochem. J. 1999; 339: 1-10Crossref PubMed Scopus (432) Google Scholar), calreticulin (35Michalak M. Corbett E.F. Mesaeli N. Nakamura K. Opas M. Biochem. J. 1999; 344: 281-292Crossref PubMed Scopus (661) Google Scholar), GRP75/PBP74/mortalin (36Singh B. Soltys B.J. Wu Z.C. Patel H.V. Freeman K.B. Gupta R.S. Exp. Cell Res. 1997; 234: 205-216Crossref PubMed Scopus (48) Google Scholar), and GRP78/BiP/ORP80 (37Roll D.E. Murphy B.J. Laderoute K.R. Sutherland R.M. Smith H.C. Mol. Cell. Biochem. 1991; 103: 141-148Crossref PubMed Scopus (43) Google Scholar), respectively (Table I). Western blot experiments further confirmed the identity of the overproduced proteins and showed that they occur in about 3 times higher relative amounts in Don Q than in Don wt and QR cells (Fig. 2). Because three of these proteins belong to the ER-resident stress-inducible GRPs/ORPs, additional Western blot analyses were performed with antibodies against other members of this protein family: ERp72/CaBP2 (34Ferrari D.M. Söling H.-D. Biochem. J. 1999; 339: 1-10Crossref PubMed Scopus (432) Google Scholar), GRP94/ERp99/endoplasmin (3Lee A.S. Trends Biochem. Sci. 2001; 26: 504-510Abstract Full Text Full Text PDF PubMed Scopus (914) Google Scholar), and GRP170/ORP150 (31Kaneda S. Yura T. Yanagi H. J. Biochem. (Tokyo). 2000; 128: 529-538Crossref PubMed Scopus (32) Google Scholar). The relative amounts of these proteins were also about 3–4 times higher in Don Q than in the Don wt and QR cells (Fig. 2).Table IN-terminal sequence alignments of proteins overproduced in Don Q cells.Protein nameN-terminal sequencep59DVLELTDENFESRVS-GRP58 (rat, murine)DVLELTDENFESRVS-p62EPAVYFEQQFVDG-Calreticulin (human)EPAVYFKEQFLDG-Calreticulin (bovine, canine)EPAIYFKEQFLDG-p70ASEAIKGAVVGIDLG-GRP75 (hamster, human, murine)ASEAIKGAVVGIDLG-p74EEEDKKEDVGTVVGI-GRP78 (hamster, rat, human, murine, equine)EEEDKKEDVGTVVGI- Open table in a new tab Fig. 2UDP-Glc-deficient cells overproduce GRPs/ORPs and CRT. Cell lysates of Don wt, Q, and QR cells were subjected to Western blot analysis using antibodies against the indicated proteins as described under “Experimental Procedures.”View Large Image Figure ViewerDownload (PPT) However, other stress-inducible proteins, such as the cytosolic HSP70 and HSP25 and the mitochondrial HSP60 were found in comparable amounts in the three cell lines (Fig. 2). Furthermore, the protein-disulfide isomerase, the UDP-Glc: glycoprotein glucosyltransferase, the peptidyl-prolyl cis-trans isomerase CPH2, and the antioxidant enzyme heme oxygenase 1/HSP32, which are overproduced when there is an accumulation of misfolded proteins in the ER (2Kaufman R.J. Genes Dev. 1999; 13: 1211-1233Crossref PubMed Scopus (1912) Google Scholar), were also found in similar amounts in Don wt, Q, and QR according to Western blot analysis (Fig. 2). Thus, in Don Q onl" @default.
• W2093912250 created "2016-06-24" @default.
• W2093912250 creator A5001889133 @default.
• W2093912250 creator A5024825620 @default.
• W2093912250 creator A5026891781 @default.
• W2093912250 creator A5031406923 @default.
• W2093912250 creator A5032946611 @default.
• W2093912250 creator A5054613513 @default.
• W2093912250 creator A5082409880 @default.
• W2093912250 creator A5085729322 @default.
• W2093912250 creator A5091346393 @default.
• W2093912250 date "2004-05-01" @default.
• W2093912250 modified "2023-10-16" @default.
• W2093912250 title "A Cellular UDP-glucose Deficiency Causes Overexpression of Glucose/Oxygen-regulated Proteins Independent of the Endoplasmic Reticulum Stress Elements" @default.
• W2093912250 cites W1481310511 @default.
• W2093912250 cites W1501535278 @default.
• W2093912250 cites W1905806846 @default.
• W2093912250 cites W1932052686 @default.
• W2093912250 cites W1963943602 @default.
• W2093912250 cites W1967099091 @default.
• W2093912250 cites W1967827663 @default.
• W2093912250 cites W1969809609 @default.
• W2093912250 cites W1970090817 @default.
• W2093912250 cites W1972492618 @default.
• W2093912250 cites W1973335387 @default.
• W2093912250 cites W1974767771 @default.
• W2093912250 cites W1978092165 @default.
• W2093912250 cites W1979164049 @default.
• W2093912250 cites W1986737010 @default.
• W2093912250 cites W1988501179 @default.
• W2093912250 cites W2001609208 @default.
• W2093912250 cites W2003666655 @default.
• W2093912250 cites W2005145242 @default.
• W2093912250 cites W2007456673 @default.
• W2093912250 cites W2012947266 @default.
• W2093912250 cites W2019424220 @default.
• W2093912250 cites W2025518316 @default.
• W2093912250 cites W2028279477 @default.
• W2093912250 cites W2028509040 @default.
• W2093912250 cites W2029642537 @default.
• W2093912250 cites W2030138800 @default.
• W2093912250 cites W2031418855 @default.
• W2093912250 cites W2034213169 @default.
• W2093912250 cites W2035623537 @default.
• W2093912250 cites W2035826038 @default.
• W2093912250 cites W2036677133 @default.
• W2093912250 cites W2039379491 @default.
• W2093912250 cites W2048048466 @default.
• W2093912250 cites W2049876394 @default.
• W2093912250 cites W2060662477 @default.
• W2093912250 cites W2062994425 @default.
• W2093912250 cites W2063826476 @default.
• W2093912250 cites W2065989978 @default.
• W2093912250 cites W2067701929 @default.
• W2093912250 cites W2068992341 @default.
• W2093912250 cites W2071273959 @default.
• W2093912250 cites W2077416030 @default.
• W2093912250 cites W2079919750 @default.
• W2093912250 cites W2080901528 @default.
• W2093912250 cites W2086941505 @default.
• W2093912250 cites W2097511933 @default.
• W2093912250 cites W2099317703 @default.
• W2093912250 cites W2100347985 @default.
• W2093912250 cites W2100782151 @default.
• W2093912250 cites W2102223391 @default.
• W2093912250 cites W2104790095 @default.
• W2093912250 cites W2106314483 @default.
• W2093912250 cites W2107601804 @default.
• W2093912250 cites W2117573196 @default.
• W2093912250 cites W2119533537 @default.
• W2093912250 cites W2120736516 @default.
• W2093912250 cites W2127848114 @default.
• W2093912250 cites W2127906377 @default.
• W2093912250 cites W2142384246 @default.
• W2093912250 cites W2144065739 @default.
• W2093912250 cites W2144983282 @default.
• W2093912250 cites W2152398979 @default.
• W2093912250 cites W2155884826 @default.
• W2093912250 cites W2162076197 @default.
• W2093912250 cites W2341701597 @default.
• W2093912250 cites W4238261567 @default.
• W2093912250 cites W4245305755 @default.
• W2093912250 cites W4255402093 @default.
• W2093912250 doi "https://doi.org/10.1074/jbc.m312791200" @default.
• W2093912250 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/15020602" @default.
• W2093912250 hasPublicationYear "2004" @default.
• W2093912250 type Work @default.
• W2093912250 sameAs 2093912250 @default.
• W2093912250 citedByCount "44" @default.
• W2093912250 countsByYear W20939122502012 @default.
• W2093912250 countsByYear W20939122502013 @default.
• W2093912250 countsByYear W20939122502014 @default.
• W2093912250 countsByYear W20939122502015 @default.
• W2093912250 countsByYear W20939122502016 @default.
• W2093912250 countsByYear W20939122502018 @default.
• W2093912250 countsByYear W20939122502019 @default.
• W2093912250 countsByYear W20939122502020 @default.
• W2093912250 countsByYear W20939122502022 @default.

• next