FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2094687612> ?p ?o ?g. }

• W2094687612 endingPage "22339" @default.
• W2094687612 startingPage "22334" @default.
• W2094687612 abstract "In Saccharomyces cerevisiae, the low molecular weight acyl carrier protein (ACP) of mitochondrial type II fatty acid synthase (FAS) and the cytoplasmic type I FAS multienzyme contain 4′-phosphopantetheine as a prosthetic group. Sequence alignment studies with the recently isolated phosphopantetheine:protein transferase (PPTase), Ppt1p, from Brevibacterium ammoniagenes revealed the yeast open reading frame, YPL148C, as a potential PPTase gene (25% identical and 43% conserved amino acids). In accordance with this similarity, pantetheinylation of mitochondrial ACP was lost upon disruption of YPL148C. In contrast, biosynthesis of cytoplasmic holo-FAS remained unaffected by this mutation. According to these characteristics, the newly identified gene was designated asPPT2. Similar to ACP null mutants, cellular lipoic acid synthesis and, hence, respiration were abolished in PPT2deletants. ACP pantetheinylation, lipoic acid synthesis, and respiratory competence were restored upon transformation ofPPT2 mutants with cloned PPT2 DNA. In vitro, holo-ACP synthesis was achieved by incubating apo-ACP with coenzyme A in the presence of purified Ppt2p. The homologous yeast enzyme could be replaced, in this assay, by the ACP synthase (EC2.7.8.7) of Escherichia coli but not by the type I FAS-specific PPTase of B. ammoniagenes, Ppt1p. These results conform with the inability of Ppt2p to activate the cytoplasmic type I FAS complex of yeast. In Saccharomyces cerevisiae, the low molecular weight acyl carrier protein (ACP) of mitochondrial type II fatty acid synthase (FAS) and the cytoplasmic type I FAS multienzyme contain 4′-phosphopantetheine as a prosthetic group. Sequence alignment studies with the recently isolated phosphopantetheine:protein transferase (PPTase), Ppt1p, from Brevibacterium ammoniagenes revealed the yeast open reading frame, YPL148C, as a potential PPTase gene (25% identical and 43% conserved amino acids). In accordance with this similarity, pantetheinylation of mitochondrial ACP was lost upon disruption of YPL148C. In contrast, biosynthesis of cytoplasmic holo-FAS remained unaffected by this mutation. According to these characteristics, the newly identified gene was designated asPPT2. Similar to ACP null mutants, cellular lipoic acid synthesis and, hence, respiration were abolished in PPT2deletants. ACP pantetheinylation, lipoic acid synthesis, and respiratory competence were restored upon transformation ofPPT2 mutants with cloned PPT2 DNA. In vitro, holo-ACP synthesis was achieved by incubating apo-ACP with coenzyme A in the presence of purified Ppt2p. The homologous yeast enzyme could be replaced, in this assay, by the ACP synthase (EC2.7.8.7) of Escherichia coli but not by the type I FAS-specific PPTase of B. ammoniagenes, Ppt1p. These results conform with the inability of Ppt2p to activate the cytoplasmic type I FAS complex of yeast. 4′-Phosphopantetheine serves as a prosthetic group in a variety of enzyme systems such as fatty acid synthases (1Lynen F. Eur. J. Biochem. 1980; 112: 431-442Crossref PubMed Scopus (131) Google Scholar, 2Schweizer E. Naturwissenschaften. 1996; 83: 347-358PubMed Google Scholar), most polyketide synthases (3Hopwood D.A. Sherman D.H. Annu. Rev. Genet. 1990; 24: 37-66Crossref PubMed Google Scholar) and several non-ribosomal polypeptide synthetases (4Kleinkauf H. von Döhren H. Eur. J. Biochem. 1996; 236: 335-351Crossref PubMed Scopus (284) Google Scholar). Similar to the chemically related soluble cofactor, coenzyme A, protein-bound phosphopantetheine fulfills in these enzymes a dual function, i.e. activation of acyl groups by thioester linkage to the terminal sulfhydryl, and acting as a flexible arm allowing translocation of intermediates between different catalytic sites. Apart from complex polycondensation systems, it is suggested that, in yeast, enzyme-bound phosphopantetheine is also involved in a single metabolic reaction, the reduction of α-amino-adipate to the respective semialdehyde (5Lambalot R.H. Gehring A.M. Flugel R.S. Zuber P. LaCelle M. Marahiel M.A. Reid R. Khosla C. Walsh C. Chem. Biol. 1996; 3: 923-936Abstract Full Text PDF PubMed Scopus (725) Google Scholar). According to their molecular structures, two classes of phosphopantetheine-containing proteins may be discriminated. One class is represented by a family of low molecular weight acyl carrier proteins (ACP) 1The abbreviations used are: ACPacyl carrier proteinFASfatty acid synthasePPTasephosphopantetheine:protein transferaseACPSACP synthaseBLASTbasic local alignment search toolbpbase pair(s)PCRpolymerase chain reactionPAGEpolyacrylamide gel electrophoresis. functioning as structurally independent components of non-aggregated multienzyme systems and exhibiting no catalytic activity, by themselves (type II system). The other class contains phosphopantetheine bound to an ACP-like acyl- or peptidyl-carrier domain, which is part of a multifunctional polypeptide chain (type I system). acyl carrier protein fatty acid synthase phosphopantetheine:protein transferase ACP synthase basic local alignment search tool base pair(s) polymerase chain reaction polyacrylamide gel electrophoresis. Using the type II ACP of Escherichia coli, it had first been demonstrated by Vagelos and co-workers (6Prescott D.J. Elovson J. Vagelos P.R. Methods Enzymol. 1975; 25: 95-101Crossref Scopus (5) Google Scholar) that 4′-phosphopantetheine is transferred from coenzyme A to the hydroxyl group of a specific serine on apo-ACP. This reaction is catalyzed by the enzyme, phosphopantetheine:protein transferase (PPTase). To date, five different bacterial PPTases have been purified and characterized in some detail, i.e. EntD (5Lambalot R.H. Gehring A.M. Flugel R.S. Zuber P. LaCelle M. Marahiel M.A. Reid R. Khosla C. Walsh C. Chem. Biol. 1996; 3: 923-936Abstract Full Text PDF PubMed Scopus (725) Google Scholar, 7Gehring A.M. Bradley K.A. Walsh C.T. Biochemistry. 1997; 36: 8495-8503Crossref PubMed Scopus (177) Google Scholar), Sfp (5Lambalot R.H. Gehring A.M. Flugel R.S. Zuber P. LaCelle M. Marahiel M.A. Reid R. Khosla C. Walsh C. Chem. Biol. 1996; 3: 923-936Abstract Full Text PDF PubMed Scopus (725) Google Scholar), 0195 (5Lambalot R.H. Gehring A.M. Flugel R.S. Zuber P. LaCelle M. Marahiel M.A. Reid R. Khosla C. Walsh C. Chem. Biol. 1996; 3: 923-936Abstract Full Text PDF PubMed Scopus (725) Google Scholar), ACPS (8Lambalot R.H. Walsh C.T. J. Biol. Chem. 1995; 270: 24658-24661Abstract Full Text Full Text PDF PubMed Scopus (176) Google Scholar), and Ppt1p (9Stuible H.-P. Meier S. Schweizer E. Eur. J. Biochem. 1997; 248: 481-487Crossref PubMed Scopus (22) Google Scholar). The substrates of EntD and Sfp are, respectively, the enterobactin synthetase of E. coli and the surfactin synthetase of Bacillus subtilis, while Ppt1p activates the two type I FAS enzymes of Brevibacterium ammoniagenes and ACPS the corresponding type II FAS of E. coli. No eucaryotic PPTase has been biochemically characterized, to date. Nevertheless, multiple PPTases are likely to occur in most eucaryotes, as is suggested by the occasional existence of several different phosphopantetheinylated proteins within the same cell. For instance, apart from the type I fatty acid synthase present in the cytoplasm of all non-plant eucaryotes, a FAS-like enzyme system of mitochondrial origin has been suggested to exist in fungi (10Chuman L. Brody S. Eur. J. Biochem. 1989; 184: 643-649Crossref PubMed Scopus (51) Google Scholar), plants (10Chuman L. Brody S. Eur. J. Biochem. 1989; 184: 643-649Crossref PubMed Scopus (51) Google Scholar), and mammals (11Runswick M.J. Fearnley I.M. Skehel J.M. Walker J.E. FEBS Lett. 1991; 286: 121-124Crossref PubMed Scopus (158) Google Scholar). This system exhibits a type II molecular structure and contains a low molecular weight ACP being comparable, in its size and sequence, to the respective E. coli protein. In the fungiSaccharomyces cerevisiae and Neurospora crassa, mutational loss of mitochondrial ACP had no effect on bulk cellular fatty acid synthesis (12Schneider R. Massow M. Lisowsky T. Weiss H. Curr. Genet. 1995; 29: 10-17Crossref PubMed Scopus (93) Google Scholar, 13Schneider R. Brors B. Massow M. Weiss H. FEBS Lett. 1997; 407: 249-252Crossref PubMed Scopus (50) Google Scholar, 14Brody S. Oh C. Hoja U. Schweizer E. FEBS Lett. 1997; 408: 217-220Crossref PubMed Scopus (133) Google Scholar). Instead, yeast ACP null mutants exhibit a respiratory-defective phenotype when grown on glycerol as a carbon source (12Schneider R. Massow M. Lisowsky T. Weiss H. Curr. Genet. 1995; 29: 10-17Crossref PubMed Scopus (93) Google Scholar, 14Brody S. Oh C. Hoja U. Schweizer E. FEBS Lett. 1997; 408: 217-220Crossref PubMed Scopus (133) Google Scholar). This phenotype is strictly connected to the loss of endogenous lipoic acid synthesis and cannot be compensated by exogenous supply of this cofactor (14Brody S. Oh C. Hoja U. Schweizer E. FEBS Lett. 1997; 408: 217-220Crossref PubMed Scopus (133) Google Scholar). Thus, mitochondrial FAS appears to be involved in the biosynthesis of the lipoic acid precursor, octanoic acid (14Brody S. Oh C. Hoja U. Schweizer E. FEBS Lett. 1997; 408: 217-220Crossref PubMed Scopus (133) Google Scholar, 15Wada H. Shintani D. Ohlrogge J. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 1591-1596Crossref PubMed Scopus (176) Google Scholar). As both the mitochondrial and the cytoplasmic FAS system require protein-bound 4′-phosphopantetheine as a prosthetic group, it remained to be shown whether the respective apo-proteins were activated by the same enzyme or, independently of each other, by two different PPTases. As will be reported in this study, inspection of the yeast genomic DNA sequence disclosed the open reading frame, YPL148C, as a potential PPTase coding sequence. It was demonstrated by both mutant analysis andin vitro activation of purified mitochondrial apo-ACP that the respective gene product represents in fact a novel phosphopantetheine:protein transferase, which specifically activates the low molecular weight mitochondrial ACP but not the type I FAS complex present in the yeast cytoplasm. Bacterial strains and plasmids used in this study are listed in Table I. Genomic DNA fromS. cerevisiae and E. coli was isolated as described by Hoffman et al. (20Hoffman C.S. Winston F. Gene ( Amst. ). 1987; 57: 267-272Crossref PubMed Scopus (2057) Google Scholar). PCR was performed using Vent DNA polymerase (New England Biolabs) according to the recommendations of the manufacturer. For gene replacement thePPT2 gene was amplified by PCR together with 430-bp N-terminal and 100-bp C-terminal flanking DNA. The forward primer GACGTAGAATTCGAGCTGTTATATACGCAT and the reverse primer GACGTAGAATTCGCGTTCTAAGACTTCCAG created new EcoRI restriction sites (underlined), which were used to insert the 1060-bp PCR product into the E. coli vector pUC19 (Boehringer Mannheim). Subsequently, the 173-bp NheI/NsiI fragment of PPT2 was eliminated and replaced by thekanMX4 marker (21Huang M.E. Cadieu E. Souciet J.L. Galibert F. Yeast. 1997; 13: 1181-1194Crossref PubMed Scopus (34) Google Scholar) (Fig. 1). The BamHI/PvuII fragment comprising the Δppt2::kanMX4 construct was used to replace the genomic yeast PPT2 gene by integrative transformation of theSaccharomyces cerevisiae strain C13-ABY.S86 according to the method of Soni et al. (22Soni R. Carmichael J.P. Murray J.A. Curr. Genet. 1993; 24: 455-459Crossref PubMed Scopus (124) Google Scholar).Table IBacterial strains and plasmids used in this studyStrain or plasmidEssential propertiesReference or originE. coli DH5αF−[φ80dΔlacZM15]Δ(lacZYA-argF) U169 relA1 deoR recA1endA1hsdR17 glnV44 thi-1 gyrA96(16Hanahan D. J. Mol. Biol. 1983; 166: 557-580Crossref PubMed Scopus (8216) Google Scholar) KER176F−rpsL lipA150::Tn1000dKn(17Reed K.E. Cronan J.E. J. Bacteriol. 1993; 175: 1325-1336Crossref PubMed Google Scholar)S. cerevisiae JS91.15–23MATα ura3 leu2 trp1 his3(18Schwank S. Hoffmann B. Schüller J. Curr. Genet. 1997; 31: 462-468Crossref PubMed Scopus (27) Google Scholar) MYY 110MATa leu2 his3 rho−M. Yaffe, La Jolla, CA SC 1341MATα ura3 leu2 trp1 his3 Δacp1::URA3This study C13-ABY.S86MATα ura3 leu2 pra1 prb1 prc1 cps1(19Teichert U. Mechler B. Müller H. Wolf D.H. J. Biol. Chem. 1989; 264: 16037-16045Abstract Full Text PDF PubMed Google Scholar) SC 1382MATα ura3 leu2 pra1 prb1 prc1 cps1 rho−This study SC 1383MATα ura3 leu2 pra1 prb1 prc1 cps1Δppt2::kanMX4 rho−This studyPlasmids pPPT1pQE70-based expression vector encodingB. ammoniagenes Ppt1p(9Stuible H.-P. Meier S. Schweizer E. Eur. J. Biochem. 1997; 248: 481-487Crossref PubMed Scopus (22) Google Scholar) pACPSpQE70-based expression vector encoding E. coli acyl carrier protein synthaseThis study pPPT2pQE70-based expression vector encoding S. cerevisiae Ppt2pThis study pHACPpQE70-based expression vector encoding the mature form of S. cerevisae mitochondrial ACPThis study pSM78pUC19 derivative containing the Δppt2::kanMX4 replacement constructThis study pSM80p425Met25-based S. cerevisiae expression vector encoding hexahistidine-tagged yeast ACPThis study pSM73pYEP181-based 2-μm plasmid carring the PPT2 reading frame under the control of its endogenous promotorThis study pSM75pYCP33-based centromer plasmid carring the PPT2 reading frame under the control of its endogenous promotorThis study Open table in a new tab The Ppt2p coding sequence was amplified by PCR using genomic DNA isolated from the S. cerevisiae strain, JS91.15–23. The forward primer TCTACATTGCATGCCTCCAGTGATGAG and the reverse primer GCACTGCGGATCCCTCTCTTTCTACCAAGTTTG introduced aSphI restriction site at the start codon and aBamHI site substituting the stop codon (underlined). TheSphI/BamHI-digested PCR product was cloned into the expression vector pQE70 (Qiagen), and the resulting plasmid was transformed into E. coli DH5α (pRP4). The Ppt2p protein thus produced contained a hexahistidine sequence at its C terminus. For protein purification, PPT2-transformed E. colicells were pre-grown on Luria Broth solid medium containing 50 mg/liter kanamycin and 100 mg/liter ampicillin and subsequently inoculated into 500 ml of liquid medium (pH 7.5) containing, per liter, 10 g of NaCl, 15 g of yeast extract, 30 g of tryptone, 100 mg/liter ampicillin, and 1 mmisopropyl-1-thio-β-d-galactopyranoside. The cells were grown at 30 °C until late log-phase, collected by centrifugation, and stored at −70 °C. The cell pellet was suspended in 40 ml of 50 mm sodium phosphate, pH 7.5, 300 mm NaCl, 30 mm imidazole, and 1 mg/ml phenylmethylsulfonyl fluoride (buffer A). Cell lysis was performed by sonication with a Branson B-12 sonifier, and insoluble components were removed by centrifugation (100,000 × g, 20 min, 4 °C). Subsequently, 2 ml of Ni2+-agarose (Qiagen) equilibrated with 50 mmsodium phosphate, pH 7.5, containing 300 mm NaCl was added. For adsorption of the hexahistidine-tagged protein, the suspension was stirred on ice for 1 h. The Ni2+-agarose was then washed twice with 40 ml of buffer A (without phenylmethylsulfonyl fluoride) and twice with 40 ml of 50 mm sodium phosphate, pH 7.5, 300 mm NaCl, 30 mm imidazole, and 15% glycerol (buffer B). Subsequently the agarose was loaded onto a 5-ml column. The protein was eluted by a stepwise gradient from 0.1 to 0.5m imidazole dissolved in buffer B. Fractions (1 ml) were collected, and aliquots were analyzed on a 15% SDS-polyacrylamide gel. The Ppt2p-containing fractions were stored in buffer B at −70 °C. The ACP synthase (ACPS) gene was PCR-amplified from E. coliM15 DNA using the forward primer ATCAGTTAGGCATGCCAATATTAGGTTTAGGCACG and the reverse primer TGCGTGAACAGATCTACTTTCAATAATTACCGTGGC. The PCR primers created novel SphI and BglII restriction sites (underlined). The ACPS reading frame was cloned into the expression vector pQE70 (Qiagen), and the resulting plasmid was transformed intoE. coli M15 (pRP4) (Qiagen). For ACPS purification, a 50-ml overnight culture of E. coli M15 transformants grown in Luria Broth with 50 mg/liter kanamycin and 100 mg/liter ampicillin at 30 °C was harvested, suspended in 200 ml of fresh medium without kanamycin, and induced with 4 mmisopropyl-1-thio-β-d-galactopyranoside. The induced cells were grown for 6 h at 30 °C. Purification of ACP synthase was performed as described for Ppt2p. The construct used for Ppt1p expression has recently been described (9Stuible H.-P. Meier S. Schweizer E. Eur. J. Biochem. 1997; 248: 481-487Crossref PubMed Scopus (22) Google Scholar). Growth and purification conditions were as described above for theE. coli ACP synthase. For overexpression of mitochondrial ACP inS. cerevisiae the complete ACP1 coding sequence was PCR-amplified from yeast DNA of the strain JS91.15–23. The forward primer ATCGGGATCCATGTTTAGATCCGTTTGCCG created aBamHI restriction site (underlined) in front of the ATG-start codon. The reverse primer ATCGCTCGAGTTAGTGATGGTGATGGTGATGGTTTGCGTCGGGATTGGAAGCGATATAATCGACCG introduced six histidine codons as well as a XhoI restriction site (underlined) downstream of the translational stop codon. The resulting PCR product was inserted into the E. coli/S. cerevisiae shuttle vector p425Met25 (23Mumberg D. Müller R. Funk M. Nucleic Acids Res. 1994; 22: 5767-5768Crossref PubMed Scopus (803) Google Scholar) and transformed into theS. cerevisiae strain C13-ABY.S86. Transformants were selected according to their leucine prototrophy on leucine-free SCD medium containing 1 g/liter methionine. For ACP purification cells were grown at 30 °C in 1 liter of SCD medium containing, per liter, 40 g of glucose, 2 g of yeast nitrogen base (Life Technologies, Inc.), 5 g of ammonium sulfate, and 1 g of methionine. The cells were harvested at late log-phase, inoculated into 1 liter of fresh medium without methionine, and grown for additional 16 h. The cell pellet obtained after centrifugation was frozen at −70 °C and subsequently suspended in buffer A. Cells were disrupted with glass beads at 4 °C, and any mitochondria still present in the resulting homogenate were lysed by sonication. The extract was fractionated by addition of ammonium sulfate to 50% saturation. After centrifugation for 20 min at 10,000 × g, the ACP-containing supernatant was titrated with 11 m HCl to pH 1.0. The precipitate thereby obtained was collected by centrifugation and subsequently re-dissolved in 150 ml of buffer A by stirring the suspension for 16 h at 4 °C. After centrifugation (100,000 × g, 20 min, 4 °C), the clear protein solution was combined with 2 ml of Ni2+-agarose. Subsequent purification steps were performed as described above for Ppt2p isolation. For expression in E. coli, the yeast mitochondrial ACP gene was PCR-amplified without its 36-amino acid N-terminal leader sequence. The forward primer GCACTGAACGCATGCCTGCAAACTTGAGCAAAGAT introduced an ATG start codon together with a SphI restriction site (underlined) at codon 37 of the ACP1 coding sequence, while the reverse primer GCACTGAACGGATCCGTTTGCGTCGGGATTGGA created a BamHI site (underlined) substituting the TAA stop codon. The SphI/BamHI-digested PCR product was cloned into the expression vector pQE70 (Qiagen) and transformed intoE. coli M15 (pRP4) (Qiagen). Expression and purification of the recombinant ACP were as described above for the E. coliACP synthase. The transfer of [3H]phosphopantetheine from [3H]coenzyme A to mitochondrial apo-ACP was monitored by liquid scintillation counting. Apo-ACP preparations were obtained by expressing the yeastACP1 gene either in the heterologous host, E. coli, or in S. cerevisiae Δppt2 disruptants. Purified apo-ACP preparations were dialyzed against 50 mm sodium phosphate buffer, pH 7.5, and subsequently used for in vitroactivation. In vitro phosphopantetheine transfer was carried out at 30 °C in a total volume of 1 ml containing 200 μg of apo-ACP, 10 μg of PPTase dissolved in buffer B, 50 μmcoenzyme A, 0.5 × 106 cpm [3H]coenzyme A (3.5 Ci/mmol) and 750 μl of 20 mm Tris-HCl, pH 7.5, containing 25 mm MgCl2 and 3 mmdithiothreitol. After 1 h of incubation, a small amount of Ni2+-agarose was added to the reaction mixture. This suspension was incubated for 10 min under gentle shaking to allow ACP adsorption. Ni2+-agarose together with the ACP bound to it was collected by centrifugation and washed five times with buffer A and, subsequently, five times with buffer B. Finally, the radioactivity adsorbed to the Ni2+-agarose matrix was quantified by liquid scintillation counting. Lipoic acid analysis was performed as described recently (14Brody S. Oh C. Hoja U. Schweizer E. FEBS Lett. 1997; 408: 217-220Crossref PubMed Scopus (133) Google Scholar). SDS-PAGE was performed according to the method of Laemmli (24Laemmli U.K. Nature. 1970; 227: 680-685Crossref PubMed Scopus (207537) Google Scholar). Mitochondrial ACP was analyzed, after reduction with 10 mm dithiothreitol at pH 7.2, by native PAGE as described by Bollag et al. (25Bollag D.M. Rozycki M.D. Edelstein S.J. Protein Methods. 2nd Ed. Wiley-Liss Inc., New York1996Google Scholar). N-terminal protein sequence determinations were performed by Toplab (München, Germany). Amino acid composition of ACP was determined according to Hannappel et al. (26Hannappel E. Kalbacher H. Voelter W. Arch. Biochem. Biophys. 1988; 260: 546-551Crossref PubMed Scopus (50) Google Scholar). Cysteamine was determined as taurine after performic acid oxidation of ACP (27Henschen A. Wittmann-Liebold B. Salnikow J. Erdmann V.A. Advanced Methods in Protein Microsequence Analysis. Springer-Verlag, Berlin1986: 244-255Crossref Google Scholar). BLAST P searches with the yeast genome data base and the B. ammoniagenes PPTase, Ppt1p (accession number Y15081), as a reference revealed similarities to the C-terminal region of FAS subunit α (28% identical and 42% conserved positions) and to the hypothetical product of the reading frame, YPL148C (25% identical and 42% conserved position). The PPTase-like domain at the C terminus of one of the two fungal FAS subunits had already been noticed by Lambalotet al. (5Lambalot R.H. Gehring A.M. Flugel R.S. Zuber P. LaCelle M. Marahiel M.A. Reid R. Khosla C. Walsh C. Chem. Biol. 1996; 3: 923-936Abstract Full Text PDF PubMed Scopus (725) Google Scholar) and by Stuible et al. (9Stuible H.-P. Meier S. Schweizer E. Eur. J. Biochem. 1997; 248: 481-487Crossref PubMed Scopus (22) Google Scholar) when probing with the bacterial PPTase sequences, ACPS and Ppt1p, respectively. As was suggested by these authors, activation of fungal type I fatty acid synthases is possibly catalyzed by this PPTase domain and, thus, represents a capacity of the FAS enzyme itself. On the other hand, activation of mitochondrial ACP is unlikely to depend on thisFAS2-encoded PPTase-like domain, as no ACP-defective phenotype is observed with FAS2 deletants (data not shown). Thus, YPL148C was considered as a potential candidate for the gene controlling phosphopantetheinylation of yeast mitochondrial ACP. The YPL148 reading frame encodes a hypothetical protein of 177 amino acids in length and a calculated molecular mass of 20.319 kDa. Its overall sequence similarity to Ppt1p from B. ammoniagenes and to ACPS from E. coli is demonstrated in Fig.2. In order to characterize the biochemical function of YPL148C, part of its sequence was replaced by the kanMX4 gene, providing resistance against the antibiotic, G418 (cf. Fig. 1). Correct chromosomal integration of the kanMX4 marker was verified by Southern blotting and by PCR analysis (data not shown). YPL148C null mutants were viable on glucose as a carbon sources, but failed to grow on non-fermentable substrates such as glycerol. As these mutants grew on glucose-containing medium without fatty acid supplementation, activation of the cytoplasmic FAS-complex is clearly not affected by YPL148C inactivation. Furthermore, glycerol utilization of YPL148C mutants was not supported by supplementation with the complex mixture of fatty acids present in an alkaline butter hydrolysate nor by any of the nutrients contained in commercial batches of yeast extract and peptone. The growth characteristics of YPL148C disruptants were therefore identical to those of yeast ACP1 deletion mutants lacking mitochondrial ACP (12Schneider R. Massow M. Lisowsky T. Weiss H. Curr. Genet. 1995; 29: 10-17Crossref PubMed Scopus (93) Google Scholar). Similar to ACP1 null mutants, YPL148C disruptants exhibit the typical characteristics of Rho-negative yeast mutants, i.e. their respiratory defect is not complemented by a Rho-negative reference strain such as MYY110. All of these findings support the idea that YPL148C encodes the phosphopantetheine transferase activating the type II ACP of yeast mitochondria. Therefore, the so far unassigned reading frame, YPL148C, was designated as PPT2. The involvement of Ppt2p in phosphopantetheinylation of mitochondrial ACP was studied upon overexpression of recombinant mitochondrial ACP in appropriate yeast strains. Among several strains tested, only the protease-negative mutant C13-ABY.S86 as well as the Δppt2 disruptant SC 1383 and the Rho-negative mutant SC 1382, which both are derived from C13-ABY.S86, allowed overproduction of ACP from pSM80 under the control of the inducible MET25 promoter (23Mumberg D. Müller R. Funk M. Nucleic Acids Res. 1994; 22: 5767-5768Crossref PubMed Scopus (803) Google Scholar). The recombinant ACP was isolated, as C-terminal hexahistidine fusion, by nickel chelate chromatography. The ACP preparations thus obtained from the three yeast strains, C13-ABY.S86, SC 1383, and the PPT2-positive, Rho-negative mutant SC 1382, were analyzed by N-terminal sequencing and by native polyacrylamide gel electrophoresis. It was found that independent on whether the ACP was isolated from respiratory competent or respiratory-defective cells, always the leader-free protein was obtained starting with Ser-37 as the N-terminal amino acid (data not shown). Thus, neither ACP overproduction nor mitochondrial inactivation precluded efficient processing and, hence, organellar import of ACP. Native gel electrophoresis of ACP derived from C13-ABY.S86 and SC 1382 transformants revealed the presence of two ACP variants of different electrophoretic mobilities (Fig. 3). The presence of pre-ACP or of ACP dimers in these preparations is excluded according to the N-terminal sequencing data and as a result of the reduction of ACP with dithiothreitol, respectively. It is known that the electrophoretic mobility of E. coli holo-ACP is higher than that of the respective apo-form (28Keating D.H. Carey M. Cronan J.E. J. Biol. Chem. 1995; 270: 22229-22235Abstract Full Text Full Text PDF PubMed Scopus (86) Google Scholar). Correspondingly, only the retarded ACP isoform was isolated from Δppt2 disruptant cells (Fig.3). This finding strongly supported the idea that both apo- and holo-ACP are included in the preparations derived fromPPT2-positive cells no matter whether these cells were respiratory-competent or respiratory-defective while exclusively apo-ACP but no holo-ACP is present in the PPT2 mutant. To verify this interpretation, ACP preparations isolated from C13-ABY.S86 and from the PPT2 null mutant, SC 1383, were tested for the presence of cysteamine. After performic acid oxidation, essentially no taurine was found in the hydrolysate of the SC 1383-derived ACP preparation. On the other hand, this cysteamine-derivative was clearly detectable in the preparation isolated from C13-ABY.S86 cells (data not shown).Together with the electrophoretic data shown in Fig. 3, these results suggest that about 50% of the ACP overproduced in wild type cells, and about 30% of that isolated from the Rho-negative mutant, SC 1382, were represented by holo-ACP while there was no ACP pantetheinylation to be detected in the PPT2-defective mutant, SC 1383. As is also evident from Fig. 3, holo-ACP synthesis is restituted to wild type level upon transformation of thePPT2 null mutant with the wild type PPT2 gene on a single-copy plasmid. Conclusive proof for Ppt2p acting as phospopantetheine:proteine transferase was derived from in vitro activation studies. For these studies, mitochondrial apo-ACP, the putative transferase, Ppt2p, and the bacterial PPTases, ACPS and Ppt1p, were purified by Ni2+-agarose chromatography upon overproduction of their hexahistidine-tagged derivatives by an inducible E. coli expression system. For efficient production in this host, the 36-amino acid pre-sequence of mitochondrial ACP had to be absent probably because of its negative effect on native protein conformation. Although endogenous ACP is known to strongly inhibit bacterial growth when overexpressed in E. coli (28Keating D.H. Carey M. Cronan J.E. J. Biol. Chem. 1995; 270: 22229-22235Abstract Full Text Full Text PDF PubMed Scopus (86) Google Scholar), no such effect was observed upon heterologous expression of yeast mitochondrial ACP. This finding conforms with the observation of Guerra et al. (29Guerra D.J. Dziewanowska K. Ohlrogge J.B. Beremand P.D. J. Biol. Chem. 1988; 263: 4386-4391Abstract Full Text PDF PubMed Google Scholar) that overproduction of heterologous bacterial ACPs in E. coli is not toxic, either. To obtain sufficient amounts of recombinant Ppt2p protein, the slow growing E. coli strain, DH5α, had to be used together with reduced cultivation temperature. In contrast to the putative yeast transferase, the bacterial PPTases, ACPS and Ppt1p, were produced at high rates although induction of ACPS expression clearly inhibited growth of the E. coli transformants. The homogeneity of yeast mitochondrial ACP and of the enzyme preparations finally obtained was verified by SDS-PAGE (Fig. 4). The unusual electrophoretic migration characteristics of mitochondrial ACP indicating an apparent molecular mass of 21 kDa rather than the calculated value of 9 kDa compare to that of endogenous E. coli ACP (28Keating D.H. Carey M. Cronan J.E. J. Biol." @default.
• W2094687612 created "2016-06-24" @default.
• W2094687612 creator A5052108838 @default.
• W2094687612 creator A5062042335 @default.
• W2094687612 creator A5063779215 @default.
• W2094687612 creator A5069043606 @default.
• W2094687612 creator A5073179893 @default.
• W2094687612 date "1998-08-01" @default.
• W2094687612 modified "2023-09-27" @default.
• W2094687612 title "A Novel Phosphopantetheine:Protein Transferase Activating Yeast Mitochondrial Acyl Carrier Protein" @default.
• W2094687612 cites W1536742797 @default.
• W2094687612 cites W1607550402 @default.
• W2094687612 cites W1607569982 @default.
• W2094687612 cites W1902924213 @default.
• W2094687612 cites W1964933259 @default.
• W2094687612 cites W1969723640 @default.
• W2094687612 cites W1976210582 @default.
• W2094687612 cites W1976423642 @default.
• W2094687612 cites W1984938563 @default.
• W2094687612 cites W1990484182 @default.
• W2094687612 cites W2000456081 @default.
• W2094687612 cites W2009434837 @default.
• W2094687612 cites W2009471270 @default.
• W2094687612 cites W2009728680 @default.
• W2094687612 cites W2016186068 @default.
• W2094687612 cites W2019280050 @default.
• W2094687612 cites W2019367914 @default.
• W2094687612 cites W2023229596 @default.
• W2094687612 cites W2025003758 @default.
• W2094687612 cites W2025590129 @default.
• W2094687612 cites W2036080658 @default.
• W2094687612 cites W2036231394 @default.
• W2094687612 cites W2041872353 @default.
• W2094687612 cites W2042329322 @default.
• W2094687612 cites W2047687152 @default.
• W2094687612 cites W2052529463 @default.
• W2094687612 cites W2069008664 @default.
• W2094687612 cites W2077231292 @default.
• W2094687612 cites W2100837269 @default.
• W2094687612 cites W2108053853 @default.
• W2094687612 cites W2132417094 @default.
• W2094687612 cites W2143486069 @default.
• W2094687612 cites W39854491 @default.
• W2094687612 cites W4249680347 @default.
• W2094687612 cites W8005587 @default.
• W2094687612 doi "https://doi.org/10.1074/jbc.273.35.22334" @default.
• W2094687612 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/9712852" @default.
• W2094687612 hasPublicationYear "1998" @default.
• W2094687612 type Work @default.
• W2094687612 sameAs 2094687612 @default.
• W2094687612 citedByCount "62" @default.
• W2094687612 countsByYear W20946876122012 @default.
• W2094687612 countsByYear W20946876122013 @default.
• W2094687612 countsByYear W20946876122014 @default.
• W2094687612 countsByYear W20946876122015 @default.
• W2094687612 countsByYear W20946876122016 @default.
• W2094687612 countsByYear W20946876122017 @default.
• W2094687612 countsByYear W20946876122018 @default.
• W2094687612 countsByYear W20946876122019 @default.
• W2094687612 countsByYear W20946876122020 @default.
• W2094687612 countsByYear W20946876122022 @default.
• W2094687612 countsByYear W20946876122023 @default.
• W2094687612 crossrefType "journal-article" @default.
• W2094687612 hasAuthorship W2094687612A5052108838 @default.
• W2094687612 hasAuthorship W2094687612A5062042335 @default.
• W2094687612 hasAuthorship W2094687612A5063779215 @default.
• W2094687612 hasAuthorship W2094687612A5069043606 @default.
• W2094687612 hasAuthorship W2094687612A5073179893 @default.
• W2094687612 hasBestOaLocation W20946876121 @default.
• W2094687612 hasConcept C181199279 @default.
• W2094687612 hasConcept C185592680 @default.
• W2094687612 hasConcept C2776376580 @default.
• W2094687612 hasConcept C2779222958 @default.
• W2094687612 hasConcept C2780786045 @default.
• W2094687612 hasConcept C553450214 @default.
• W2094687612 hasConcept C55493867 @default.
• W2094687612 hasConcept C86803240 @default.
• W2094687612 hasConceptScore W2094687612C181199279 @default.
• W2094687612 hasConceptScore W2094687612C185592680 @default.
• W2094687612 hasConceptScore W2094687612C2776376580 @default.
• W2094687612 hasConceptScore W2094687612C2779222958 @default.
• W2094687612 hasConceptScore W2094687612C2780786045 @default.
• W2094687612 hasConceptScore W2094687612C553450214 @default.
• W2094687612 hasConceptScore W2094687612C55493867 @default.
• W2094687612 hasConceptScore W2094687612C86803240 @default.
• W2094687612 hasIssue "35" @default.
• W2094687612 hasLocation W20946876121 @default.
• W2094687612 hasOpenAccess W2094687612 @default.
• W2094687612 hasPrimaryLocation W20946876121 @default.
• W2094687612 hasRelatedWork W1492114039 @default.
• W2094687612 hasRelatedWork W1931316580 @default.
• W2094687612 hasRelatedWork W1981010643 @default.
• W2094687612 hasRelatedWork W2036080658 @default.
• W2094687612 hasRelatedWork W2044993717 @default.
• W2094687612 hasRelatedWork W2055714699 @default.
• W2094687612 hasRelatedWork W2435222411 @default.
• W2094687612 hasRelatedWork W2467608370 @default.
• W2094687612 hasRelatedWork W2506604011 @default.

• next