FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2095108585> ?p ?o ?g. }

• W2095108585 endingPage "25814" @default.
• W2095108585 startingPage "25798" @default.
• W2095108585 abstract "Neuronal nitric-oxide synthase (nNOS) is expressed in a variety of human tissues and shows a complex transcriptional regulation with the presence of nine alternative first exons (1a–1i) resulting in nNOS transcripts with differing 5′-untranslated regions. We previously demonstrated that nNOS exon 1c, one of the predominant transcripts in the human gastrointestinal tract, is driven by a separate promoter (Saur, D., Paehge, H., Schusdziarra, V., and Allescher, H. D. (2000) Gastroenterology 118, 849–858). The present study focused on the quantitative expression of nNOS first exon variants in different human tissues and the characterization of the basal nNOS exon 1c promoter. In human brain, skeletal muscle, colon, and TGW-nu-I neuroblastoma cells, first exon expression patterns were analyzed by quantitative real-time reverse transcription-PCR. In these tissues/cells exon 1c was one of the most abundant first exons of nNOS. By transient transfections of TGW-nu-I and HeLa cells with reporter plasmids containing a series of 5′ and 3′ deletions in the exon 1c regulatory region, the minimal TATA-less promoter was localized within 44 base pairs. Gel mobility shift assays of this cis-regulatory region revealed a high complexity of the basal promoter with a cooperative binding of several transcription factors, like Sp and ZNF family members. When the Sp binding site of the minimal promoter construct was mutated, promoter activity was completely abolished in both cell lines, whereas mutation of the common binding site of ZNF76 and ZNF143 resulted in a decrease of 53% in TGW-nu-I and 37% in HeLa cells. In Drosophila Schneider cells expression of Sp1, the long Sp3 isoform, ZNF76 and ZNF143 potently transactivated the nNOS exon 1c promoter. These results identify the critical regulatory region for the nNOS exon 1c basal promoter and stress the functional importance of multiple protein complexes involving Sp and ZNF families of transcription factors in regulating nNOS exon 1c transcription. Neuronal nitric-oxide synthase (nNOS) is expressed in a variety of human tissues and shows a complex transcriptional regulation with the presence of nine alternative first exons (1a–1i) resulting in nNOS transcripts with differing 5′-untranslated regions. We previously demonstrated that nNOS exon 1c, one of the predominant transcripts in the human gastrointestinal tract, is driven by a separate promoter (Saur, D., Paehge, H., Schusdziarra, V., and Allescher, H. D. (2000) Gastroenterology 118, 849–858). The present study focused on the quantitative expression of nNOS first exon variants in different human tissues and the characterization of the basal nNOS exon 1c promoter. In human brain, skeletal muscle, colon, and TGW-nu-I neuroblastoma cells, first exon expression patterns were analyzed by quantitative real-time reverse transcription-PCR. In these tissues/cells exon 1c was one of the most abundant first exons of nNOS. By transient transfections of TGW-nu-I and HeLa cells with reporter plasmids containing a series of 5′ and 3′ deletions in the exon 1c regulatory region, the minimal TATA-less promoter was localized within 44 base pairs. Gel mobility shift assays of this cis-regulatory region revealed a high complexity of the basal promoter with a cooperative binding of several transcription factors, like Sp and ZNF family members. When the Sp binding site of the minimal promoter construct was mutated, promoter activity was completely abolished in both cell lines, whereas mutation of the common binding site of ZNF76 and ZNF143 resulted in a decrease of 53% in TGW-nu-I and 37% in HeLa cells. In Drosophila Schneider cells expression of Sp1, the long Sp3 isoform, ZNF76 and ZNF143 potently transactivated the nNOS exon 1c promoter. These results identify the critical regulatory region for the nNOS exon 1c basal promoter and stress the functional importance of multiple protein complexes involving Sp and ZNF families of transcription factors in regulating nNOS exon 1c transcription. nitric oxide nitric-oxide synthase neuronal nitric-oxide synthase electrophoretic mobility shift assay 6-carboxy-fluorescein fetal bovine serum gene-specific primer nucleotide(s) rapid amplification of genomic ends reverse transcriptase Drosophila Schneider cells phosphate-buffered saline glyceraldehyde-3-phosphate dehydrogenase Nitric oxide (NO),1 a ubiquitous multifunctional mediator, is synthesized by nitric-oxide synthases (NOS) during the oxidation of l-arginine to l-citrulline. In the central and peripheral nervous system, skeletal muscle, the macula densa of the kidney, testis, and neutrophils, neuronal NOS (nNOS) is the predominant enzyme for the generation of nitric oxide. NO, synthesized by nNOS, acts as neurotransmitter, neuromodulator, or intracellular signaling molecule. It is involved in synaptic plasticity, regulation of gene expression, development, differentiation, and regeneration and plays an important role in neurodegenerative disorders and stroke as a mediator of neurotoxicity (for review see Refs. 1Bredt D.S. Free Radic. Res. 1999; 31: 577-596Crossref PubMed Scopus (657) Google Scholar, 2Dawson V.L. Dawson T.M. Prog. Brain Res. 1998; 118: 215-229Crossref PubMed Google Scholar, 3Forstermann U. Boissel J.P. Kleinert H. FASEB J. 1998; 12: 773-790Crossref PubMed Scopus (561) Google Scholar, 4Wang Y. Newton D.C. Marsden P.A. Crit. Rev. Neurobiol. 1999; 13: 21-43Crossref PubMed Scopus (165) Google Scholar). In the gastrointestinal tract NO generated by nNOS acts as an important mediator of the non-adrenergic non-cholinergic inhibitory innervation of intestinal smooth muscle (5Stark M.E. Szurszeswski J.H. Gastroenterology. 1992; 103: 1928-1949Abstract Full Text PDF PubMed Google Scholar) and as a neuromodulator within the enteric nervous system (6Allescher H.D. Kurjak M. Huber A. Trudrung P. Schusdziarra V. Am. J. Physiol. 1996; 271: G568-G574PubMed Google Scholar). Although the transcriptional regulation of the other two NOS enzymes, the calcium-dependent endothelial NOS and the calcium-independent inducible NOS, are extensively studied (for review see Refs. 3Forstermann U. Boissel J.P. Kleinert H. FASEB J. 1998; 12: 773-790Crossref PubMed Scopus (561) Google Scholar, 7Papapetropoulos A. Rudic R.D. Sessa W.C. Cardiovasc. Res. 1999; 43: 509-520Crossref PubMed Scopus (163) Google Scholar, 8Geller D.A. Billiar T.R. Cancer Metastasis Rev. 1998; 17: 7-23Crossref PubMed Scopus (273) Google Scholar), little is known about the transcriptional regulation of the nNOS gene (3Forstermann U. Boissel J.P. Kleinert H. FASEB J. 1998; 12: 773-790Crossref PubMed Scopus (561) Google Scholar, 4Wang Y. Newton D.C. Marsden P.A. Crit. Rev. Neurobiol. 1999; 13: 21-43Crossref PubMed Scopus (165) Google Scholar, 9Sasaki M. Gonzalez-Zulueta M. Huang H. Herring W.J. Ahn S. Ginty D.D. Dawson V.L. Dawson T.M. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 8617-8622Crossref PubMed Scopus (160) Google Scholar, 10Deans Z. Dawson S.J. Xie J. Young A.P. Wallace D. Latchman D.S. J. Biol. Chem. 1996; 271: 32153-32158Abstract Full Text Full Text PDF PubMed Scopus (30) Google Scholar), which is considered to be responsible for the largest proportion of NO in the body (1Bredt D.S. Free Radic. Res. 1999; 31: 577-596Crossref PubMed Scopus (657) Google Scholar). Although usually named constitutive, recent observations suggest a tightly regulated gene expression of nNOS in response to different physiological and pathophysiological stimuli, resulting in an up- or down-regulation of nNOS mRNA (3Forstermann U. Boissel J.P. Kleinert H. FASEB J. 1998; 12: 773-790Crossref PubMed Scopus (561) Google Scholar, 9Sasaki M. Gonzalez-Zulueta M. Huang H. Herring W.J. Ahn S. Ginty D.D. Dawson V.L. Dawson T.M. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 8617-8622Crossref PubMed Scopus (160) Google Scholar). Recently nine distinct first exons, called exons 1a–1i, of nNOS mRNA have been identified, leading to nNOS mRNA variants with different 5′-untranslated regions and translational efficiencies (11Wang Y. Newton D.C. Robb G.B. Kau C.L. Miller T.L. Cheung A.H. Hall A.V. VanDamme S. Wilcox J.N. Marsden P.A. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 12150-12155Crossref PubMed Scopus (171) Google Scholar). The nNOS gene is therefore believed to be one of the most complex genes known in terms of first exon usage and alternative splicing (11Wang Y. Newton D.C. Robb G.B. Kau C.L. Miller T.L. Cheung A.H. Hall A.V. VanDamme S. Wilcox J.N. Marsden P.A. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 12150-12155Crossref PubMed Scopus (171) Google Scholar, 12Saur D. Paehge H. Schusdziarra V. Allescher H.D. Gastroenterology. 2000; 118: 849-858Abstract Full Text Full Text PDF PubMed Scopus (85) Google Scholar, 13Xie J. Roddy P. Rife T. Murad F. Young A.P. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 1242-1246Crossref PubMed Scopus (82) Google Scholar). It has been shown that nNOS exons 1c (12Saur D. Paehge H. Schusdziarra V. Allescher H.D. Gastroenterology. 2000; 118: 849-858Abstract Full Text Full Text PDF PubMed Scopus (85) Google Scholar) and 1f and 1g (13Xie J. Roddy P. Rife T. Murad F. Young A.P. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 1242-1246Crossref PubMed Scopus (82) Google Scholar) (former called exons 15′3, 15′2, and 15′1, respectively), which show high abundant expression in the human gastrointestinal tract (12Saur D. Paehge H. Schusdziarra V. Allescher H.D. Gastroenterology. 2000; 118: 849-858Abstract Full Text Full Text PDF PubMed Scopus (85) Google Scholar), are driven by separate promoters in HeLa cells. The use of multiple alternative promoters allows a cell-, tissue-, and site-specific transcriptional regulation of nNOS in different physiological and pathophysiological stages. An altered expression or biological activity of nNOS has been linked to several physiological conditions, like aging and pregnancy, as well as different pathophysiological conditions and diseases such as ischemia/hypoxia and injuries of the central nervous system, inherited diabetes insipidus, heart failure, arteriosclerosis, achalasia, diabetic gastroparesis, and hypertrophic pyloric stenosis (1Bredt D.S. Free Radic. Res. 1999; 31: 577-596Crossref PubMed Scopus (657) Google Scholar, 2Dawson V.L. Dawson T.M. Prog. Brain Res. 1998; 118: 215-229Crossref PubMed Google Scholar, 3Forstermann U. Boissel J.P. Kleinert H. FASEB J. 1998; 12: 773-790Crossref PubMed Scopus (561) Google Scholar, 4Wang Y. Newton D.C. Marsden P.A. Crit. Rev. Neurobiol. 1999; 13: 21-43Crossref PubMed Scopus (165) Google Scholar, 7Papapetropoulos A. Rudic R.D. Sessa W.C. Cardiovasc. Res. 1999; 43: 509-520Crossref PubMed Scopus (163) Google Scholar,14Vanderwinden J.M. Mailleux P. Schiffmann S.N. Vanderhaeghen J.J. De-Laet M.H. N. Engl. J. Med. 1992; 327: 511-515Crossref PubMed Scopus (308) Google Scholar, 15Chung E. Curtis D. Chen G. Marsden P.A. Twells R., Xu, W. Gardiner M. Am. J. Hum. Genet. 1996; 58: 363-370PubMed Google Scholar, 16Mearin F. Mourelle M. Guarner F. Salas A. Riveros M., V Moncada S. Malagelada J.R. Eur J. Clin. Invest. 1993; 23: 724-728Crossref PubMed Scopus (269) Google Scholar, 17Watkins C.C. Sawa A. Jaffrey S. Blackshaw S. Barrow R.K. Snyder S.H. Ferris C.D. J. Clin. Invest. 2000; 106: 373-384Crossref PubMed Scopus (207) Google Scholar). nNOSα mutant mice, generated by targeted disruption of the nNOS gene by homologous recombination, showed a gastrointestinal phenotype resembling hypertrophic pyloric stenosis with delayed gastric emptying of solids and fluids (18Huang P.L. Dawson T.M. Bredt D.S. Snyder S.H. Fishman M.C. Cell. 1993; 75: 1273-1286Abstract Full Text PDF PubMed Scopus (1125) Google Scholar, 19Mashimo H. Kjellin A. Goyal R.K. Gastroenterology. 2000; 119: 766-773Abstract Full Text Full Text PDF PubMed Scopus (131) Google Scholar). In addition, these mice have a hypertensive lower esophageal sphincter with impaired relaxation (20Sivarao D.V. Mashimo H.L. Thatte H.S. Goyal R.K. Gastroenterology. 2001; 121: 34-42Abstract Full Text PDF PubMed Scopus (138) Google Scholar). A recent study comprising 27 families with inherited infantile pyloric stenosis identified nNOS as a susceptibility gene for this disorder (15Chung E. Curtis D. Chen G. Marsden P.A. Twells R., Xu, W. Gardiner M. Am. J. Hum. Genet. 1996; 58: 363-370PubMed Google Scholar), and expression of nNOS exon 1c mRNA is significantly reduced in the pyloric sphincter of patients with infantile hypertrophic pyloric stenosis. 2D. Saur, J. M. Vanderwinden, M. H. De-Laet, and H.-D. Allescher, manuscript in preparation.2D. Saur, J. M. Vanderwinden, M. H. De-Laet, and H.-D. Allescher, manuscript in preparation. Therefore it is of physiological and pathophysiological interest to investigate the molecular basis of nNOS exon 1c transcription. In addition, the distribution and quantitative expression of alternative first exon nNOS variants in different human tissues was determined. Here we present evidence for a tissue-specific expression of nNOS first exon variants, with exon 1c being one of the predominant forms in human brain, skeletal muscle, gastrointestinal tissue, and neuroblastoma cells. We furthermore characterize the basal promoter of exon 1c, showing a high complexity with a cooperative binding of several Sp and ZNF family members of transcription factors. The cell lines TGW-nu-I (human neuroblastoma) and ME-180 (human cervix carcinoma) were kindly provided to our laboratory by Dr. Esumi (21Ogura T. Nakayama K. Fujisawa H. Esumi H. Neurosci. Lett. 1996; 204: 89-92Crossref PubMed Scopus (48) Google Scholar) and Dr. E. R. Werner (22Werner-Felmayer G. Werner E.R. Fuchs D. Hausen A. Mayer B. Reibnegger G. Weiss G. Wachter H. Biochem. J. 1993; 289: 357-361Crossref PubMed Scopus (38) Google Scholar), respectively. The mammalian expression plasmids pcDNA3 ZNF76 and pcDNA3 143 were a gift from Dr. P. Carbon (23Myslinski E. Krol A. Carbon P. J. Biol. Chem. 1998; 273: 21998-22006Abstract Full Text Full Text PDF PubMed Scopus (72) Google Scholar), and CB6-MZF-1 (alternative name CB6-ZNF42), under the control of the cytomegalovirus early promoter, was generously provided by Dr. R. Hromas (24Hromas R. Collins S.J. Hickstein D. Raskind W. Deaven L.L. O'Hara P. Hagen F.S. Kaushansky K. J. Biol. Chem. 1991; 266: 14183-14187Abstract Full Text PDF PubMed Google Scholar). The plasmid pPac-Sp1, which expresses Sp1 from the Drosophila actin promoter, and the “empty” control plasmid pPac0, containing only the Drosophila actin promoter, were generously provided by Dr. R. Tjian (25Courey A.J. Tjian R. Cell. 1988; 55: 887-898Abstract Full Text PDF PubMed Scopus (1073) Google Scholar). The expression vector for Sp2 (pPac-Sp2) was a gift from Dr. J. D. Noti (26Noti J.D. J. Biol. Chem. 1997; 272: 24038-24045Abstract Full Text Full Text PDF PubMed Scopus (77) Google Scholar), and the expression plasmids for the short isoforms of Sp3 (pPac-Sp3), the long isoform of Sp3 (pPacUSp3), Sp4 (pPac-Sp4), and the β-galactosidase expression plasmid p97b were generously provided by Dr. G. Suske (27Hagen G. Muller S. Beato M. Suske G. Nucleic Acids Res. 1992; 20: 5519-5525Crossref PubMed Scopus (521) Google Scholar, 28Hagen G. Muller S. Beato M. Suske G. EMBO J. 1994; 13: 3843-3851Crossref PubMed Scopus (650) Google Scholar, 29Hagen G. Dennig J. Preiss A. Beato M. Suske G. J. Biol. Chem. 1995; 270: 24989-24994Abstract Full Text Full Text PDF PubMed Scopus (186) Google Scholar, 30Philipsen S. Suske G. Nucleic Acids Res. 1999; 27: 2991-3000Crossref PubMed Scopus (531) Google Scholar). All cell culture reagents were obtained from Invitrogen (Groningen, Netherlands). Polyclonal antibodies against Sp1 (PEP 2 X), Sp2 (K-20 X), Sp3 (d-20 X), Sp4 (V-20 X), NFκB p65 (C-20 X), NF-κB p50 (C-19 X), Ap-2a (C-17 X) were purchased from Santa Cruz Biotechnologies (Heidelberg, Germany). Consensus and mutant consensus oligonucleotides used in electrophoretic mobility shift assays (EMSAs) were obtained from Santa Cruz Biotechnologies (Ap2, Myc-Max, NF-I, YY1, NFκB, p53, Sp1, USF-1), or synthesized (Staf, Olf-1, ZNF42, MAZ) by MWG (Ebersberg, Germany). Primers were made by MWG and TaqMan-probes by Applied Biosystems (Weiterstadt, Germany). Restriction endonucleases were obtained from New England BioLabs (Mannheim, Germany). [γ-32P]ATP was supplied from Amersham Biosciences, Inc. (Freiburg, Germany). The Escherichia coli strain TOP10 (Invitrogen) was used for transformation and amplification of DNA-containing plasmids. Tissues from human rectum were obtained from surgical resections for malignant disease and prepared as previously described (12Saur D. Paehge H. Schusdziarra V. Allescher H.D. Gastroenterology. 2000; 118: 849-858Abstract Full Text Full Text PDF PubMed Scopus (85) Google Scholar). Liquid nitrogen-frozen rectum muscle layer preparations and fresh TGW-nu-I, ME-180, and HeLa cells were homogenized with a Polytron homogenizer (Kinematica, Switzerland), and total RNA was isolated using the guanidine isothiocyanate/phenol/chloroform extraction method as previously described (12Saur D. Paehge H. Schusdziarra V. Allescher H.D. Gastroenterology. 2000; 118: 849-858Abstract Full Text Full Text PDF PubMed Scopus (85) Google Scholar, 31Huber A. Saur D. Kurjak M. Schusdziarra V. Allescher H.D. Am. J. Physiol. 1998; 275: G1146-G1156PubMed Google Scholar). Pooled total RNA from human adult brain and skeletal muscle was purchased from CLONTECH (Heidelberg, Germany). Reverse transcription and PCR amplification were carried out exactly as described before (12Saur D. Paehge H. Schusdziarra V. Allescher H.D. Gastroenterology. 2000; 118: 849-858Abstract Full Text Full Text PDF PubMed Scopus (85) Google Scholar, 31Huber A. Saur D. Kurjak M. Schusdziarra V. Allescher H.D. Am. J. Physiol. 1998; 275: G1146-G1156PubMed Google Scholar). RT-PCR was performed with specific primer pairs for ZNF42, ZNF76, and ZNF143 (for all primers see Table I) for 35 cycles using random hexamer-primed cDNA from human brain, skeletal muscle, rectum, TGW-nu-I cells, ME-180 cells, and HeLa cells (annealing 58 °C, 30 s; extension 72 °C, 60 s; denaturation 94 °C, 30 s). Amplification products were cloned into pCRII plasmid (Invitrogen) and subjected to DNA sequence analysis (GATC, Konstanz, Germany).Table ISense (S) and antisense strand (AS) primers and TaqMan probesNameSequence (5′ to 3′)ZNF42 (S)CGCAGGTCCAGGTAGTGTAAGCZNF42 (AS)CTCTCCGATGCTCTTCCAGGZNF76 (S)CAGGTGACGGTACAGAAAGAAGCZNF76 (AS)TGATGAGCGGTGGTGTAGAGACZNF143 (S)TCATAGATGGCCAGGTCATTCAGZNF143 (AS)CCAATCATTCCAGTACCTGCTACACZNF42 XhoI (S)CGGCTCGAGGCCGCCACCATGAATGGTCCCCTTGTGTAZNF42 XhoI (AS)CGGCTCGAGCTACTCGGCGCTGTGGACZNF76 BamHI (S)CGGGATCCGCCGCCACCATGGAGAGZNF76 BamHI (AS)CGGGATCCTCAGCAGCCACTCTCCGZNF143 BamHI (S)CGGGATCCGCCGCCACCATGGCAGAGTTTCCTGGAGGAGGGZNF143BamHI (AS)CGGGATCCTTAATCATCCAACCCTGnNOS exon 1a (S)CCCATGCTCTAGCTTGGAGCnNOS exon 1b (S)GCTGCTGCCACCTCTAAATGAnNOS exon 1c (S)ATGCCAGGGTGAGGCCTTnNOS exon 1d (S)GCTGAGAGATGGAAGAACTGGCnNOS exon 1e (S)GGAGGAGCCTTGGAGGGAnNOS exon 1f (S)CGCTGGGTGAGGAGCTACTTAGnNOS exon 1g (S)GGGAGGAAGAGGAGGAGTACGAnNOS exon 1h (S)TTCCTCGGTGCCCGACTnNOS exon 1i (S)CACCTGGAGCCTCTTAACTTTCAGnNOS exon 2 (AS)GTGACGCATGATAGATGTGAACTATTCnNOS exon 2 ProbeAGATCTGATCCGCATCTAACAGGCTGGCnNOS exon 6 (S)CAGTGGTCCAAGCTGCAGGTAnNOS exon 7 (AS)GGTGGCATACTTGACATGGTTACAnNOS exon 7 ProbeTCGATGCCCGTGACTGCACCACP-5891 (S)AAACATAAATTCCATTGCATTCCAP-2774 (S)ACTTTGGGAGGCTGAGGCAGP-1938 (S)GTACCTGGCACATAATAGGTP-1520 (S)AGCTCCTGTCCTCAGGTGATCTP-332 (S)GCTGGGGGGAAACCTGAGP-279 (AS)CAGCAGTGGCAGCGTCTGP-83 (S)ACCTCCCAGCCTGCCCCTGP+49 (AS)GTCACCCCCTCTCAGACAGTGP-90 Sp1/ZNF42-M1 (S)AGAGCTCGAGCCACCTCCCAGCCTGCCCCTGGTTAGGP-90 Sp1-M2 (S)AGAGCTCGAGCCACCTCCCAGCCTGCCCCTGGGGATTGGCP-90 Ap2/Olf-1-M (S)AGAGCTCGAGCCACCTCCCAGCCTGCTTCTGP-90 Staf-M (S)AGAGCTCGAGCCACCTCTTAGTCTGCCCCTGSDM-Sp1/ZNF42-M1 (S)CTCCCAGCCTGCCCCTGGTTAGGGGCCACCTGGTGTCSDM-Sp1/ZNF42-del (S)CCAGCCTGCCCCTCACCTGGTGTCSDM-Staf-M (S)CAGCAGAGCCACCTCTTAGTCTGCCCCTGGGGAGGGSDM-Staf-del (S)CAGCAGAGCCACCCTGGGGAGGGSDM-Staf/Sp1/ZNF42-M1 (S)CAGCAGAGCCACCTCTTAGTCTGCCCCTGGTTAGGGGCCACCTGGTGTCSDM-Staf/Sp1/ZNF42-del (S)CAGCAGAGCCACCACCTGGTGTCGSP1-AS/ex 1c (AS)CCTGGCATGGTGGCGGTCACGSP2-AS/ex 1c (AS)GTCACCCCCTCTCAGACAGTGCTCAP1GTAATACGACTCACTATAGGGCAP2ACTATAGGGCACGCGTGGTSequences of primers and probes for RT-PCR, real-time RT-PCR, 5′-RAGE-PCR, constructions of pPac-ZNF42, pPac-ZNF76, and pPac-ZNF143, generation of 5′ deletions of pGL3–5891/+49, point mutations of pGL3–90/+49, and site-directed mutagenesis of pGL3–5891/+49 and pGL3–332/+49. Boldface letters indicate mutated bases. Open table in a new tab Sequences of primers and probes for RT-PCR, real-time RT-PCR, 5′-RAGE-PCR, constructions of pPac-ZNF42, pPac-ZNF76, and pPac-ZNF143, generation of 5′ deletions of pGL3–5891/+49, point mutations of pGL3–90/+49, and site-directed mutagenesis of pGL3–5891/+49 and pGL3–332/+49. Boldface letters indicate mutated bases. Real-time quantitative RT-PCR analyses for the alternative first exons 1a–1i and exon 6/7 of human nNOS mRNA were performed using an ABI Prism 7700 Sequence Detection System instrument (Applied Biosystems). cDNAs for quantitative analysis were generated with the TaqMan reverse transcription reagents (Applied Biosystems) as recommended by the manufacturer, using murine leukemia virus reverse transcriptase, random hexamer primers, and 5 μg of total RNA from human rectum and from TGW-nu-I, ME-180, and HeLa cells. In addition, total RNA obtained from CLONTECH and isolated from pooled human brain and skeletal muscle was used. nNOS transcripts were amplified with intron-spanning, isoform-specific primers and probes complementary to the alternative first exons 1a–1i (forward primers) and the common exon 2 (reverse primer, probe). As a parameter for total nNOS mRNA expression, an intron-spanning pair of exon 6- and exon 7-specific primers present in all known human nNOS cDNAs was used with an exon 7-specific internal probe. Primers and TaqMan probes were designed to meet specific criteria by using the Primer Express software (Applied Biosystems). The 5′-end of the probe was labeled with a fluorescent reporter (6-carboxy-fluorescein (FAM)) and the 3′-end with a quencher dye (6-carboxyltetramethylrhodamine). Sequences of primers and fluorescent probes used in the study are shown in Table I.GAPDH, HPRT, and TF2D primers and probes were purchased from Applied Biosystems. The principle of real-time RT-PCR has been described in detail elsewhere (32Gibson U.E. Heid C.A. Williams P.M. Genome Res. 1996; 6: 995-1001Crossref PubMed Scopus (1756) Google Scholar, 33Bustin S.A. J. Mol. Endocrinol. 2000; 25: 169-193Crossref PubMed Scopus (3011) Google Scholar). Briefly, real-time PCR is based on a sequence-specific probe labeled with a 5′ reporter and 3′ quencher dye. When the probe is intact, reporter dye emission is quenched, but during the extension phase of the PCR, the nucleolytic activity of theTaq-DNA polymerase cleaves the hybridized probe, and due to the separation of reporter and quencher dye a fluorescence signal is released that is monitored by the sequence detector. A computer algorithm normalizes the signal to an internal reference (ΔRn) and calculates the threshold cycle number (C t), when ΔRn becomes equal to 10 standard deviations of the baseline. C t is used for quantification of the input mRNA number. For each amplicon, the amount of target and endogenous reference (glyceraldehyde-3-phosphate dehydrogenase, HPRT, TF2D) was determined from a standard curve generated by serial 5-fold dilutions (25,000 to 8 copies) of plasmids containing the respective target sequence. The standard curve was amplified in triplicate during every experiment, and the amount of target gene was normalized by the endogenous reference. Quantitative PCR was performed using the TaqMan Universal PCR Master Mix (Applied Biosystems), with cDNAs corresponding to 100 ng of total RNA, 200 nm probe, and 900 nmprimers in a 25-μl final reaction mix (1 PCR cycle 50 °C, 2 min; 95 °C, 10 min; 50 PCR cycles 60 °C, 1 min; 95 °C, 15 s). Signals were analyzed by the ABI Prism Sequence Detection System software version 1.7 (Applied Biosystems). The 5′-flanking region of human nNOS exon 1c was determined by rapid amplification of genomic ends (RAGE) using the human GenomeWalker kit (CLONTECH) as previously described (12Saur D. Paehge H. Schusdziarra V. Allescher H.D. Gastroenterology. 2000; 118: 849-858Abstract Full Text Full Text PDF PubMed Scopus (85) Google Scholar). Digested and adapter-ligated genomic DNA fragments obtained from CLONTECH were amplified in a first round of PCR (seven cycles 94 °C, 25 s; 72 °C, 7 min and 32 cycles 94 °C, 25 s; 67 °C, 7 min adding 5 s each cycle) using the antisense gene-specific primer GSP1-AS/ex 1c (10 pmol) (for all primers see Table I) and the sense generic primer AP1 from CLONTECH specific for the ligated adapters. The second round of PCR was performed with nested antisense gene-specific primer GSP2-AS/ex 1c (10 pmol) and sense generic primer AP2 (5 cycles 94 °C, 25 s; 72 °C, 7 min; 20 cycles 94 °C, 25 s; 67 °C 7 min adding 5 s each cycle). PCR products were cloned into pCRII plasmid and subjected to commercial sequence analysis (GATC). The BLASTn program was employed to search for sequence identity. Potential cis-acting DNA sequences and putative consensus elements were identified by analysis with the MatInspector professional software (Genomatix Software GmbH, Munich, Germany) using the Transfac data base. The human genomic 5′-flanking region of nNOS exon 1c was obtained by 5′-RAGE PCR. To create a 5940-bp fragment containing the promoter of exon 1c (nt −5891 to +49), 100 ng of genomic DNA was PCR-amplified (30 cycles at 94 °C, 20 s; 60 °C, 30 s; 72 °C, 7 min) using a proofreading polymerase (Pwo, Roche Molecular Biochemicals, Mannheim, Germany) and the primers P-5891 (sense) and P+49 (antisense) (see TableI for primer sequences). The gel-purified PCR product was blunt end-cloned into the SmaI site of the promoter-/enhancerless firefly luciferase reporter gene vector pGL3-basic (Promega, Mannheim, Germany) in the forward (pGL3−5891/+49) and reverse (pGL3+49/−5891) orientation. Reporter gene constructs containing 5′ and 3′ deletions of the promoter region of nNOS exon 1c were generated by PCR, exonuclease III/S1 nuclease digestion, or restriction endonuclease digestion. pGL3−2774/+49, pGL3−1938/+49, pGL3−1520/+49 and pGL3−332/+49 were prepared by PCR and blunt end cloning similar to the preparation of pGL3−5891/+49, using the sense primers P-2774, P-1938, P-1520, and P-332 combined with the common antisense primer P+49. For construction of pGL3−5891/−279, sense primer P-5891 was used with antisense primer P-279. pGL3−226/+49 was prepared by restriction endonuclease digestion of pGL3−332/+49 with PflmI andMluI, followed by blunting and religation. Additional 5′ deletions of pGL3−332/+49 (pGL3−278/+49, pGL3−241/+49, pGL3−174/+49, pGL3−131/+49, pGL3−90/+49, pGL3−83/+49, pGL3−63/+49, pGL3−48/+49, pGL3−34/+49, pGL3−24/+49, pGL3−14/+49, pGL3−4/+49, pGL3 + 18/+49), were prepared by successive exonuclease III and S1 nuclease digestions and re-ligations. pGL3−90/+49 Sp1/ZNF42-M1, containing a point mutation of the common Sp1 and ZNF42 binding site, pGL3−90/+49 Sp1-M2, containing only a mutated Sp1 element, pGL3−90/+49 Ap2/Olf-1-M, containing a mutation of the common Ap2 and Olf-1 binding site, and pGL3−90/+49 Staf-M, containing a mutated Staf consensus sequence (common binding site for ZNF76 and ZNF143), were prepared by PCR using the common antisense primer P+49 combined with the following sense primers: P-90 Sp1/ZNF42-M1, P-90 Sp1-M2, P-90 Ap2/Olf-1-M, and P-90 Staf-M. Gel-purified PCR products were blunt end-cloned into pGL3-basic in the forward orientation. Mutations and deletions of the common Sp1/ZNF42 binding site, the Staf binding site, and both the Sp1/ZNF42 and Staf binding sites in the longer promoter constructs pGL3−5981/+49 and pGL3−332/+49 were generated by using the QuikChange XL site-directed mutagenesis kit (Stratagene, Heidelberg, Germany) exactly as described by the manufacturer with the following primers: SDM-Sp1/ZNF42-M1 (mutation of the Sp1/ZNF42 binding site), SDM-Sp1/ZNF42-del (deletion of the Sp1/ZNF42 binding site), SDM-Staf-M (mutation of the Staf binding site), SDM-Staf-del (deletion of the Staf binding site), SDM-Staf/Sp1/ZNF42-M1 (mutation of the Staf and Sp1/ZNF42 binding sites), and SDM-Staf/Sp1/ZNF42-del (deletion of the Staf and Sp1/ZNF42 binding sites). To construct plasmids that express the transcription factors ZNF42, ZNF76, and ZNF143 from theDrosophila actin promoter, the eukaryotic expression vectors CB6-ZNF42 (alternative name CB6-MZF-1), pcDNA3 ZNF76, and pcDNA3 ZNF143 were used as templates for PCR to generate DNAs containing the complete coding sequences of these transcription factors. Primers for ZNF42 contained XhoI, and primers for ZNF76 and ZNF143 contained BamHI restriction sites and a Kozak consensus sequence upstream of the ATG start codon. TheXhoI and BamHI restriction sites were used to clone the coding sequences of ZNF42, ZNF76, and ZNF143 into the respective XhoI or BamHI sites of the expression plasmid pPac0, which contains only the Drosophila actin promoter. Integrity of all cloned sequences was confirmed by automated DNA sequencing (GATC) using an ABI Prism 377 DNA sequencer (Applied Biosystems). HeLa cells were cultured and transiently cotransfected with the different nNOS exon 1c-pGL3 promoter gene constructs and the herpes simplex virus thymidine kinase promoter-drivenRenilla luciferase expression vector pRL-TK (Promega) to normalize for transfection efficiency and cell number essentially as described previously (12Saur D. Paehge H. Schusdziarra V. Allescher H.D. Gastroenterology. 2000; 118: 849-858Abstract Full Text Full Text PDF PubMed Scopus (85) Google Scholar). TGW-nu-I cells were cultured in minimum Eagle's medium containing" @default.
• W2095108585 created "2016-06-24" @default.
• W2095108585 creator A5014722516 @default.
• W2095108585 creator A5033411437 @default.
• W2095108585 creator A5057713565 @default.
• W2095108585 creator A5058267557 @default.
• W2095108585 creator A5090240499 @default.
• W2095108585 date "2002-07-01" @default.
• W2095108585 modified "2023-09-26" @default.
• W2095108585 title "Complex Regulation of Human Neuronal Nitric-oxide Synthase Exon 1c Gene Transcription" @default.
• W2095108585 cites W1228798347 @default.
• W2095108585 cites W1482844117 @default.
• W2095108585 cites W1497064282 @default.
• W2095108585 cites W1498146886 @default.
• W2095108585 cites W1603904020 @default.
• W2095108585 cites W1851149345 @default.
• W2095108585 cites W1923711010 @default.
• W2095108585 cites W1929952785 @default.
• W2095108585 cites W1945050693 @default.
• W2095108585 cites W1967993059 @default.
• W2095108585 cites W1980195431 @default.
• W2095108585 cites W1985306358 @default.
• W2095108585 cites W1985725092 @default.
• W2095108585 cites W1989602742 @default.
• W2095108585 cites W1996559981 @default.
• W2095108585 cites W1996711093 @default.
• W2095108585 cites W2001046931 @default.
• W2095108585 cites W2001077058 @default.
• W2095108585 cites W2010499718 @default.
• W2095108585 cites W2011282682 @default.
• W2095108585 cites W2012191233 @default.
• W2095108585 cites W2018855284 @default.
• W2095108585 cites W2024286935 @default.
• W2095108585 cites W2033501267 @default.
• W2095108585 cites W2036781343 @default.
• W2095108585 cites W2037653294 @default.
• W2095108585 cites W2038978204 @default.
• W2095108585 cites W2041233862 @default.
• W2095108585 cites W2053295632 @default.
• W2095108585 cites W2056169163 @default.
• W2095108585 cites W2066010552 @default.
• W2095108585 cites W2066664309 @default.
• W2095108585 cites W2077783035 @default.
• W2095108585 cites W2078092202 @default.
• W2095108585 cites W2080776632 @default.
• W2095108585 cites W2085576934 @default.
• W2095108585 cites W2085898972 @default.
• W2095108585 cites W2093530104 @default.
• W2095108585 cites W2095495393 @default.
• W2095108585 cites W2110727504 @default.
• W2095108585 cites W2121358285 @default.
• W2095108585 cites W2122616238 @default.
• W2095108585 cites W2133264846 @default.
• W2095108585 cites W2135905023 @default.
• W2095108585 cites W2136781148 @default.
• W2095108585 cites W2143146123 @default.
• W2095108585 cites W2145684092 @default.
• W2095108585 cites W2148896458 @default.
• W2095108585 cites W2150796809 @default.
• W2095108585 cites W2164329598 @default.
• W2095108585 cites W2164966658 @default.
• W2095108585 cites W2210241620 @default.
• W2095108585 cites W2460419807 @default.
• W2095108585 doi "https://doi.org/10.1074/jbc.m109802200" @default.
• W2095108585 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/11960979" @default.
• W2095108585 hasPublicationYear "2002" @default.
• W2095108585 type Work @default.
• W2095108585 sameAs 2095108585 @default.
• W2095108585 citedByCount "72" @default.
• W2095108585 countsByYear W20951085852012 @default.
• W2095108585 countsByYear W20951085852014 @default.
• W2095108585 countsByYear W20951085852015 @default.
• W2095108585 countsByYear W20951085852017 @default.
• W2095108585 countsByYear W20951085852019 @default.
• W2095108585 countsByYear W20951085852020 @default.
• W2095108585 countsByYear W20951085852021 @default.
• W2095108585 countsByYear W20951085852022 @default.
• W2095108585 crossrefType "journal-article" @default.
• W2095108585 hasAuthorship W2095108585A5014722516 @default.
• W2095108585 hasAuthorship W2095108585A5033411437 @default.
• W2095108585 hasAuthorship W2095108585A5057713565 @default.
• W2095108585 hasAuthorship W2095108585A5058267557 @default.
• W2095108585 hasAuthorship W2095108585A5090240499 @default.
• W2095108585 hasBestOaLocation W20951085851 @default.
• W2095108585 hasConcept C104317684 @default.
• W2095108585 hasConcept C138885662 @default.
• W2095108585 hasConcept C153911025 @default.
• W2095108585 hasConcept C179926584 @default.
• W2095108585 hasConcept C181199279 @default.
• W2095108585 hasConcept C185592680 @default.
• W2095108585 hasConcept C2777622882 @default.
• W2095108585 hasConcept C2909202170 @default.
• W2095108585 hasConcept C36823959 @default.
• W2095108585 hasConcept C41895202 @default.
• W2095108585 hasConcept C54355233 @default.
• W2095108585 hasConcept C55493867 @default.
• W2095108585 hasConcept C86803240 @default.
• W2095108585 hasConcept C95444343 @default.

• next