FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2095290717> ?p ?o ?g. }

• W2095290717 endingPage "1780" @default.
• W2095290717 startingPage "1771" @default.
• W2095290717 abstract "Collagen degradation by matrix metalloproteinases is the limiting step in reversing liver fibrosis. Although collagen production in cirrhotic livers is increased, the expression and/or activity of matrix metalloproteinases could be normal, increased in early fibrosis, or decreased during advanced liver cirrhosis. Hepatic stellate cells are the main producers of collagens and matrix metalloproteinases in the liver. Therefore, we sought to investigate whether they simultaneously produce α1(I) collagen and matrix metalloproteinase-13 mRNAs. In this communication we show that expression of matrix metalloproteinase-13 mRNA is reciprocally modulated by tumor necrosis factor-α and transforming growth factor-β1. When hepatic stellate cells are co-cultured with hepatocytes, matrix metalloproteinase-13 mRNA is up-regulated and α1(I) collagen is down-regulated. Injuring hepatocytes with galactosamine further increased matrix metalloproteinase-13 mRNA production. Confocal microscopy and differential centrifugation of co-cultured cells revealed that matrix metalloproteinase-13 is localized mainly within hepatic stellate cells. Studies performed with various hepatic stellate cell lines revealed that they are heterogeneous regarding expression of matrix metalloproteinase-13. Those with myofibroblastic phenotypes produce more type I collagen whereas those resembling freshly isolated hepatic stellate cells express matrix metalloproteinase-13. Overall, these findings strongly support the notion that α1(I) collagen and matrix metalloproteinase-13 mRNAs are reciprocally modulated. Collagen degradation by matrix metalloproteinases is the limiting step in reversing liver fibrosis. Although collagen production in cirrhotic livers is increased, the expression and/or activity of matrix metalloproteinases could be normal, increased in early fibrosis, or decreased during advanced liver cirrhosis. Hepatic stellate cells are the main producers of collagens and matrix metalloproteinases in the liver. Therefore, we sought to investigate whether they simultaneously produce α1(I) collagen and matrix metalloproteinase-13 mRNAs. In this communication we show that expression of matrix metalloproteinase-13 mRNA is reciprocally modulated by tumor necrosis factor-α and transforming growth factor-β1. When hepatic stellate cells are co-cultured with hepatocytes, matrix metalloproteinase-13 mRNA is up-regulated and α1(I) collagen is down-regulated. Injuring hepatocytes with galactosamine further increased matrix metalloproteinase-13 mRNA production. Confocal microscopy and differential centrifugation of co-cultured cells revealed that matrix metalloproteinase-13 is localized mainly within hepatic stellate cells. Studies performed with various hepatic stellate cell lines revealed that they are heterogeneous regarding expression of matrix metalloproteinase-13. Those with myofibroblastic phenotypes produce more type I collagen whereas those resembling freshly isolated hepatic stellate cells express matrix metalloproteinase-13. Overall, these findings strongly support the notion that α1(I) collagen and matrix metalloproteinase-13 mRNAs are reciprocally modulated. Liver fibrosis results from excess deposition of extracellular matrix components, mainly type I collagen that is produced by hepatic stellate cells (HSCs).1Eng FJ Friedman SL Fibrogenesis I: new insights into hepatic stellate cell activation: the simple becomes complex.Am J Physiol. 2000; 279: G7-G11PubMed Google Scholar, 2Pinzani M Marra F Cytokine receptors and signaling in hepatic stellate cells.Semin Liver Dis. 2001; 21: 397-416Crossref PubMed Scopus (406) Google Scholar, 3Rockey DC Hepatic blood flow regulation by stellate cells in normal and injured liver.Semin Liver Dis. 2001; 21: 337-349Crossref PubMed Scopus (180) Google Scholar, 4Geerts A History, heterogeneity, developmental biology, and functions of quiescent hepatic stellate cells.Semin Liver Dis. 2001; 21: 311-335Crossref PubMed Scopus (614) Google Scholar These cells can undergo a phenotypic change named activation. During activation HSCs acquire a different morphology and function, express higher levels of fibrillar collagens, and develop a contractile apparatus that includes the up-regulation of nonskeletal myosin and α-actin.1Eng FJ Friedman SL Fibrogenesis I: new insights into hepatic stellate cell activation: the simple becomes complex.Am J Physiol. 2000; 279: G7-G11PubMed Google Scholar, 2Pinzani M Marra F Cytokine receptors and signaling in hepatic stellate cells.Semin Liver Dis. 2001; 21: 397-416Crossref PubMed Scopus (406) Google Scholar, 3Rockey DC Hepatic blood flow regulation by stellate cells in normal and injured liver.Semin Liver Dis. 2001; 21: 337-349Crossref PubMed Scopus (180) Google Scholar, 4Geerts A History, heterogeneity, developmental biology, and functions of quiescent hepatic stellate cells.Semin Liver Dis. 2001; 21: 311-335Crossref PubMed Scopus (614) Google Scholar, 5Ogata I Saez CG Greenwel P Ponce ML Geerts A Leinwand L Rojkind M Rat liver fat-storing cell lines express sarcomeric myosin heavy chain mRNA and protein.Cell Motil Cytoskel. 1993; 26: 125-132Crossref PubMed Scopus (15) Google Scholar Although the activity of matrix metalloproteinases (MMPs) may be normal or increased6Maruyama K Feinman L Okazaki I Lieber CS Direct measurement of neutral collagenase activity in homogenates from baboon and human liver.Biochim Biophys Acta. 1981; 658: 124-131Crossref PubMed Scopus (48) Google Scholar, 7Maruyama K Feinman L Fainsilber Z Nakano M Okazaki I Lieber CS Mammalian collagenase increases in early alcoholic liver disease and decreases with cirrhosis.Life Sci. 1982; 30: 1379-1384Crossref PubMed Scopus (105) Google Scholar and the half-life of collagen I and III is decreased by 50%,8Rojkind M Role of metalloproteinases in liver fibrosis.Alcohol Clin Exp Res. 1999; 23: 934-939Crossref PubMed Scopus (23) Google Scholar the capacity of HSCs to degrade fibrillar collagens may be hampered by two key factors: firstly, lack of access to digest collagen fibrils within thick, highly cross-linked collagen bundles;8Rojkind M Role of metalloproteinases in liver fibrosis.Alcohol Clin Exp Res. 1999; 23: 934-939Crossref PubMed Scopus (23) Google Scholar, 9Vater CA Harris Jr, ED Siegel RC Native cross-links in collagen fibrils induce resistance to human synovial collagenase.Biochem J. 1979; 181: 639-649Crossref PubMed Scopus (186) Google Scholar and secondly, the up-regulation of tissue inhibitors of metalloproteinases (TIMPs) that blocks MMP activity.10Knittel T Mehde M Kobold D Saile B Dinter C Ramadori G Expression patterns of matrix metalloproteinases and their inhibitors in parenchymal and non-parenchymal cells of rat liver: regulation by TNF-alpha and TGF-beta1.J Hepatol. 1999; 30: 48-60Abstract Full Text Full Text PDF PubMed Scopus (290) Google Scholar, 11Knittel T Mehde M Grundmann A Saile B Scharf JG Ramadori G Expression of matrix metalloproteinases and their inhibitors during hepatic tissue repair in the rat.Histochem Cell Biol. 2000; 113: 443-453Crossref PubMed Scopus (207) Google Scholar, 12Arthur MJ Iredale JP Mann DA Tissue inhibitors of metalloproteinases: role in liver fibrosis and alcoholic liver disease.Alcohol Clin Exp Res. 1999; 23: 940-943PubMed Google Scholar, 13McCrudden R Iredale JP Liver fibrosis, the hepatic stellate cell and tissue inhibitors of metalloproteinases.Histol Histopathol. 2000; 15: 1159-1168PubMed Google Scholar, 14Arthur MJ Fibrogenesis II: metalloproteinases and their inhibitors in liver fibrosis.Am J Physiol. 2000; 279: G245-G249Google Scholar, 15Benyon RC Arthur MJ Extracellular matrix degradation and the role of hepatic stellate cells.Semin Liver Dis. 2001; 21: 373-384Crossref PubMed Scopus (447) Google Scholar, 16Arthur MJ Mann DA Iredale JP Tissue inhibitors of metalloproteinases, hepatic stellate cells and liver fibrosis.J Gastroenterol Hepatol. 1998; 13: S33-S38PubMed Google Scholar Indeed, under conditions in which TIMP-1 is overexpressed17Yoshiji H Kuriyama S Miyamoto Y Thorgeirsson UP Gomez DE Kawata M Yoshii J Ikenaka Y Noguchi R Tsujinoue H Nakatani T Thorgeirsson SS Fukui H Tissue inhibitor of metalloproteinases-1 promotes liver fibrosis development in a transgenic mouse model.Hepatology. 2000; 32: 1248-1254Crossref PubMed Scopus (237) Google Scholar or its expression up-regulated,18Iredale JP Benyon RC Arthur MJ Ferris WF Alcolado R Winwood PJ Clark N Murphy G Tissue inhibitor of metalloproteinase-1 messenger RNA expression is enhanced relative to interstitial collagenase messenger RNA in experimental liver injury and fibrosis.Hepatology. 1996; 24: 176-184Crossref PubMed Google Scholar, 19Greenwel P Rojkind M Accelerated development of liver fibrosis in CCl4-treated rats by the weekly induction of acute phase response episodes: upregulation of alpha1(I) procollagen and tissue inhibitor of metalloproteinase-1 mRNAs.Biochim Biophys Acta. 1997; 1361: 177-184Crossref PubMed Scopus (21) Google Scholar there is increased accumulation of collagen in the liver. Conversely, during resolution of liver fibrosis in a reversible rat model, interstitial collagenase expression (MMP-1/MMP-13) remains unaltered, whereas TIMP-1 and TIMP-2 expression is down-regulated.20Iredale JP Benyon RC Pickering J McCullen M Northrop M Pawley S Hovell C Arthur MJ Mechanisms of spontaneous resolution of rat liver fibrosis. Hepatic stellate cell apoptosis and reduced hepatic expression of metalloproteinase inhibitors.J Clin Invest. 1998; 102: 538-549Crossref PubMed Scopus (940) Google Scholar Another important event taking place during resolution of liver fibrosis is apoptosis of myofibroblasts with concomitant decrease in α-smooth muscle-positive cells.20Iredale JP Benyon RC Pickering J McCullen M Northrop M Pawley S Hovell C Arthur MJ Mechanisms of spontaneous resolution of rat liver fibrosis. Hepatic stellate cell apoptosis and reduced hepatic expression of metalloproteinase inhibitors.J Clin Invest. 1998; 102: 538-549Crossref PubMed Scopus (940) Google Scholar Indeed, data in the literature have documented a higher susceptibility of activated cells to undergo apoptosis than quiescent HSCs.21Saile B Knittel T Matthes N Schott P Ramadori G CD95/CD95L-mediated apoptosis of the hepatic stellate cell. A mechanism terminating uncontrolled hepatic stellate cell proliferation during hepatic tissue repair.Am J Pathol. 1997; 151: 1265-1272PubMed Google Scholar Based on these findings, it is difficult to reconcile the sustained expression of MMPs observed during resolution of liver fibrosis,20Iredale JP Benyon RC Pickering J McCullen M Northrop M Pawley S Hovell C Arthur MJ Mechanisms of spontaneous resolution of rat liver fibrosis. Hepatic stellate cell apoptosis and reduced hepatic expression of metalloproteinase inhibitors.J Clin Invest. 1998; 102: 538-549Crossref PubMed Scopus (940) Google Scholar, 22Iredale JP Hepatic stellate cell behavior during resolution of liver injury.Semin Liver Dis. 2001; 21: 427-436Crossref PubMed Scopus (296) Google Scholar unless MMPs are produced preferentially by nonactivated HSCs. Indeed, this possibility is supported by the observation that collagen and MMP-13 production are reciprocally modulated in cultured HSCs.8Rojkind M Role of metalloproteinases in liver fibrosis.Alcohol Clin Exp Res. 1999; 23: 934-939Crossref PubMed Scopus (23) Google Scholar Accordingly, cells that produce an excess of type I collagen, such as myofibroblast within fibrous septa, should express less MMPs than quiescent HSCs expressing low levels of type I collagen. To test this hypothesis we took advantage of several HSC clones developed in our laboratory that have distinct phenotypes.23Greenwel P Schwartz M Rosas M Peyrol S Grimaud JA Rojkind M Characterization of fat-storing cell lines derived from normal and CCl4-cirrhotic livers: differences in the production of interleukin-6.Lab Invest. 1991; 65: 644-653PubMed Google Scholar, 24Greenwel P Rubin J Schwartz M Hertzberg E Rojkind M Liver fat-storing cell clones obtained from a CCl4-cirrhotic rat are heterogeneous with regard to proliferation, expression of extracellular matrix components, interleukin-6 and connexin 43.Lab Invest. 1993; 69: 210-216PubMed Google Scholar Although two of these clones resemble quiescent HSCs, two others are more myofibroblastic. In this communication we show that those clones with a myofibroblastic phenotype expressing high levels of α1(I) procollagen and elastin mRNAs, do not express MMP-2 or MMP-13, and that these MMPs cannot be induced by tumor necrosis factor (TNF)-α. Conversely, those HSC clones expressing lower levels of α1(I) collagen and elastin mRNA express these MMPs that are further induced by TNF-α or by co-culture with hepatocytes. We also showed that when co-cultured with HSCs, hepatocytes induce MMP-13 mRNA expression while down-regulating α1(I) collagen gene expression. Moreover, similar to events occurring during wound healing in skin,25Liu X Levenson SM Chang TH Steinberg JJ Imegwu O Rojkind M Molecular mechanisms underlying wound healing acceleration by Staphylococcus aureus peptidoglycan.Wound Repair Regen. 1996; 4: 470-476Crossref PubMed Scopus (11) Google Scholar hepatocyte injury induced with galactosamine further up-regulates MMP-13 mRNA expression. Minimum essential medium was purchased from Mediatech, Inc. (Herndon, VA). Nonessential amino acids, penicillin, and streptomycin were obtained from Life Technologies, Inc. (Rockville, MD). Bovine serum albumin and acetone were purchased from Sigma Chemical Co. (St. Louis, MO). TNF-α, transforming growth factor (TGF)-β1, and the protease inhibitor cocktail Complete were obtained from Roche Molecular Biochemicals (Indianapolis, IN). Affi-gel and horseradish peroxidase-conjugated goat anti-mouse IgG were obtained from Bio-Rad Life Science Research Products (Hercules, CA). [α-32P]-dCTP was obtained from Amersham Life Science (Arlington Heights, IL). NFSC and CFSC cell lines derived from normal and CCl4-fibrotic rat livers have been previously characterized.23Greenwel P Schwartz M Rosas M Peyrol S Grimaud JA Rojkind M Characterization of fat-storing cell lines derived from normal and CCl4-cirrhotic livers: differences in the production of interleukin-6.Lab Invest. 1991; 65: 644-653PubMed Google Scholar, 24Greenwel P Rubin J Schwartz M Hertzberg E Rojkind M Liver fat-storing cell clones obtained from a CCl4-cirrhotic rat are heterogeneous with regard to proliferation, expression of extracellular matrix components, interleukin-6 and connexin 43.Lab Invest. 1993; 69: 210-216PubMed Google Scholar Clones CFSC-8B, CFSC-3H, CFSC-2G, and CFSC-5H were derived from the CFSC line as described.24Greenwel P Rubin J Schwartz M Hertzberg E Rojkind M Liver fat-storing cell clones obtained from a CCl4-cirrhotic rat are heterogeneous with regard to proliferation, expression of extracellular matrix components, interleukin-6 and connexin 43.Lab Invest. 1993; 69: 210-216PubMed Google Scholar All clones expressed known markers of HSCs, including α-smooth muscle actin, glial fibrillary acidic protein, and nestin. Cells (1 × 106) were cultured in minimum essential medium with l-glutamine supplemented with 10% fetal bovine serum, nonessential amino acids, 100 IU/ml penicillin, and 100 μg/ml streptomycin at 37°C in a humidified atmosphere with 5% CO2 until they reached confluence (48 hours). After this time, the medium was replaced by a serum-free medium containing 0.2% bovine serum albumin and cells were further incubated for 24 hours. For time-course experiments, HSC clones were plated and maintained in culture for various time periods using the same culture conditions described above (see specific experiments). In some experiments, CFSC-8Bs were cultured as described above and the serum-containing minimum essential medium replaced with a serum-free medium that contained 0.2% bovine serum albumin. These cells were cultured for an additional period of 12 hours followed by treatment with TNF-α (20 ng/ml) for 12 hours. Controls consisted of HSCs maintained in culture under identical conditions but without the addition of cytokine. Primary cultures of mouse HSCs prepared as previously described26Inagaki Y Truter S Garret LA De Crombrugghe B Nemoto T Kobayashi K Greenwel P Activation of proα2(I) collagen promoter during hepatic fibrogenesis in transgenic mice.Biochem Biophys Res Commun. 1998; 250: 606-611Crossref PubMed Scopus (33) Google Scholar were used for some experiments. These cells were cultured in serum-free medium as described for rat HSC clones and treated with either 20 ng/ml of TNF-α or 8 ng/ml of TGF-β1. Twenty-four hours after incubation with each cytokine, cells were harvested for extraction of total RNA and Northern analysis of α1(I) collagen, MMP-13, and S14 mRNAs. Total RNA was extracted from HSC cultures and co-cultures by the method of Chomczynski and Sacchi.27Chomczynski P Sacchi N Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.Anal Biochem. 1987; 162: 156-159Crossref PubMed Scopus (63230) Google Scholar Aliquots of 10 μg of RNA were subjected to electrophoresis on 1% agarose-formaldehyde gels and transferred to nylon membranes (GeneScreen; Dupont, Boston, MA). Prehybridizations and hybridizations were performed as previously described.23Greenwel P Schwartz M Rosas M Peyrol S Grimaud JA Rojkind M Characterization of fat-storing cell lines derived from normal and CCl4-cirrhotic livers: differences in the production of interleukin-6.Lab Invest. 1991; 65: 644-653PubMed Google Scholar, 24Greenwel P Rubin J Schwartz M Hertzberg E Rojkind M Liver fat-storing cell clones obtained from a CCl4-cirrhotic rat are heterogeneous with regard to proliferation, expression of extracellular matrix components, interleukin-6 and connexin 43.Lab Invest. 1993; 69: 210-216PubMed Google Scholar The following 32P-labeled cDNA probes were used: rat α1(I) procollagen28Genovese C Rowe D Kream B Construction of DNA sequences complementary to rat α(1) and α(2) collagens mRNA and their use in studying the regulation of type I collagen synthesis by 1,25-dihydroxyvitamin D.Biochemistry. 1984; 23: 6210-6216Crossref PubMed Scopus (546) Google Scholar fibronectin,29Schwarzbauer JE Tamkun JW Lemischka IR Hynes RO Three different fibronectin mRNAs arise by alternative splicing within the coding region.Cell. 1983; 35: 421-431Abstract Full Text PDF PubMed Scopus (483) Google Scholar MMP-13,30Henriet P Rousseau GG Eeckhout Y Cloning and sequencing of mouse collagenase cDNA. Divergence of mouse and rat collagenases from the other mammalian collagenases.FEBS Lett. 1992; 310: 175-178Abstract Full Text PDF PubMed Scopus (116) Google Scholar MMP-2,31Reponen P Sahlberg C Huhtala P Hurskainen T Thesleff I Tryggvason K Molecular cloning of murine 72-kDa type IV collagenase and its expression during mouse development.J Biol Chem. 1992; 267: 7856-7862Abstract Full Text PDF PubMed Google Scholar TIMP-1,32Coulombe B Skup D In vitro synthesis of the active tissue inhibitor of metalloproteinases encoded by a complementary DNA from virus-infected murine fibroblasts.J Biol Chem. 1988; 263: 1439-1443Abstract Full Text PDF PubMed Google Scholar MMP-9,33Thesleff I Tryggvason K High expression of 92-kDa type IV collagenase (gelatinase B) in the osteoclasts lineage during mouse development.J Cell Biol. 1994; 124: 1091-1102Crossref PubMed Scopus (250) Google Scholar colony-stimulating factor-1 (CSF-1), ribosomal protein S14, and human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (ATCC, Rockville, MD). The relative intensities of the generated [α-32P]-cDNA/mRNA signals were determined either by phosphor imaging analysis (Molecular Dynamics, Sunnyvale, CA) or by densitometric analysis of autoradiographies. Values are reported as means of triplicate experiments ± SD after correcting for loading differences using the signals generated by GAPDH or S14 ribosomal protein mRNAs. In some experiments we measured the expression of albumin, α1(I) collagen and MMP-13 mRNA by RT-PCR following standard procedures.34Beverley SM Amplification of RNA by PCR.in: Ausubel FM Brent R Kingston RE Moore DD Seidman JG Smith JA Struhl K Current Protocols in Molecular Biology. vol 2. Wiley Interscience, New York1992: 15.4.1-15.4.6Google Scholar For these experiments, the following primers were used: albumin, 5′AAGGCACCCCGATTACTCCG3′ and 5′TGCGAAGTCACCCATCACCG3′; MMP-13, 5′AAAGAACATGGTGACTTCTACC3′ and 5′ACTGGATTCCTTGAACGTC3′; α1(I) collagen, 5′GACATCCCTGAAGTCAGCTGC3′ and 5′TCCCTTGGGTCCCTCGAC3′. The concentrations of primers and the number of amplification cycles required to obtain linear rates was determined experimentally. For albumin, amplification primer concentration was 0.05 μmol/L and the number of cycles 16. For α1(I) collagen, primer concentration was 0.2 μmol/L and the number of cycles 23. For MMP-13 primer concentration was 0.5 μmol/L and the number of cycles 29. CFSC-8B and CFSC-3H were co-cultured at different ratios as indicated in the text. Cells were cultured in minimum essential medium supplemented with 10% fetal bovine serum, nonessential amino acids, and antibiotics until they reached confluence (48 hours). After this time, the medium was replaced with a serum-free medium containing 0.2% bovine serum albumin. Approximately 24 hours after replacing the culture medium, total RNA was extracted as described above.27Chomczynski P Sacchi N Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.Anal Biochem. 1987; 162: 156-159Crossref PubMed Scopus (63230) Google Scholar Co-cultures were prepared with freshly isolated hepatocytes and the HSC clone CFSC-8B as previously described.35Rojkind M Novikoff PM Greenwel P Rubin J Rojas-Valencia L Campos de Carvalho A Stockert R Spray D Hertzberg EL Wolkoff A Characterization and functional studies on rat liver fat-storing cell line and freshly isolated hepatocyte co-culture system.Am J Pathol. 1995; 276: 1508-1520Google Scholar, 36Fontana L Jerez D Rojas-Valenica L Solis-Herruzo A Greenwel P Rojkind M Ethanol induces the expression of α1(I) procollagen mRNA in a co-culture system containing a liver stellate cell-line and freshly isolated hepatocytes.Biochem Biophys Acta. 1997; 1362: 135-144PubMed Google Scholar Hepatocytes were isolated from Sprague-Dawley rats by a two-step perfusion method using collagenase, as previously described.37Neufeld DS Isolation of rat hepatocytes.Methods Mol Biol. 1997; 75: 145-151PubMed Google Scholar Viability of hepatocytes was determined by the trypan blue exclusion test and only cells with viability greater than 90% were used. Frozen stocks of CFSC-8B were thawed and maintained in culture as described above. Confluent dishes were trypsinized and 1 × 106 cells seeded as described previously. Forty-eight hours after plating, triplicate dishes were used for counting the number of HSCs with a hemocytometer. Co-cultures with freshly isolated hepatocytes were then established by plating the cells at ratios ranging from 1:1 to 5:1 (hepatocytes:HSCs). Co-cultures were maintained for 24 to 48 hours in a serum-free hormonally defined medium35Rojkind M Novikoff PM Greenwel P Rubin J Rojas-Valencia L Campos de Carvalho A Stockert R Spray D Hertzberg EL Wolkoff A Characterization and functional studies on rat liver fat-storing cell line and freshly isolated hepatocyte co-culture system.Am J Pathol. 1995; 276: 1508-1520Google Scholar, 36Fontana L Jerez D Rojas-Valenica L Solis-Herruzo A Greenwel P Rojkind M Ethanol induces the expression of α1(I) procollagen mRNA in a co-culture system containing a liver stellate cell-line and freshly isolated hepatocytes.Biochem Biophys Acta. 1997; 1362: 135-144PubMed Google Scholar and total RNA was extracted as described above.27Chomczynski P Sacchi N Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.Anal Biochem. 1987; 162: 156-159Crossref PubMed Scopus (63230) Google Scholar In duplicate co-cultures maintained for 24 hours, 5 mmol/L of galactosamine was added and 24 hours later culture medium and cells harvested separately. Lactic dehydrogenase was measured in the culture medium using a commercially available kit (Sigma Diagnostics, St. Louis, MO) and total RNA was extracted from the cells. As controls for these experiments we used monocultures of CFSC-8B, and hepatocytes and co-cultures without any treatment. To determine the expression of α1(I) collagen and MMP-13 mRNA in individual cell populations in co-cultures maintained for 48 hours, the culture medium was removed, the cells washed twice with Lefferts medium with EGTA,37Neufeld DS Isolation of rat hepatocytes.Methods Mol Biol. 1997; 75: 145-151PubMed Google Scholar followed by incubation with bacterial collagenase for 5 minutes at 37°C. Detached cells were separated by differential centrifugation as described.37Neufeld DS Isolation of rat hepatocytes.Methods Mol Biol. 1997; 75: 145-151PubMed Google Scholar Total RNA was extracted from the cells and the expression of α1(I) collagen, MMP-13, and albumin mRNAs determined by RT-PCR as described above. HSCs were cultured to confluence, washed with phosphate-buffered saline (PBS), and incubated in serum-free medium for 12 hours. Culture media conditioned by HSCs were removed and proteins precipitated with 50% acetone at 4°C for 1 hour. Pellets were resuspended in 1 ml of 20 mmol/L phosphate buffer, pH 7.1, containing 40 μl of the protease inhibitor cocktail Complete. Before precipitation, excess albumin was eliminated by Affi-gel chromatography following the manufacturer's recommendations. Pellets were resuspended in 2× Laemmli sample buffer38Laemmli UK Cleavage of structural proteins during the assembly of the head of bacteriophage T4.Nature. 1970; 227: 680-685Crossref PubMed Scopus (207487) Google Scholar and protein concentration was determined with the BCA protein assay kit (Pierce, Rockford, IL). HSCs remaining in the culture dishes were lysed by the direct addition of sodium dodecyl sulfate lysis buffer and protein concentration was determined as described above. Aliquots containing 30 μg of protein were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis on 8% polyacrylamide gels and transferred to Immobilon-P membranes (Millipore Co., Bedford, MA). Membranes were blocked for 1 hour in 3% low-fat milk in 50 mmol/L Tris, pH 7.5, 0.5 mol/L NaCl, 0.01% Tween 20, before incubating for 2 hours with a 1:2000 dilution of the MMP-13 monoclonal antibody (Neomarkers, Fremont, CA). After extensive washing of the membranes with Tween 20/Tris-buffered saline, bound antibodies were detected with horseradish peroxidase-conjugated goat anti-mouse IgGs diluted 1:3000 in Tris-buffered saline containing 3% low-fat milk. Membranes were washed and developed with a horseradish peroxidase chemiluminescence detection reagent (ECL Renaissance System; NEN Life Sci Products, Boston, MA). Co-cultures of hepatocytes and CFSC-8B were prepared on coverslips and maintained in culture for 48 hours. Coverslips were rinsed with PBS, fixed with 4% paraformaldehyde for 10 minutes, permeabilized with cold acetone for 15 minutes, and then rinsed with PBS and blocked with 1% bovine serum albumin-2% goat serum for 1 hour. Coverslips were incubated overnight in a humidified chamber with either a monoclonal antibody against MMP-13 (1:200) (see Western Blot Analysis) and polyclonal antibodies against albumin (1:200) (ICN Cappel, Costa Mesa, CA) or an antibody to MMP-13 (1:200) and an anti-desmin antibody (1:10) (ICN Cappel). After several washes with PBS, coverslips were incubated for 1 hour with either one of the following fluorescent-tagged antibodies diluted 1:300: CY3-labeled goat anti-mouse (Chemicon International, Temecula, CA) or fluorescein-labeled goat anti-rabbit (Molecular Probes, Eugene, OR). Coverslips were washed with 0.1%Tween-20/PBS and were mounted on glass slides with Gel/Mount from Biomeda Corp. (Foster City, CA). Images were obtained using AX70 Olympus photomicroscope and a Meridian Ultra confocal microscope and processed with Adobe Photoshop software v5.0.2. We have previously shown that HSCs are heterogeneous regarding expression of α1(I) procollagen mRNA.23Greenwel P Schwartz M Rosas M Peyrol S Grimaud JA Rojkind M Characterization of fat-storing cell lines derived from normal and CCl4-cirrhotic livers: differences in the production of interleukin-6.Lab Invest. 1991; 65: 644-653PubMed Google Scholar, 24Greenwel P Rubin J Schwartz M Hertzberg E Rojkind M Liver fat-storing cell clones obtained from a CCl4-cirrhotic rat are heterogeneous with regard to proliferation, expression of extracellular matrix components, interleukin-6 and connexin 43.Lab Invest. 1993; 69: 210-216PubMed Google Scholar To determine whether HSCs are also heterogeneous regarding expression of MMPs, and whether MMP-2, MMP-9, and/or MMP-13 mRNA levels reciprocally correlate with that of α1(I) procollagen mRNA, the following experiments were performed: Steady-state levels of MMP-2, MMP-9, MMP-13, and TIMP-1 mRNAs in the maternal HSC lines NFSC and CFSC, which are derived from normal and CCl4-cirrhotic rat liver, respectively, were measured. In addition, we determined the levels of expression of these mRNAs in four clones derived from CFSC, namely CFSC-8B, CFSC-2G, CFSC-3H, and CFSC-5H. As shown in Figure 1A, steady-state levels of α1(I) procollagen, MMP-2, and TIMP-1 mRNAs measured in confluent cultures varied significantly among the various HSC clones investigated. Interestingly, only clone CFSC-8B expressed MMP-2 mRNA. Moreover, although all clones expressed TIMP-1 (Figure 1A), neither the maternal CFSC line nor the four clones investigated, expressed MMP-9 (data not shown). In contrast to these findings, none but CFSC-8B expressed measurable levels of MMP-13 mRNA that was up-regulated by TNF-α admi" @default.
• W2095290717 created "2016-06-24" @default.
• W2095290717 creator A5000508186 @default.
• W2095290717 creator A5003011876 @default.
• W2095290717 creator A5006504627 @default.
• W2095290717 creator A5016931621 @default.
• W2095290717 creator A5023142073 @default.
• W2095290717 creator A5026268103 @default.
• W2095290717 creator A5028290370 @default.
• W2095290717 creator A5049992205 @default.
• W2095290717 creator A5060293440 @default.
• W2095290717 date "2003-06-01" @default.
• W2095290717 modified "2023-09-26" @default.
• W2095290717 title "Reciprocal Modulation of Matrix Metalloproteinase-13 and Type I Collagen Genes in Rat Hepatic Stellate Cells" @default.
• W2095290717 cites W108119117 @default.
• W2095290717 cites W1241851957 @default.
• W2095290717 cites W1516990313 @default.
• W2095290717 cites W1517339521 @default.
• W2095290717 cites W1552424392 @default.
• W2095290717 cites W1624994258 @default.
• W2095290717 cites W1901445830 @default.
• W2095290717 cites W1969496486 @default.
• W2095290717 cites W1972765252 @default.
• W2095290717 cites W1974144714 @default.
• W2095290717 cites W1974449373 @default.
• W2095290717 cites W1975694876 @default.
• W2095290717 cites W1978304759 @default.
• W2095290717 cites W1984878174 @default.
• W2095290717 cites W1986603765 @default.
• W2095290717 cites W1988646738 @default.
• W2095290717 cites W1997064567 @default.
• W2095290717 cites W1998931253 @default.
• W2095290717 cites W2009781638 @default.
• W2095290717 cites W2012050910 @default.
• W2095290717 cites W2013105546 @default.
• W2095290717 cites W2016498524 @default.
• W2095290717 cites W2018289835 @default.
• W2095290717 cites W2024602261 @default.
• W2095290717 cites W2025423141 @default.
• W2095290717 cites W2030958462 @default.
• W2095290717 cites W2049859945 @default.
• W2095290717 cites W2050331605 @default.
• W2095290717 cites W2069763463 @default.
• W2095290717 cites W2072558376 @default.
• W2095290717 cites W2077455531 @default.
• W2095290717 cites W2081165103 @default.
• W2095290717 cites W2084164842 @default.
• W2095290717 cites W2100837269 @default.
• W2095290717 cites W2126490617 @default.
• W2095290717 cites W2134812217 @default.
• W2095290717 cites W213902781 @default.
• W2095290717 cites W2155389524 @default.
• W2095290717 cites W2167923772 @default.
• W2095290717 cites W2243440920 @default.
• W2095290717 cites W2266001849 @default.
• W2095290717 cites W2314254441 @default.
• W2095290717 cites W2412710705 @default.
• W2095290717 cites W2415704076 @default.
• W2095290717 cites W25497486 @default.
• W2095290717 cites W4294216491 @default.
• W2095290717 cites W66029348 @default.
• W2095290717 cites W97218433 @default.
• W2095290717 doi "https://doi.org/10.1016/s0002-9440(10)64312-x" @default.
• W2095290717 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/1868138" @default.
• W2095290717 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/12759235" @default.
• W2095290717 hasPublicationYear "2003" @default.
• W2095290717 type Work @default.
• W2095290717 sameAs 2095290717 @default.
• W2095290717 citedByCount "48" @default.
• W2095290717 countsByYear W20952907172012 @default.
• W2095290717 countsByYear W20952907172014 @default.
• W2095290717 countsByYear W20952907172015 @default.
• W2095290717 countsByYear W20952907172016 @default.
• W2095290717 countsByYear W20952907172018 @default.
• W2095290717 countsByYear W20952907172019 @default.
• W2095290717 crossrefType "journal-article" @default.
• W2095290717 hasAuthorship W2095290717A5000508186 @default.
• W2095290717 hasAuthorship W2095290717A5003011876 @default.
• W2095290717 hasAuthorship W2095290717A5006504627 @default.
• W2095290717 hasAuthorship W2095290717A5016931621 @default.
• W2095290717 hasAuthorship W2095290717A5023142073 @default.
• W2095290717 hasAuthorship W2095290717A5026268103 @default.
• W2095290717 hasAuthorship W2095290717A5028290370 @default.
• W2095290717 hasAuthorship W2095290717A5049992205 @default.
• W2095290717 hasAuthorship W2095290717A5060293440 @default.
• W2095290717 hasBestOaLocation W20952907171 @default.
• W2095290717 hasConcept C104317684 @default.
• W2095290717 hasConcept C106487976 @default.
• W2095290717 hasConcept C109523444 @default.
• W2095290717 hasConcept C142724271 @default.
• W2095290717 hasConcept C176891718 @default.
• W2095290717 hasConcept C185592680 @default.
• W2095290717 hasConcept C189165786 @default.
• W2095290717 hasConcept C2777107211 @default.
• W2095290717 hasConcept C2779814568 @default.
• W2095290717 hasConcept C2780644872 @default.
• W2095290717 hasConcept C38008103 @default.
• W2095290717 hasConcept C43617362 @default.

• next