FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2095787470> ?p ?o ?g. }

• W2095787470 endingPage "26646" @default.
• W2095787470 startingPage "26630" @default.
• W2095787470 abstract "We have investigated the impact of persistent intravascular hemolysis on liver dysfunction using the mouse malaria model. Intravascular hemolysis showed a positive correlation with liver damage along with the increased accumulation of free heme and reactive oxidants in liver. Hepatocytes overinduced heme oxygenase-1 (HO-1) to catabolize free heme in building up defense against this pro-oxidant milieu. However, in a condition of persistent free heme overload in malaria, the overactivity of HO-1 resulted in continuous transient generation of free iron to favor production of reactive oxidants as evident from 2′,7′-dichlorofluorescein fluorescence studies. Electrophoretic mobility shift assay documented the activation of NF-κB, which in turn up-regulated intercellular adhesion molecule 1 as evident from chromatin immunoprecipitation studies. NF-κB activation also induced vascular cell adhesion molecule 1, keratinocyte chemoattractant, and macrophage inflammatory protein 2, which favored neutrophil extravasation and adhesion in liver. The infiltration of neutrophils correlated positively with the severity of hemolysis, and neutrophil depletion significantly prevented liver damage. The data further documented the elevation of serum TNFα in infected mice, and the treatment of anti-TNFα antibodies also significantly prevented neutrophil infiltration and liver injury. Deferoxamine, which chelates iron, interacts with free heme and bears antioxidant properties that prevented oxidative stress, NF-κB activation, neutrophil infiltration, hepatocyte apoptosis, and liver damage. Furthermore, the administration of N-acetylcysteine also prevented NF-κB activation, neutrophil infiltration, hepatocyte apoptosis, and liver damage. Thus, hepatic free heme accumulation, TNFα release, oxidative stress, and NF-κB activation established a link to favor neutrophil infiltration in inducing liver damage during hemolytic conditions in malaria. We have investigated the impact of persistent intravascular hemolysis on liver dysfunction using the mouse malaria model. Intravascular hemolysis showed a positive correlation with liver damage along with the increased accumulation of free heme and reactive oxidants in liver. Hepatocytes overinduced heme oxygenase-1 (HO-1) to catabolize free heme in building up defense against this pro-oxidant milieu. However, in a condition of persistent free heme overload in malaria, the overactivity of HO-1 resulted in continuous transient generation of free iron to favor production of reactive oxidants as evident from 2′,7′-dichlorofluorescein fluorescence studies. Electrophoretic mobility shift assay documented the activation of NF-κB, which in turn up-regulated intercellular adhesion molecule 1 as evident from chromatin immunoprecipitation studies. NF-κB activation also induced vascular cell adhesion molecule 1, keratinocyte chemoattractant, and macrophage inflammatory protein 2, which favored neutrophil extravasation and adhesion in liver. The infiltration of neutrophils correlated positively with the severity of hemolysis, and neutrophil depletion significantly prevented liver damage. The data further documented the elevation of serum TNFα in infected mice, and the treatment of anti-TNFα antibodies also significantly prevented neutrophil infiltration and liver injury. Deferoxamine, which chelates iron, interacts with free heme and bears antioxidant properties that prevented oxidative stress, NF-κB activation, neutrophil infiltration, hepatocyte apoptosis, and liver damage. Furthermore, the administration of N-acetylcysteine also prevented NF-κB activation, neutrophil infiltration, hepatocyte apoptosis, and liver damage. Thus, hepatic free heme accumulation, TNFα release, oxidative stress, and NF-κB activation established a link to favor neutrophil infiltration in inducing liver damage during hemolytic conditions in malaria. Correction: Impact of intravascular hemolysis in malaria on liver dysfunction: Involvement of hepatic free heme overload, NF-κB activation, and neutrophil infiltrationJournal of Biological ChemistryVol. 294Issue 52PreviewVOLUME 287 (2012) PAGES 26630–26646 Full-Text PDF Open Access Intravascular hemolysis is a common pathological condition in a wide variety of diseases, including malaria, paroxysmal nocturnal hemoglobinuria, thalassemia, and sickle cell anemia (1Belcher J.D. Beckman J.D. Balla G. Balla J. Vercellotti G. Heme degradation and vascular injury.Antioxid. Redox Signal. 2010; 12: 233-248Crossref PubMed Scopus (172) Google Scholar, 2Kato G.J. Taylor 6th, J.G. Pleiotropic effects of intravascular hemolysis on vascular homeostasis.Br. J. Haematol. 2010; 148: 690-701Crossref PubMed Scopus (59) Google Scholar). Irrespective of the cases, severe hemolysis leads to several systemic complications and severe organ damage (1Belcher J.D. Beckman J.D. Balla G. Balla J. Vercellotti G. Heme degradation and vascular injury.Antioxid. Redox Signal. 2010; 12: 233-248Crossref PubMed Scopus (172) Google Scholar, 3Woollard K.J. Sturgeon S. Chin-Dusting J.P. Salem H.H. Jackson S.P. Erythrocyte hemolysis and hemoglobin oxidation promote ferric chloride-induced vascular injury.J. Biol. Chem. 2009; 284: 13110-13118Abstract Full Text Full Text PDF PubMed Scopus (85) Google Scholar, 4Qian Q. Nath K.A. Wu Y. Daoud T.M. Sethi S. Hemolysis and acute kidney failure.Am. J. Kidney Dis. 2010; 56: 780-784Abstract Full Text Full Text PDF PubMed Scopus (108) Google Scholar, 5Yang F. Haile D.J. Berger F.G. Herbert D.C. Van Beveren E. Ghio A.J. Haptoglobin reduces lung injury associated with exposure to blood.Am. J. Physiol. Lung Cell Mol. Physiol. 2003; 284: L402-L409Crossref PubMed Scopus (62) Google Scholar). Renal failure, liver damage, spleen enlargement, lung injury, vascular injury, and stroke are some of the major complications due to hemolysis (1Belcher J.D. Beckman J.D. Balla G. Balla J. Vercellotti G. Heme degradation and vascular injury.Antioxid. Redox Signal. 2010; 12: 233-248Crossref PubMed Scopus (172) Google Scholar, 3Woollard K.J. Sturgeon S. Chin-Dusting J.P. Salem H.H. Jackson S.P. Erythrocyte hemolysis and hemoglobin oxidation promote ferric chloride-induced vascular injury.J. Biol. Chem. 2009; 284: 13110-13118Abstract Full Text Full Text PDF PubMed Scopus (85) Google Scholar, 4Qian Q. Nath K.A. Wu Y. Daoud T.M. Sethi S. Hemolysis and acute kidney failure.Am. J. Kidney Dis. 2010; 56: 780-784Abstract Full Text Full Text PDF PubMed Scopus (108) Google Scholar, 5Yang F. Haile D.J. Berger F.G. Herbert D.C. Van Beveren E. Ghio A.J. Haptoglobin reduces lung injury associated with exposure to blood.Am. J. Physiol. Lung Cell Mol. Physiol. 2003; 284: L402-L409Crossref PubMed Scopus (62) Google Scholar). Hemolysis leads to the release of free hemoglobin in plasma. Once outside the red blood cells, hemoglobin dissociates to αβ dimers, which are bound by haptoglobin and removed from the circulation (6Kato G.J. Haptoglobin halts hemoglobin's havoc.J. Clin. Invest. 2009; 119: 2140-2142PubMed Google Scholar). However, once hemolysis becomes severe, haptoglobin fails to scavenge all the extracellular hemoglobin (7Tolosano E. Fagoonee S. Hirsch E. Berger F.G. Baumann H. Silengo L. Altruda F. Enhanced splenomegaly and severe liver inflammation in haptoglobin/hemopexin double-null mice after acute hemolysis.Blood. 2002; 100: 4201-4208Crossref PubMed Scopus (116) Google Scholar). Free ferrous hemoglobin in the plasma gets oxidized to ferrihemoglobin, which dissociates to free heme and globin (7Tolosano E. Fagoonee S. Hirsch E. Berger F.G. Baumann H. Silengo L. Altruda F. Enhanced splenomegaly and severe liver inflammation in haptoglobin/hemopexin double-null mice after acute hemolysis.Blood. 2002; 100: 4201-4208Crossref PubMed Scopus (116) Google Scholar). Free heme is removed from the blood by the protein hemopexin (8Smith A. Morgan W.T. Hemopexin-mediated transport of heme into isolated rat hepatocytes.J. Biol. Chem. 1981; 256: 10902-10909Abstract Full Text PDF PubMed Google Scholar, 9Smith A. Morgan W.T. Hemopexin-mediated heme uptake by liver. Characterization of the interaction of heme-hemopexin with isolated rabbit liver plasma membranes.J. Biol. Chem. 1984; 259: 12049-12053Abstract Full Text PDF PubMed Google Scholar), which is taken up by the hepatocytes through receptor-mediated endocytosis. Hemopexin similarly fails to counter the condition when hemolysis is severe and persistent. Under such conditions, free heme concentration is increased in serum. Besides the hemopexin-mediated heme transport to liver, there can be other ways of heme entry inside the liver when the hemopexin is saturated. Extracellular free hemoglobin and free heme is very toxic due to their pro-oxidant nature (10Pal C. Kundu M.K. Bandyopadhyay U. Adhikari S. Synthesis of novel heme-interacting acridone derivatives to prevent free heme-mediated protein oxidation and degradation.Bioorg. Med. Chem. Lett. 2011; 21: 3563-3567Crossref PubMed Scopus (35) Google Scholar, 11Pal C. Bandyopadhyay U. Redox-active antiparasitic drugs.Antioxid. Redox Signal. 2012; 17: 555-582Crossref PubMed Scopus (65) Google Scholar, 12Buehler P.W. D'Agnillo F. Toxicological consequences of extracellular hemoglobin. Biochemical and physiological perspectives.Antioxid. Redox Signal. 2010; 12: 275-291Crossref PubMed Scopus (83) Google Scholar, 13Reeder B.J. Svistunenko D.A. Cooper C.E. Wilson M.T. The radical and redox chemistry of myoglobin and hemoglobin. From in vitro studies to human pathology.Antioxid. Redox Signal. 2004; 6: 954-966Crossref PubMed Scopus (151) Google Scholar, 14Kapralov A. Vlasova I.I. Feng W. Maeda A. Walson K. Tyurin V.A. Huang Z. Aneja R.K. Carcillo J. Bayir H. Kagan V.E. Peroxidase activity of hemoglobin-haptoglobin complexes. Covalent aggregation and oxidative stress in plasma and macrophages.J. Biol. Chem. 2009; 284: 30395-30407Abstract Full Text Full Text PDF PubMed Scopus (78) Google Scholar, 15Kumar S. Bandyopadhyay U. Free heme toxicity and its detoxification systems in human.Toxicol. Lett. 2005; 157: 175-188Crossref PubMed Scopus (613) Google Scholar, 16Rother R.P. Bell L. Hillmen P. Gladwin M.T. The clinical sequelae of intravascular hemolysis and extracellular plasma hemoglobin. A novel mechanism of human disease.JAMA. 2005; 293: 1653-1662Crossref PubMed Scopus (1149) Google Scholar). The heme iron reacts with endogenous H2O2 via the Fenton reaction and Haber-Weiss reaction to produce oxygen free radicals. The hydrophobic nature of heme allows it to intercalate into cell membranes causing the oxidant-mediated killing of cells (15Kumar S. Bandyopadhyay U. Free heme toxicity and its detoxification systems in human.Toxicol. Lett. 2005; 157: 175-188Crossref PubMed Scopus (613) Google Scholar, 17Jeney V. Balla J. Yachie A. Varga Z. Vercellotti G.M. Eaton J.W. Balla G. Pro-oxidant and cytotoxic effects of circulating heme.Blood. 2002; 100: 879-887Crossref PubMed Scopus (508) Google Scholar). The damage to cells and tissue is further aggravated in the presence of H2O2, which causes the release of iron from heme (18Nagababu E. Rifkind J.M. Heme degradation by reactive oxygen species.Antioxid. Redox Signal. 2004; 6: 967-978Crossref PubMed Scopus (170) Google Scholar). Once inside the tissue, toxicity of heme is counteracted by the combination of heme oxygenase-1 (HO-1) 3The abbreviations used are: HO-1heme oxygenase-1DFOdeferoxamine mesylateNACN-acetylcysteineIcam1intercellular adhesion molecule-1Vcam1vascular cell adhesion moleculeKCkeratinocyte chemoattractantMIP-2macrophage inflammatory protein 2ASTaspartate transaminaseALPalkaline phosphataseALTalanine transaminaseDCFDA2′,7′-dichlorodihydrofluorescein diacetateMPOmyeloperoxidaseTNB5-thio-2-nitrobenzoic acidDTNB5,5′-dithiobis-2-nitrobenzoic acidPMNpolymorphonuclear. and ferritin. The action of HO-1 on heme results in the generation of equimolar concentration of iron, biliverdin, and CO (15Kumar S. Bandyopadhyay U. Free heme toxicity and its detoxification systems in human.Toxicol. Lett. 2005; 157: 175-188Crossref PubMed Scopus (613) Google Scholar). Once released, this iron is generally chelated by ferritin (19Orino K. Lehman L. Tsuji Y. Ayaki H. Torti S.V. Torti F.M. Ferritin and the response to oxidative stress.Biochem. J. 2001; 357: 241-247Crossref PubMed Scopus (374) Google Scholar), although the limits of ferritin are not known in pathological conditions. However, in conditions of persistent hemolysis and continuous supply of heme, HO-1 is overinduced and generated huge quantities of free iron, which may cross the limit of its ferritin sequestration. This chaos or failure of the cytoprotective system leads to severe oxidative stress-mediated cell death through necrosis and apoptosis (15Kumar S. Bandyopadhyay U. Free heme toxicity and its detoxification systems in human.Toxicol. Lett. 2005; 157: 175-188Crossref PubMed Scopus (613) Google Scholar, 20Ryter S.W. Tyrrell R.M. The heme synthesis and degradation pathways. Role in oxidant sensitivity. Heme oxygenase has both pro- and antioxidant properties.Free Radic. Biol. Med. 2000; 28: 289-309Crossref PubMed Scopus (661) Google Scholar, 21Balla J. Vercellotti G.M. Jeney V. Yachie A. Varga Z. Jacob H.S. Eaton J.W. Balla G. Heme, heme oxygenase, and ferritin. How the vascular endothelium survives (and dies) in an iron-rich environment.Antioxid. Redox Signal. 2007; 9: 2119-2137Crossref PubMed Scopus (149) Google Scholar). heme oxygenase-1 deferoxamine mesylate N-acetylcysteine intercellular adhesion molecule-1 vascular cell adhesion molecule keratinocyte chemoattractant macrophage inflammatory protein 2 aspartate transaminase alkaline phosphatase alanine transaminase 2′,7′-dichlorodihydrofluorescein diacetate myeloperoxidase 5-thio-2-nitrobenzoic acid 5,5′-dithiobis-2-nitrobenzoic acid polymorphonuclear. Malaria, one of the most devastating infectious diseases, is endemic in 91 countries. Around 40% of the world's population is at risk of acquiring this dreadful infection. Each year, there are 300–500 million cases of malaria and 1.5–2.7 million deaths due to malaria (22Breman J.G. Eradicating malaria.Sci. Prog. 2009; 92: 1-38Crossref PubMed Scopus (38) Google Scholar). Intravascular hemolysis is highly accelerated due to malaria infection (23Seixas E. Gozzelino R. Chora A. Ferreira A. Silva G. Larsen R. Rebelo S. Penido C. Smith N.R. Coutinho A. Soares M.P. Heme oxygenase-1 affords protection against noncerebral forms of severe malaria.Proc. Natl. Acad. Sci. U.S.A. 2009; 106: 15837-15842Crossref PubMed Scopus (217) Google Scholar, 24Larkin D. de Laat B. Jenkins P.V. Bunn J. Craig A.G. Terraube V. Preston R.J. Donkor C. Grau G.E. van Mourik J.A. O'Donnell J.S. Severe Plasmodium falciparum malaria is associated with circulating ultra-large von Willebrand multimers and ADAMTS13 inhibition.PLoS Pathog. 2009; 5: e1000349Crossref PubMed Scopus (103) Google Scholar, 25Fendel R. Brandts C. Rudat A. Kreidenweiss A. Steur C. Appelmann I. Ruehe B. Schröder P. Berdel W.E. Kremsner P.G. Mordmüller B. Hemolysis is associated with low reticulocyte production index and predicts blood transfusion in severe malarial anemia.PLoS ONE. 2010; 5: e10038Crossref PubMed Scopus (37) Google Scholar). In the erythrocytic stage, the malaria parasites modify the erythrocytes (26Haldar K. Hiller N.L. van Ooij C. Bhattacharjee S. Plasmodium parasite proteins and the infected erythrocyte.Trends Parasitol. 2005; 21: 402-403Abstract Full Text Full Text PDF PubMed Scopus (17) Google Scholar) and degrade ∼60–80% of the total RBC hemoglobin (27Francis S.E. Sullivan Jr., D.J. Goldberg D.E. Hemoglobin metabolism in the malaria parasite Plasmodium falciparum.Annu. Rev. Microbiol. 1997; 51: 97-123Crossref PubMed Scopus (661) Google Scholar, 28Bandyopadhyay U. Dey S. Apicomplexan Parasites.in: Becker K. Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, Germany2011: 205-234Crossref Scopus (12) Google Scholar). Severe organ damage has been reported due to malaria infection (15Kumar S. Bandyopadhyay U. Free heme toxicity and its detoxification systems in human.Toxicol. Lett. 2005; 157: 175-188Crossref PubMed Scopus (613) Google Scholar, 28Bandyopadhyay U. Dey S. Apicomplexan Parasites.in: Becker K. Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, Germany2011: 205-234Crossref Scopus (12) Google Scholar, 29Pamplona A. Ferreira A. Balla J. Jeney V. Balla G. Epiphanio S. Chora A. Rodrigues C.D. Gregoire I.P. Cunha-Rodrigues M. Portugal S. Soares M.P. Mota M.M. Heme oxygenase-1 and carbon monoxide suppress the pathogenesis of experimental cerebral malaria.Nat. Med. 2007; 13: 703-710Crossref PubMed Scopus (430) Google Scholar, 30Buffet P.A. Safeukui I. Deplaine G. Brousse V. Prendki V. Thellier M. Turner G.D. Mercereau-Puijalon O. The pathogenesis of Plasmodium falciparum malaria in humans: insights from splenic physiology.Blood. 2011; 117: 381-392Crossref PubMed Scopus (234) Google Scholar, 31Haldar K. Murphy S.C. Milner D.A. Taylor T.E. Malaria. Mechanisms of erythrocytic infection and pathological correlates of severe disease.Annu. Rev. Pathol. 2007; 2: 217-249Crossref PubMed Scopus (156) Google Scholar, 32Postma N.S. Mommers E.C. Eling W.M. Zuidema J. Oxidative stress in malaria; implications for prevention and therapy.Pharm. World Sci. 1996; 18: 121-129Crossref PubMed Scopus (101) Google Scholar, 33Orjih A.U. Banyal H.S. Chevli R. Fitch C.D. Hemin lyses malaria parasites.Science. 1981; 214: 667-669Crossref PubMed Scopus (166) Google Scholar, 34Porto B.N. Alves L.S. Fernández P.L. Dutra T.P. Figueiredo R.T. Graça-Souza A.V. Bozza M.T. Heme induces neutrophil migration and reactive oxygen species generation through signaling pathways characteristic of chemotactic receptors.J. Biol. Chem. 2007; 282: 24430-24436Abstract Full Text Full Text PDF PubMed Scopus (123) Google Scholar). However, the mechanism of organ damage under hemolytic conditions is not yet clear. Here, we provide evidence that intravascular hemolysis in malaria damages liver as a result of increased accumulation of free heme and reactive oxidants in liver, which favor neutrophil infiltration. We demonstrated that heme overload and oxidative stress activated the transcriptional factor NF-κB, which in turn enhanced neutrophil infiltration and extravasation through the up-regulation of intercellular adhesion molecules and chemokines. Furthermore, the chelation of free iron, scavenging of reactive oxidants, and depletion of neutrophil significantly prevented liver damage during malaria in mice. P. yoelii (MDR strain) is grown in vivo in male BALB/c mice (20–25 g) by inoculation of infected blood as described (35Guha M. Kumar S. Choubey V. Maity P. Bandyopadhyay U. Apoptosis in liver during malaria. Role of oxidative stress and implication of mitochondrial pathway.FASEB J. 2006; 20: 1224-1226Crossref PubMed Scopus (158) Google Scholar, 36Dey S. Guha M. Alam A. Goyal M. Bindu S. Pal C. Maity P. Mitra K. Bandyopadhyay U. Malarial infection develops mitochondrial pathology and mitochondrial oxidative stress to promote hepatocyte apoptosis.Free Radic. Biol. Med. 2009; 46: 271-281Crossref PubMed Scopus (62) Google Scholar). Parasite burden in blood (% parasitemia) was monitored by preparing a thin smear of blood and subsequent Giemsa staining. All animals are maintained in the animal house, and procedures were conducted in accordance with the guidelines of the Institutional Animal Ethics Committee and Committee for the Purpose of Control and Supervision of Experiments on Animals. Blood was collected by puncture of the heart from different groups of mice and put into a 1.5-ml microcentrifuge tube. Serum was separated by centrifugation at 600 × g for 5 min and kept at −20 °C. Serum of different groups of mice was diluted (1:100) in distilled water and was analyzed in a spectrophotometer to determine the release of hemoglobin or heme from the erythrocytes in the serum. Although most of the heme in serum probably comes from hemolysis, it could also come from other sources such as muscle cells and hepatocytes. Activity of liver enzymes and bilirubin in serum of mice was measured to assess liver function. Enzyme activities of alanine transaminase (ALT), aspartate transaminase (AST), and alkaline phosphatase (ALP) were measured. We also measured the total amount of bilirubin and conjugated or direct bilirubin in serum. All assays were performed by using kits purchased from Randox Laboratories Ltd. (Ardmore, Antrim, UK). Manufacturers' instructions were strictly followed. These assays served as parameters to evaluate the extent of hemolysis and liver damage in mice. Total heme or free heme was quantified in serum and liver homogenate by using Quantichrome heme assay kit (Bioassay Systems) according to the manufacturer's instructions. HO-1 (Hmox1) activity in liver homogenate was measured based on the amount of bilirubin formed in an assay system as described (37Farombi E.O. Shrotriya S. Na H.K. Kim S.H. Surh Y.J. Curcumin attenuates dimethylnitrosamine-induced liver injury in rats through Nrf2-mediated induction of heme oxygenase-1.Food Chem. Toxicol. 2008; 46: 1279-1287Crossref PubMed Scopus (254) Google Scholar, 38Bindu S. Pal C. Dey S. Goyal M. Alam A. Iqbal M.S. Dutta S. Sarkar S. Kumar R. Maity P. Bandyopadhyay U. Translocation of heme oxygenase-1 to mitochondria is a novel cytoprotective mechanism against nonsteroidal anti-inflammatory drug-induced mitochondrial oxidative stress, apoptosis and gastric mucosal injury.J. Biol. Chem. 2011; 286: 39387-39402Abstract Full Text Full Text PDF PubMed Scopus (84) Google Scholar). Liver excised from a mouse was homogenized in a homogenization buffer (Tris-HCl, pH 7.4, 5 ml/liter Triton X-100, and protease inhibitor mixture). Liver homogenates from different groups of mice were used for the assay. The assay mixture consisted of a 1:1 mixture of liver homogenate (200 μg of protein) and assay buffer (0.8 mm NADPH, 2 mm glucose 6-phosphate, 0.2 units of glucose 6-phosphate dehydrogenase, 1 mm MgCl2, 100 mm potassium phosphate buffer, 20 μm hemin, and 2 mg of mouse liver cytosol as a source of biliverdin reductase). The final volume was made up to 1 ml. The mixture was incubated at 37 °C for 1 h in the dark. Reactions were terminated by keeping the samples on ice for 5 min. The bilirubin formed was extracted in chloroform, and A464–530 was measured. The amount of bilirubin formed was calculated from its extinction coefficient (40 mm/liter/cm) (37Farombi E.O. Shrotriya S. Na H.K. Kim S.H. Surh Y.J. Curcumin attenuates dimethylnitrosamine-induced liver injury in rats through Nrf2-mediated induction of heme oxygenase-1.Food Chem. Toxicol. 2008; 46: 1279-1287Crossref PubMed Scopus (254) Google Scholar). The HO-1 activity was expressed as nanomoles of bilirubin formed per mg of protein/h. TRIzol reagent was used to isolate RNA from the perfused tissue according to the manufacturer's instructions (Invitrogen). Total RNA (2 μg) was then reverse-transcribed using the RevertAid First Strand cDNA synthesis kit (Fermentas) according to the manufacturer's instructions. The cDNA obtained was diluted for PCRs. The primers were purchased from Integrated DNA Technologies Inc. (San Diego). The primers are given along with their product size in Table 1. The cycling conditions for PCR amplification were as follows: initial denaturation at 95 °C for 30 s and 40 cycles of denaturation at 95 °C for 30 s, annealing at 55 °C for 30 s, and extension at 72 °C for 60 s, respectively. The PCR products were detected with 1.5% agarose gel electrophoresis, and densitometric analysis of the bands allowed semi-quantification. The images were captured using Quantity One® software (Bio Rad).TABLE 1Primers for RT-PCRGenesForward primer (5′–3′)Reverse primer (5′–3′)Product sizebpIcam1taagaggactcggtggatggtttccccagactctcacagc347Vcam1ctccacaaggcttcaagaggacgtcagaacaaccgaatcc308Cxcl1tgagctgcgctgtcagtgcctagaagccagcgttcaccaga260Cxcl2gctggccaccaaccaccaggagcgaggcacatcaggtacg357Hmox1gcactatgtaaagcgtctccgactctggtctttgtgttcc353Fth1ctttgccaaatactttctccaaagagatattctgccatgc361ActBgtcagaaggactcctatgtggctcgttgccaatagtgatg618Icam1 promotergagagatgagagggggaagggatccgctgtgagaaagtcc363 Open table in a new tab Liver was perfused for a long time to remove all contaminations of blood cells after which the homogenates were prepared. The perfused liver from different groups of mice was homogenized in a glass homogenizer in buffer (140 mm NaCl, 10 mm EDTA, 10% glycerol, 20 mm Tris, pH 8.0, supplemented with 1% Nonidet P-40 as detergent, and 20.000 units/ml aprotinin, 200 mm PMSF). The samples were then subjected to centrifugation for 20 min at 13,000 × g at 4 °C. The supernatant (liver tissue lysate 70 μg) was mixed with protein loading buffer (Fermentas) and boiled for 4 min. The proteins were separated in a 12% SDS-polyacrylamide gel at constant voltage (100 V). Proteins were then transferred to a nitrocellulose membrane in a transfer apparatus with a current intensity of 400 mA for 120 min in a 190 mm glycine, 20 mm Tris base buffer, pH 8.3. The membrane was incubated for 3 h in the blocking buffer TBS (25 mm Tris, 150 mm NaCl, 2 mm KCl, pH 7.4) to which 5% nonfat dry milk had been added. The mixture was then quickly washed with the same buffer without milk. The membrane was incubated overnight in the last buffer with 0.2% bovine serum albumin (BSA) solution containing 1:1000 anti-HO-1(Abcam), ferritin heavy chain (US Biological), anti-NF-κB p65, IKKβ, IκB-α, and β-actin (Santa Cruz Biotechnology) for separate experiments. The membrane was then washed well with TBS containing 0.1% Tween 20. The membrane was incubated for 2 h in the same buffer containing secondary antibody (1:1000 HRP-labeled anti-rabbit or -goat IgG). The membrane was washed well with the incubation buffer. The protein detection was performed with a standard Western blot detection system. Pre-stained standards were used as molecular weight markers and were run in parallel. Hepatocytes were isolated from liver after perfusion by a two-step collagenase digestion method and purified by Percoll gradient (39Gonçalves L.A. Vigário A.M. Penha-Gonçalves C. Improved isolation of murine hepatocytes for in vitro malaria liver stage studies.Malar. J. 2007; 6: 169Crossref PubMed Scopus (64) Google Scholar). Hepatocytes were then counted and used for further experiments. For the preparation of hepatocyte lysates, cells were lysed in 100 μl of buffer (140 mm NaCl, 10 mm EDTA, 10% glycerol, 20 mm Tris, pH 8.0, supplemented with 1% Nonidet P-40 as detergent, and 20,000 units/ml aprotinin, 200 mm PMSF) by three freeze-thaw cycles and sonication, and the cytosolic fraction was prepared by centrifugation at 13,000 × g for 20 min at 4 °C. Protein content in supernatant was determined by the method of Lowry et al. (40Lowry O.H. Rosebrough N.J. Farr A.L. Randall R.J. Protein measurement with the Folin phenol reagent.J. Biol. Chem. 1951; 193: 265-275Abstract Full Text PDF PubMed Google Scholar). An equal amount of protein was used for Western immunoblotting (41Kim Y.M. de Vera M.E. Watkins S.C. Billiar T.R. Nitric oxide protects cultured rat hepatocytes from tumor necrosis factor-α-induced apoptosis by inducing heat shock protein 70 expression.J. Biol. Chem. 1997; 272: 1402-1411Abstract Full Text Full Text PDF PubMed Scopus (500) Google Scholar). Hepatocytes isolated from different groups of mice were loaded with DCFDA (10 μm) (Molecular Probes, Eugene, OR) for 30 min in the dark. Images were captured on a fluorescence microscope using a green filter. Upon oxidation, DCFDA exhibited bright green fluorescence (excitation/emission maxima ∼490/515 nm), which was viewed under Leica DM 2500 fluorescence microscope (Leica Microsystems, GmbH, Wetzlar, Germany) (42Kalyanaraman B. Darley-Usmar V. Davies K.J. Dennery P.A. Forman H.J. Grisham M.B. Mann G.E. Moore K. Roberts 2nd, L.J. Ischiropoulos H. Measuring reactive oxygen and nitrogen species with fluorescent probes. Challenges and limitations.Free Radic. Biol. Med. 2012; 52: 1-6Crossref PubMed Scopus (1257) Google Scholar, 43Maity P. Bindu S. Dey S. Goyal M. Alam A. Pal C. Mitra K. Bandyopadhyay U. Indomethacin, a nonsteroidal anti-inflammatory drug, develops gastropathy by inducing reactive oxygen species-mediated mitochondrial pathology and associated apoptosis in gastric mucosa. A novel role of mitochondrial aconitase oxidation.J. Biol. Chem. 2009; 284: 3058-3068Abstract Full Text Full Text PDF PubMed Scopus (100) Google Scholar). Nuclear extract from liver tissue was prepared with the help of two nuclear extraction buffers: Buffer I (10 mm HEPES, 1.5 mm MgCl2, 10 mm KCl, and 0.5% Triton X-100) and Buffer II (1 m NaCl, 0.2 m EDTA, 20% glycerol and 0.5 mm DTT). Liver tissues from different groups of mice were minced in the presence of Buffer I and then homogenized. The sample was then centrifuged, and the cytosol was separated. The pellet was resuspended in a mixture of Buffers I and II (1:1). The samples were vigorously vortexed for 30 s, kept on ice for the next 30 min, and centrifuged at high speed at 4 °C. The supernatants obtained were nuclear extracts and were stored at −80 °C until use. NF-κB double-stranded consensus oligonucleotides 5′-AGTTGAGGGGACTTTCCCAGGC-3′ and 3′-TCAACTCCCCTGAAAGGGTCCG-5′ (44Sajan M.P. Standaert M.L. Nimal S. Varanasi U. Pastoor T. Mastorides S. Braun U. Leitges M. Farese R.V. The critical role of atypical protein kinase C in activating hepatic SREBP-1c and NF-κB in obesity.J. Lipid Res. 2009; 50: 1133-1145Abstract Full Text Full Text PDF PubMed Scopus (50) Google Scholar, 45Fouad D. Siendones E. Costán G. Muntané J. Role of NF-κB activation and nitric oxide expression during PGE protection against d-galactosamine-induced cell death in cultured rat hepatocytes.Liver Int. 2004; 24: 227-236Crossref PubMed Scopus (17)" @default.
• W2095787470 created "2016-06-24" @default.
• W2095787470 creator A5005570162 @default.
• W2095787470 creator A5012898753 @default.
• W2095787470 creator A5014964203 @default.
• W2095787470 creator A5015603057 @default.
• W2095787470 creator A5024050842 @default.
• W2095787470 creator A5050385668 @default.
• W2095787470 creator A5063116970 @default.
• W2095787470 creator A5083860067 @default.
• W2095787470 creator A5090154704 @default.
• W2095787470 date "2012-08-01" @default.
• W2095787470 modified "2023-09-27" @default.
• W2095787470 title "Impact of Intravascular Hemolysis in Malaria on Liver Dysfunction" @default.
• W2095787470 cites W1483837838 @default.
• W2095787470 cites W1520993960 @default.
• W2095787470 cites W1533671266 @default.
• W2095787470 cites W1549692527 @default.
• W2095787470 cites W1557884422 @default.
• W2095787470 cites W1600806957 @default.
• W2095787470 cites W1603028832 @default.
• W2095787470 cites W1655162787 @default.
• W2095787470 cites W1678613034 @default.
• W2095787470 cites W1775749144 @default.
• W2095787470 cites W1966946965 @default.
• W2095787470 cites W1969148054 @default.
• W2095787470 cites W1974553236 @default.
• W2095787470 cites W1974559428 @default.
• W2095787470 cites W1975042970 @default.
• W2095787470 cites W1975254388 @default.
• W2095787470 cites W1976457313 @default.
• W2095787470 cites W1976484400 @default.
• W2095787470 cites W1981800879 @default.
• W2095787470 cites W1984853657 @default.
• W2095787470 cites W1986391901 @default.
• W2095787470 cites W1989957948 @default.
• W2095787470 cites W1997684038 @default.
• W2095787470 cites W2003590875 @default.
• W2095787470 cites W2005138536 @default.
• W2095787470 cites W2006754144 @default.
• W2095787470 cites W2008550786 @default.
• W2095787470 cites W2016847790 @default.
• W2095787470 cites W2021132204 @default.
• W2095787470 cites W2021650047 @default.
• W2095787470 cites W2025112014 @default.
• W2095787470 cites W2026488328 @default.
• W2095787470 cites W2027900150 @default.
• W2095787470 cites W2030404101 @default.
• W2095787470 cites W2036015712 @default.
• W2095787470 cites W2038924400 @default.
• W2095787470 cites W2040874701 @default.
• W2095787470 cites W2041510906 @default.
• W2095787470 cites W2043689968 @default.
• W2095787470 cites W2045623016 @default.
• W2095787470 cites W2046384678 @default.
• W2095787470 cites W2046928894 @default.
• W2095787470 cites W2058505378 @default.
• W2095787470 cites W2058844821 @default.
• W2095787470 cites W2059149560 @default.
• W2095787470 cites W2059643010 @default.
• W2095787470 cites W2061989529 @default.
• W2095787470 cites W2062396541 @default.
• W2095787470 cites W2062711706 @default.
• W2095787470 cites W2064711537 @default.
• W2095787470 cites W2071896096 @default.
• W2095787470 cites W2074966179 @default.
• W2095787470 cites W2075544155 @default.
• W2095787470 cites W2078762023 @default.
• W2095787470 cites W2082203545 @default.
• W2095787470 cites W2086667809 @default.
• W2095787470 cites W2090047333 @default.
• W2095787470 cites W2091851807 @default.
• W2095787470 cites W2098145015 @default.
• W2095787470 cites W2099536293 @default.
• W2095787470 cites W2110099015 @default.
• W2095787470 cites W2111911518 @default.
• W2095787470 cites W2113703551 @default.
• W2095787470 cites W2119697266 @default.
• W2095787470 cites W2119711891 @default.
• W2095787470 cites W2120724865 @default.
• W2095787470 cites W2120728320 @default.
• W2095787470 cites W2128378359 @default.
• W2095787470 cites W2142702612 @default.
• W2095787470 cites W2147923435 @default.
• W2095787470 cites W2150027863 @default.
• W2095787470 cites W2154658221 @default.
• W2095787470 cites W2155800305 @default.
• W2095787470 cites W2158040122 @default.
• W2095787470 cites W2158826149 @default.
• W2095787470 cites W2160551514 @default.
• W2095787470 cites W2161299344 @default.
• W2095787470 cites W2166781237 @default.
• W2095787470 cites W2169952241 @default.
• W2095787470 cites W2171559922 @default.
• W2095787470 cites W220993559 @default.
• W2095787470 cites W2335925695 @default.
• W2095787470 cites W4245322049 @default.
• W2095787470 cites W4248389956 @default.

• next