FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2095913712> ?p ?o ?g. }

• W2095913712 endingPage "113" @default.
• W2095913712 startingPage "104" @default.
• W2095913712 abstract "Joubert syndrome–related disorders (JSRDs) are a group of clinically and genetically heterogeneous conditions that share a midbrain-hindbrain malformation, the molar tooth sign (MTS) visible on brain imaging, with variable neurological, ocular, and renal manifestations. Mutations in the CEP290 gene were recently identified in families with the MTS-related neurological features, many of which showed oculo-renal involvement typical of Senior-Löken syndrome (JSRD-SLS phenotype). Here, we performed comprehensive CEP290-mutation analysis on two nonoverlapping cohorts of JSRD-affected patients with a proven MTS. We identified mutations in 19 of 44 patients with JSRD-SLS. The second cohort consisted of 84 patients representing the spectrum of other JSRD subtypes, with mutations identified in only two patients. The data suggest that CEP290 mutations are frequently encountered and are largely specific to the JSRD-SLS subtype. One patient with mutation displayed complete situs inversus, confirming the clinical and genetic overlap between JSRDs and other ciliopathies. Joubert syndrome–related disorders (JSRDs) are a group of clinically and genetically heterogeneous conditions that share a midbrain-hindbrain malformation, the molar tooth sign (MTS) visible on brain imaging, with variable neurological, ocular, and renal manifestations. Mutations in the CEP290 gene were recently identified in families with the MTS-related neurological features, many of which showed oculo-renal involvement typical of Senior-Löken syndrome (JSRD-SLS phenotype). Here, we performed comprehensive CEP290-mutation analysis on two nonoverlapping cohorts of JSRD-affected patients with a proven MTS. We identified mutations in 19 of 44 patients with JSRD-SLS. The second cohort consisted of 84 patients representing the spectrum of other JSRD subtypes, with mutations identified in only two patients. The data suggest that CEP290 mutations are frequently encountered and are largely specific to the JSRD-SLS subtype. One patient with mutation displayed complete situs inversus, confirming the clinical and genetic overlap between JSRDs and other ciliopathies. Joubert syndrome (JS [MIM 213300]) is an autosomal recessive disease presenting with hypotonia, ataxia, neonatal breathing abnormalities, oculomotor apraxia, and psychomotor delay.1Joubert M Eisenring JJ Robb JP Andermann F Familial agenesis of the cerebellar vermis: a syndrome of episodic hyperpnea, abnormal eye movements, ataxia, and retardation.Neurology. 1969; 19: 813-825Crossref PubMed Google Scholar, 2Boltshauser E Isler W Joubert syndrome: episodic hyperpnea, abnormal eye movements, retardation and ataxia, associated with dysplasia of the cerebellar vermis.Neuropadiatrie. 1977; 8: 57-66Crossref PubMed Scopus (127) Google Scholar The neuroradiological hallmark of JS is a complex midbrain-hindbrain malformation known as the “molar tooth sign” (MTS), which originates from the association of cerebellar vermis hypoplasia or aplasia, horizontally oriented and thickened superior cerebellar peduncles, and a deepened interpeduncular fossa.3Maria BL Hoang KB Tusa RJ Mancuso AA Hamed LM Quisling RG Hove MT Fennell EB Booth-Jones M Ringdahl DM et al.“Joubert syndrome” revisited: key ocular motor signs with magnetic resonance imaging correlation.J Child Neurol. 1997; 12: 423-430Crossref PubMed Scopus (233) Google Scholar These clinical and neuroradiological features are shared by at least eight distinct syndromes termed “JS-related disorders” (JSRDs), which additionally present with pleiotropic involvement, mainly of the eyes and kidneys.4Gleeson JG Keeler LC Parisi MA Marsh SE Chance PF Glass IA Graham Jr, JM Maria BL Barkovich AJ Dobyns WB Molar tooth sign of the midbrain-hindbrain junction: occurrence in multiple distinct syndromes.Am J Med Genet A. 2004; 125: 125-134Crossref Scopus (182) Google Scholar The four major subgroups of JSRDs include (1) the classic form (MIM 213300), largely restricted to brain involvement and also occasionally displaying retinopathy and postaxial polydactyly but rarely renal involvement; (2) the oculo-renal form (referred to in this article as “JSRD-SLS”), which associates JS neurological features with the Senior-Löken syndrome (SLS [MIM 266900]) phenotype of nephronophthisis (NPH [MIM 256100]) and retinal dystrophy (either Leber congenital amaurosis [LCA {MIM 204000}] or retinitis pigmentosa); (3) the subgroup with preaxial or mesaxial polydactlyly and orofacial defects, such as lobulated tongue, notched upper lip, or cleft lip/palate, known as the “orofacial-digital type VI” (OFDVI, or Varadi-Papp [MIM 277170]) syndrome; and (4) the subgroup with choroidoretinal coloboma and hepatic fibrosis, referred to as the “cerebellar vermis hypoplasia/aplasia, oligophrenia, ataxia, ocular coloboma, and hepatic fibrosis” (COACH [MIM 216360]) syndrome. The genetic bases of JSRDs are only partially understood. Two loci, JBTS1/CORS1 and JBTS2/CORS2, have been mapped to chromosomes 9q34.3 and 11p12-q13.3, respectively, in a limited number of families,5Saar K Al-Gazali L Sztriha L Rueschendorf F Nur-E-Kamal M Reis A Bayoumi R Homozygosity mapping in families with Joubert syndrome identifies a locus on chromosome 9q34.3 and evidence for genetic heterogeneity.Am J Hum Genet. 1999; 65: 1666-1671Abstract Full Text Full Text PDF PubMed Scopus (126) Google Scholar, 6Keeler LC Marsh SE Leeflang EP Woods CG Sztriha L Al-Gazali L Gururaj A Gleeson JG Linkage analysis in families with Joubert syndrome plus oculo-renal involvement identifies the CORS2 locus on chromosome 11p12-q13.3.Am J Hum Genet. 2003; 73: 656-662Abstract Full Text Full Text PDF PubMed Scopus (85) Google Scholar, 7Valente EM Salpietro DC Brancati F Bertini E Galluccio T Tortorella G Briuglia S Dallapiccola B Description, nomenclature, and mapping of a novel cerebello-renal syndrome with the molar tooth malformation.Am J Hum Genet. 2003; 73: 663-670Abstract Full Text Full Text PDF PubMed Scopus (74) Google Scholar whereas mutations in the AHI1 gene have been shown to account for ∼10% of patients with JSRD, who mostly display the classic form of the disease.8Dixon-Salazar T Silhavy JL Marsh SE Louie CM Scott LC Gururaj A Al-Gazali L Al-Tawari AA Kayserili H Sztriha L et al.Mutations in the AHI1 gene, encoding Jouberin, cause Joubert syndrome with cortical polymicrogyria.Am J Hum Genet. 2004; 75: 979-987Abstract Full Text Full Text PDF PubMed Scopus (224) Google Scholar, 9Ferland RJ Eyaid W Collura RV Tully LD Hill RS Al-Nouri D Al-Rumayyan A Topcu M Gascon G Bodell A et al.Abnormal cerebellar development and axonal decussation due to mutations in AHI1 in Joubert syndrome.Nat Genet. 2004; 36: 1008-1013Crossref PubMed Scopus (301) Google Scholar, 9Ferland RJ Eyaid W Collura RV Tully LD Hill RS Al-Nouri D Al-Rumayyan A Topcu M Gascon G Bodell A et al.Abnormal cerebellar development and axonal decussation due to mutations in AHI1 in Joubert syndrome.Nat Genet. 2004; 36: 1008-1013Crossref PubMed Scopus (301) Google Scholar, 10Valente EM Brancati F Silhavy JL Castori M Marsh SE Barrano G Bertini E Boltshauser E Zaki MS Abdel-Aleem A et al.AHI1 gene mutations cause specific forms of Joubert syndrome-related disorders.Ann Neurol. 2006; 59: 527-534Crossref PubMed Scopus (101) Google Scholar, 11Parisi MA Doherty D Eckert ML Shaw DW Ozyurek H Aysun S Giray O Al Swaid A Al Shahwan S Dohayan N et al.AHI1 mutations cause both retinal dystrophy and renal cystic disease in Joubert syndrome.J Med Genet. 2006; 43: 334-339Crossref PubMed Scopus (89) Google Scholar Recently, we and others identified pathogenic mutations in the CEP290 gene, which encodes a centrosomal protein, in 13 families with JSRD.12Valente EM Silhavy JL Brancati F Barrano G Krishnaswami SR Castori M Lancaster MA Boltshauser E Boccone L Al-Gazali L et al.Mutations in CEP290, which encodes a centrosomal protein, cause pleiotropic forms of Joubert syndrome.Nat Genet. 2006; 38: 623-625Crossref PubMed Scopus (282) Google Scholar, 13Sayer JA Otto EA O’Toole JF Nurnberg G Kennedy MA Becker C Hennies HC Helou J Attanasio M Fausett BV et al.The centrosomal protein nephrocystin-6 is mutated in Joubert syndrome and activates transcription factor ATF4.Nat Genet. 2006; 38: 674-681Crossref PubMed Scopus (393) Google Scholar CEP290 protein was localized to the base (centrosome) and stalk of primary cilia, suggesting that JSRDs constitute one of the “cilia-related” group of disorders. This point is strengthened by the clinical overlap between JSRDs and other ciliopathies, including infantile and juvenile NPH (either isolated or associated with retinal dystrophy, which is known as “SLS”), Meckel syndrome (MKS [MIM 249000]), and Bardet-Biedl syndrome (BBS [MIM 209900]).14Hildebrandt F Otto E Cilia and centrosomes: a unifying pathogenic concept for cystic kidney disease?.Nat Rev Genet. 2005; 6: 928-940Crossref PubMed Scopus (244) Google Scholar Further reinforcing this link, NPHP1 homozygous deletions that are a frequent cause of isolated juvenile NPH and SLS and mutations in MKS3 that are usually responsible for MKS have been detected in rare cases of JSRDs.15Parisi MA Bennett CL Eckert ML Dobyns WB Gleeson JG Shaw DW McDonald R Eddy A Chance PF Glass IA The NPHP1 gene deletion associated with juvenile nephronophthisis is present in a subset of individuals with Joubert syndrome.Am J Hum Genet. 2004; 75: 82-91Abstract Full Text Full Text PDF PubMed Scopus (186) Google Scholar, 16Castori M Valente EM Donati MA Salvi S Fazzi E Procopio E Galluccio T Emma F Dallapiccola B Bertini E NPHP1 gene deletion is a rare cause of Joubert syndrome related disorders.J Med Genet. 2005; 42: e9Crossref PubMed Scopus (71) Google Scholar, 17Baala L Romano S Khaddour R Saunier S Smith UM Audollent S Ozilou C Faivre L Laurent N Foliguet B et al.The Meckel-Gruber syndrome gene, MKS3, is mutated in Joubert syndrome.Am J Hum Genet. 2007; 80: 186-194Abstract Full Text Full Text PDF PubMed Scopus (173) Google Scholar Among the 13 families with JSRD with CEP290 mutations reported so far, the majority had JSRD-SLS, in line with the pleiotropic features observed in most ciliopathies. Few patients displayed incomplete phenotypes lacking either renal or retinal involvement and additional signs, such as occipital encephalocele.12Valente EM Silhavy JL Brancati F Barrano G Krishnaswami SR Castori M Lancaster MA Boltshauser E Boccone L Al-Gazali L et al.Mutations in CEP290, which encodes a centrosomal protein, cause pleiotropic forms of Joubert syndrome.Nat Genet. 2006; 38: 623-625Crossref PubMed Scopus (282) Google Scholar, 13Sayer JA Otto EA O’Toole JF Nurnberg G Kennedy MA Becker C Hennies HC Helou J Attanasio M Fausett BV et al.The centrosomal protein nephrocystin-6 is mutated in Joubert syndrome and activates transcription factor ATF4.Nat Genet. 2006; 38: 674-681Crossref PubMed Scopus (393) Google Scholar Intriguingly, mutations in CEP290 have also been shown to be the most frequent cause of isolated LCA, in the absence of any renal and neurological involvement.18den Hollander AI Koenekoop RK Yzer S Lopez I Arends ML Voesenek KE Zonneveld MN Strom TM Meitinger T Brunner HG et al.Mutations in the CEP290 (NPHP6) gene are a frequent cause of Leber congenital amaurosis.Am J Hum Genet. 2006; 79: 556-561Abstract Full Text Full Text PDF PubMed Scopus (443) Google Scholar, 19Perrault I Delphin N Hanein S Gerber S Dufier JL Roche O Defoort-Dhellemmes S Dollfus H Fazzi E Munnich A et al.Spectrum of NPHP6/CEP290 mutations in Leber congenital amaurosis and delineation of the associated phenotype.Hum Mutat. 2007; 28: 416Crossref PubMed Scopus (154) Google Scholar The prevalence of CEP290 mutations among patients with JSRD-SLS, as well as their role in causing other MTS-associated phenotypes and genotype-phenotype correlates, are still unknown. In this study, we sought to address these issues by performing CEP290 mutation analysis in the largest series to date of probands representative of the whole JSRD clinical spectrum. Databases located at the IRCCS CSS, Mendel Institute (Rome) (AISJAC database), at the University of California–San Diego (San Diego) (Center for Cerebellar Malformations), and at the JS Foundation were screened for patients with a definite diagnosis of JSRD and neuroradiologically proven MTS. Patients were referred to these two centers from >20 countries on all continents through European and U.S. referral centers. Samples were obtained from referring physicians or through the JS BioBank. Whenever available, detailed clinical data were collected by means of a standardized questionnaire to assess the possible involvement of all organs, including diagnostic testing for ocular, renal, hepatic, and skeletal features. From these databases, we selected two groups of patients for CEP290 screening. The first cohort consisted of 44 probands with definite or probable JSRD-SLS. Thirty-two patients met the following inclusion criteria for definite JSRD-SLS: (1) presence of MTS, (2) renal signs of NPH (end-stage renal disease [ESRD] and/or typical ultrasound features and/or proof of impaired urinary-concentration ability), and (3) either LCA or progressive retinitis pigmentosa. In this group, we also included 12 children younger than 10 years presenting a cerebello-ocular phenotype with MTS and LCA but with no obvious renal involvement, who had not yet undergone proper urinary-concentration testing or ultrasound examination. In our experience, the risk of a child with LCA within this age group developing a renal disease is >50%; thus, these 12 patients were given diagnoses of “probable JSRD-SLS.” The second cohort consisted of 84 probands representative of the complete spectrum of the remaining subgroups of JSRDs, including classic JS (n=42), JS plus ocular involvement but without renal involvement by age 10 years (n=21), JS plus NPH or cystic kidney disease without retinal involvement (n=5), COACH syndrome (n=6), and OFDVI syndrome (n=5). Five patients had a proven MTS, but clinical details were not sufficient to assign them to a specific phenotypic subgroup. Informed consent was obtained from all families, and the study was approved by the local ethics committees. The 128 probands with JSRD were analyzed for CEP290 mutations after a three-step strategy.10Valente EM Brancati F Silhavy JL Castori M Marsh SE Barrano G Bertini E Boltshauser E Zaki MS Abdel-Aleem A et al.AHI1 gene mutations cause specific forms of Joubert syndrome-related disorders.Ann Neurol. 2006; 59: 527-534Crossref PubMed Scopus (101) Google Scholar In brief, a denaturing high-performance liquid chromatography (DHPLC)–based analysis was first performed on DNA from one parent of each proband. All exons identified as carrying abnormal elution profiles were sequenced in both directions, and, subsequently, all parental mutations were tested in the affected offspring and, in case of homozygosity, in the other parent as well. Finally, heterozygous patients underwent complete gene analysis by direct sequencing in both directions to identify the second mutation. This strategy allowed DNA from affected children (which is usually scarce and difficult to reobtain) to be preserved and DHPLC limits in identifying homozygous mutations to be overcome. PCRs were performed in a final volume of 25 μl containing 40–80 ng genomic DNA, 1 U AmpliTaq Gold (Applied Biosystems), 15 pmol of each primer, 1.5–2 mM MgCl2, 75 μM of each deoxyribonucleotide triphosphate, and 1× PCR Buffer (Applied Biosystems), through the use of a GeneAmp PCR system 9700 (Applied Biosystems). Samples were run on a Wave DNA Fragment Analysis System (Transgenomics) at column temperatures recommended by Navigator Software version 1.5.4 (Transgenomics). Bidirectional sequencing of purified PCR products (Millipore) was performed by using BigDye chemistry and an ABI 3100 Capillary Array Sequencer (Applied Biosystems). Primers and conditions for PCR and DHPLC are listed in table 1.Table 1.Primers and PCR and DHPLC Conditions for CEP290 AnalysisExon(s)Primer Sequence (5′→3′)Amplicon Size (bp)PCR Annealing Temperature (°C)No. of CyclesDHPLC Oven TemperatureaEach value is a different optimized oven temperature, with the corresponding buffer B starting percent for each corresponding temperature at which the amplicon has been analyzed. For some amplicons, to ensure adequate peak separation, we needed to run at a different temperature and buffer B starting percent. In those instances, duplicate values for both are represented. (°C)Buffer B Starting %aEach value is a different optimized oven temperature, with the corresponding buffer B starting percent for each corresponding temperature at which the amplicon has been analyzed. For some amplicons, to ensure adequate peak separation, we needed to run at a different temperature and buffer B starting percent. In those instances, duplicate values for both are represented.2ACCAATAATACTGTGTACCTTG CAGATTGTGACAATTATAGTTG289583853.1/5754.4/52.13CAACTATAATTGTCACAATCTG GTTCCACTAATAGCCAAACC212583255.750.94GTGCTTACATTCCAGTATAAAG GTTTAATGAACAAATGGAATTCA186583254.4/5853.4/495ACCTTATAATCATGATGGACTC AATAACCATGATTACAATCATCC285583251.8/53.454.3/546TTGTTGACTCATTTGAACCTC AAAAAGCCAGGTAACTTGAAC264583253.2/56.455.6/54.27ACTGCTGAATTTTATCTTCTTC TTAGAAGACTCCAGTCCTGG208583255.751.28–9CAAGATAATATGCATCATTTTCCC ATGAAATTAAAGTTTTTAGGAACC47258325558.710AGAGGACACTTATGGCTGCG GTAATGAGATAATATGAAGTCTG332563552.9/54.156.3/54.611CACATATGTAATGTAATGTATCC CTAATAAACGTGTTATAAACCAG364563552.4/55.255.8/54.712GTATCATAAATCTACTAACGGTG ATCGTTCAGAGTTCCAACTG284583554/55.455.9/55.513CTTGTACCCACAAGAAAATATG AGAAAACTCAATATTGACTTGAC341563552.7/54.355.8/52.814TGATTTGAAGGAATAAGTAGTC CTGTGAATGGCAAGAATAATTC282583555/56.1/5857.2/56.1/5215GTACATTTTCCTTTAGACTTAG ACTTGTAAATCAGGTTGCGC311583854.1/56.655/52.516–17CATTTTTGCAGCTTATTTGAATG ATATCCAGACAACTCACTTATC380583854.8/55.857.9/56.918ATTAAAGTGTTGGAATAGTAGG TATTTTCCTTTACTCTCTTTGC218583855.350.119ATTGATCAAACTTTTCTTAACTTG ACAGAGGTAATTAGGAGTAAAG29354355456.220CCAATGATGTCTTTGGTATATG AAATATCTCATCAGAAACTATGG340583854.5/5557.8/57.321GTCCATTTTATTTAAAGACAGAC TTAATTCAAGGGGCATTTTCTC362583553.6/57.456.7/52.922TATGGTTGAGGTAAAATTCCTG AGTACTATCTGCATGCTTTGG390583852.6/55.858.9/54.223TAACTTTCCTATAATGTTGTCAG TAAGTTCCTAACAGTAGTTACC372543553.257.324ATACCTCTTGTGTTGAGAAAAC CACAAAGACACATCCATATTAC300543553.3/54.556.7/54.725TATGCAATATTGTACAAAGTAGG TGATACCATCCTATCTTCTGC368583854.5/55.458.7/57.826AAAGTGGCTAGTGCTTGACC TGTTAAATTTATATAAATGCAGGC358543556.357.927AACTGGATTGTGAGTTTTAAGG AGGATTATTCATCTGCCTAAG383583852.7/54.857.3/53.728ACAGCATCTAAAATATCTGAGG AGATCCAGACAAACCACTTAAC369583854.4/56.657/54.429AAGGCCAAGTAAAGAGGATTG TACTACTAAGAATTGTATACCTG349583555/56.958/55.830TAGAAAGTGTACTTAATTGTTCC CCCACTCCCAACATCTAATG231583856.2/5855/5231AATCTGTGATAACTTTCACTGG TGTTTGCACCACTGAACTCC604583554.7/5861.2/56.532CATTATCATCAATGGAGGAATG TAGTCATTTGTGCAATATTCTTG60358355361.733CCTGTTATGTGCCTGATGTC TGAGTTAACACTCTAGACTATG222583856.8/58.155.5/5434ATCTATGTTTTATCATACAGCTG ATCATTCTATGCATTGCCCTC321583854.6/56.957.5/54.635GCATTTTAAAGGGAAAAAGATAC CACTTTAGGGTAAAATAATATTTAG402543753.5/55.4/57.558.1/56.1/54.136ATATGGAGATACTGTTTCTTCC GCTGAATTTTAATTTACATGGTC305583855.655.237AATATGGAATAAGTATGGCATTG AGCAAACACTTATGTTTATCTTC337583852.4/54.4/57.858.1/56.1/52.738GTGACAGAGTGAGACTGGG ACAACACGGAGATTTATACTAC397583854.8/56.457.7/5639ATAGTAGGAAGTAATAAAGCTTG TAGTGAATTCTCTTCCAATAGG305583857.5/59.255/5340GTTCCTTTTATCATTGATACTTC AAGTAGAAATAAACTACTACCTC352583852.6/53.858.6/57.441GTGATAGCTTCAGAAAGTTGC CAGAATTAATACAGCCAGGTC342583855.354.342AACATATTTACATATTCTCTAGG TAAAGCTATATAATTTCCAGGTC345543855.254.443TTTGGTTTGGTAATGAGTATGC TTCAATTTCTAGGGGTCAACC301583855/56.656.8/55.244ACACTGAACTTTTCTTTTTTTATC AGATGTAATGCTTTTGGCCAG320583854.4/57.656.7/52.745TATCCAGTATGTCTTTTATGGC ACCATCACCATGATATATTAGG329583853.9/55.756.4/53.246TTTGCCTTTTCTTTTCAATGGC TATCTAAACTTTTCATTTCTGGC223583856.2/57.753.4/51.947TGTTGTATTGTTGGTACTTCG TTAGCCTTGCCTCTCATAAG394563553/54.957.9/5648TGGTTTCTAAAACTACTTTGAAG ACTTCCAGTTTTTCCAAGAGG296583853.3/54.4/57.255.5/54.4/51.649TAGAGCCCCAGGTTATTTTTG TGTTCATCAGGAAGAAACCAG293583854.2/56.1/58.559.5/56.5/5350TTAGTACAGTTATTTGAACTGAC ACAATGCAAGGAACATCTTGC293583853.7/55.256.6/53.551ACGCTTTGTTAAAAATGTGTATC ATGCTTGTCTCTAGTTGTAGC255583855.5/58.952.7/46.252TCACTAGTTCATAAGAAATGCC AATTCGATTTTACAGGGAGAC291583855.1/56.656.2/54.253CCATTACCTTGAACTCATTCG TAGGATACGTAGTTAAAGATGG230583854.2/55.954.2/51.554ATTCAGGAATACTTTGGCTTTC TTCGGAGAACTGCTTATTTCC418583853.6/55.557.7/52.9a Each value is a different optimized oven temperature, with the corresponding buffer B starting percent for each corresponding temperature at which the amplicon has been analyzed. For some amplicons, to ensure adequate peak separation, we needed to run at a different temperature and buffer B starting percent. In those instances, duplicate values for both are represented. Open table in a new tab The common NPHP1 homozygous deletion, the intronic CEP290 mutation recurring in isolated LCA (c.2991+1655A→G), and mutations in the AHI1 gene were excluded in all probands, in accordance with published protocols.10Valente EM Brancati F Silhavy JL Castori M Marsh SE Barrano G Bertini E Boltshauser E Zaki MS Abdel-Aleem A et al.AHI1 gene mutations cause specific forms of Joubert syndrome-related disorders.Ann Neurol. 2006; 59: 527-534Crossref PubMed Scopus (101) Google Scholar, 16Castori M Valente EM Donati MA Salvi S Fazzi E Procopio E Galluccio T Emma F Dallapiccola B Bertini E NPHP1 gene deletion is a rare cause of Joubert syndrome related disorders.J Med Genet. 2005; 42: e9Crossref PubMed Scopus (71) Google Scholar, 18den Hollander AI Koenekoop RK Yzer S Lopez I Arends ML Voesenek KE Zonneveld MN Strom TM Meitinger T Brunner HG et al.Mutations in the CEP290 (NPHP6) gene are a frequent cause of Leber congenital amaurosis.Am J Hum Genet. 2006; 79: 556-561Abstract Full Text Full Text PDF PubMed Scopus (443) Google Scholar We identified 23 distinct CEP290 mutations in 21 families. Seventeen mutations were novel, whereas six had been reported elsewhere (tables 2 and 3).12Valente EM Silhavy JL Brancati F Barrano G Krishnaswami SR Castori M Lancaster MA Boltshauser E Boccone L Al-Gazali L et al.Mutations in CEP290, which encodes a centrosomal protein, cause pleiotropic forms of Joubert syndrome.Nat Genet. 2006; 38: 623-625Crossref PubMed Scopus (282) Google Scholar, 13Sayer JA Otto EA O’Toole JF Nurnberg G Kennedy MA Becker C Hennies HC Helou J Attanasio M Fausett BV et al.The centrosomal protein nephrocystin-6 is mutated in Joubert syndrome and activates transcription factor ATF4.Nat Genet. 2006; 38: 674-681Crossref PubMed Scopus (393) Google Scholar, 19Perrault I Delphin N Hanein S Gerber S Dufier JL Roche O Defoort-Dhellemmes S Dollfus H Fazzi E Munnich A et al.Spectrum of NPHP6/CEP290 mutations in Leber congenital amaurosis and delineation of the associated phenotype.Hum Mutat. 2007; 28: 416Crossref PubMed Scopus (154) Google Scholar Six probands were homozygous for CEP290 mutations, and 10 were compound heterozygous, whereas, in 5 probands, only a single mutated allele could be found. All mutations reported were either nonsense or frameshift mutations resulting in a predicted truncated protein. Most mutations (20 of 23) clustered from exon 28 to the end of the gene, with a peak at exon 41 (fig. 1). The most common mutation was G1890X, which was homozygous in three families (two from the United Arab Emirates and one from Turkey) and heterozygous in three others (from Italy, Ireland, and the United Kingdom). The R1465X mutation in exon 34 recurred in three families (from Belgium, Brazil, and the United States), and the Q1628X (exon 37) mutation in two (from the United States and Russia), whereas the remaining 20 mutations were all found in single families (table 2). All mutations segregated with the disease in familial cases. CEP290 nucleotide variants representing either polymorphisms or nucleotide changes of unknown significance are listed in table 4.Table 2.Genotypes and Phenotypes of Patients with CEP290 MutationsPhenotypePatientOriginConsanguinitySexAge (years)DNA AlterationPredicted Protein AlterationExon(s)EyeaRC = retinal coloboma; RP = retinitis pigmentosa; VR = vision reduction.KidneybNPH includes ESRD (if present, age at onset in years is given in parentheses) and/or typical ultrasound (US) features and/or proof of impaired urinary-concentration ability. UCT = urinary-concentration testing after 1-deamino-8-D-arginine vasopressin challenge; NP = not performed.OthercEC = encephalocele; MR = mental retardation; ASD = atrial septal defect; VSD = ventricular septal defect; LT = lobulated tongue; PP = postaxial polydactyly; CM = cardiomegaly; SI = complete situs inversus.With JSRD-SLS: COR083SwitzerlandNoF25163delT,dThe six previously reported mutations (see table 3 for details). All other mutations are novel. homozygousT1721fsX1723, homozygous38LCANPHEC COR145United KingdomNoM21657_1666delA+6031C→TL552fsX572+R2011X17, 44LCANormal US, UCT NP… MTI333aUnited StatesNoM3eThis patient died at age 3 years.4882C→TdThe six previously reported mutations (see table 3 for details). All other mutations are novel.+5610delCAAAQ1628X+K1870fsX187237, 41LCANANA MTI333bUnited StatesNoF124882C→TdThe six previously reported mutations (see table 3 for details). All other mutations are novel.+5610delCAAAQ1628X+K1870fsX187237, 41LCA, RCNPH (7)No MR COR109FranceNoF61682_1683delA+3814C→TdThe six previously reported mutations (see table 3 for details). All other mutations are novel.A560fsX572+R1272X17, 31LCANormal US, UCT NP… COR003ItalyNoF65668G→TdThe six previously reported mutations (see table 3 for details). All other mutations are novel.+?G1890X+?41, ?LCANPHASD COR084RussiaNoF64882C→TdThe six previously reported mutations (see table 3 for details). All other mutations are novel.+5941G→TQ1628X+E1981X37, 43LCANPH… MTI154IndiaNoF65668G→T,dThe six previously reported mutations (see table 3 for details). All other mutations are novel. homozygousG1890X, homozygous41RP, VRNPHVSD MTI125United StatesNoF64393C→T+?R1465X+?34, ?LCANPH (6)… COR004aItalyNoF173811C→T+5734delTR1271X+R1911fsX192231, 42LCANPH (13)… COR004bItalyNoM73811C→T+5734delTR1271X+R1911fsX192231, 42LCANPH… MTI328United StatesNoM81985A→T+6277delGQ662X+V2092fsX209620, 46LCANPH (4)… MTI273TurkeyYesM104786_4790delTAAA, homozygousS1595fsX1599, homozygous36LCANPH (9)SI COR125United KingdomNoF105431_5433delGA+5668G→TdThe six previously reported mutations (see table 3 for details). All other mutations are novel.N1810fsX1816 +G1890X40, 41LCANPH (8)… MTI487TurkeyYesF105722G→T, homozygousE1908X, homozygous42LCA, RCUS and UCT NPLT, PP, CM MTI118IrelandNoF123167_3175insAdThe six previously reported mutations (see table 3 for details). All other mutations are novel.+5668G→TdThe six previously reported mutations (see table 3 for details). All other mutations are novel.I1055fsX1069+G1890X28, 41LCANPH… MTI286BrazilNoF134393C→T+?R1465X+?34, ?LCANPH… MTI111aLaosNoM136072C→A+7321dupCTCTY2024X+L2440fsX245644, 54LCANPH… MTI111bLaosNoF286072C→A+7321dupCTCTY2024X+L2440fsX245644, 54NANANA COR031BelgiumYesF154393C→T+4723A→TdThe six previously reported mutations (see table 3 for details). All other mutations are novel.R1465X+K1575X34, 36LCANPH… COR001ItalyNoF205489_5493delA+?K1829fsX1850+?40, ?LCANPH (9)… COR002aItalyNoM346870delT+?N2290fsX2300+?50, ?LCANPH (18)… COR002bItalyNoM306870delT+?N2290fsX2300+?50, ?LCANPH (11)…With JSRD: MTI012United Arab EmiratesYesM85668G→T,dThe six previously reported mutations (see table 3 for details). All other mutations are novel. homozygousG1890X, homozygous41NormalNormal US, UCT NP… MTI587United Arab EmiratesYesM55668G→T,dThe six previously reported mutations (see table 3 for details). All other mutations are novel. homozygousG1890X, homozygous41NormalNPH…Note.—NA = not available. All patients displayed MTS features, neurological signs typical of JS.a RC = retinal coloboma; RP = retinitis pigmentosa; VR = vision reduction.b NPH includes ESRD (if present, age at onset in years is given in parentheses) and/or typical ultrasound (US) features and/or proof of impaired urinary-concentration ability. UCT = urinary-concentration testing after 1-deamino-8-D-arginine vasopressin challenge; NP = not performed.c EC = encephalocele; MR = mental retardation; ASD = atrial septal defect; VSD = ventricular septal defect; LT = lobulated tongue; PP = postaxial polydactyly; CM = cardiomegaly; SI = complete situs inversus.d The six previously reported mutations (see table 3 for details). All other mutations are novel.e This patient died at age 3 years. Open table in a new tab Table 3.Recurrent Mutations Identified in the CEP290 GenePhenotype and DNA MutationPredicted Protein AlterationExonNo. of FamiliesReferencesaPD = present data.JSRD only: 5668G→TG1890X4110Valente et al.,12Valente EM Silhavy JL Brancati F Barrano G Krishnaswami SR Castori M Lancaster MA Boltshauser E Boccone L Al-Gazali L et al.Mutations in CEP290, which encodes a centrosomal protein, cause pleiotropic forms of Joubert syndrome.Nat Genet. 2006; 38: 623-625Crossref PubMed Scopus (282) Google Scholar Sayer et al.,13Sayer JA Otto EA O’Toole JF Nurnberg G Kennedy MA Becker C Hennies HC Helou J Attanasio M Fausett BV et al.The centrosomal protein nephrocystin-6 is mutated in Joubert syndrome and activates transcription factor ATF4.Nat Genet. 2006; 38: 674-681Crossref PubMed Scopus (393) Google Scholar PD 4393C→TR1465X343PDLCA only: 2991+1655A→GC998X2644den Hollander et al.,18den Hollander AI Koenekoop RK Yzer S Lopez I Arends ML Voesenek KE Zonneveld MN Strom TM Meitinger T Brunner HG et al.Mutations in the CEP290 (NPHP6) gene are a frequent cause of Leber congenital amaurosis.Am J Hum Genet. 2006; 79: 556-561Abstract Full Text Full Text PDF PubMed Scopus (443) Google Scholar Perrault et al.19Perrault I Delphin N Hanein S Gerber S Dufier JL Roch" @default.
• W2095913712 created "2016-06-24" @default.
• W2095913712 creator A5000404849 @default.
• W2095913712 creator A5005725800 @default.
• W2095913712 creator A5012180571 @default.
• W2095913712 creator A5013393582 @default.
• W2095913712 creator A5013900097 @default.
• W2095913712 creator A5015575038 @default.
• W2095913712 creator A5023112376 @default.
• W2095913712 creator A5026370929 @default.
• W2095913712 creator A5029526385 @default.
• W2095913712 creator A5033457856 @default.
• W2095913712 creator A5033695524 @default.
• W2095913712 creator A5036840174 @default.
• W2095913712 creator A5037050087 @default.
• W2095913712 creator A5037394247 @default.
• W2095913712 creator A5039716945 @default.
• W2095913712 creator A5043613312 @default.
• W2095913712 creator A5044939309 @default.
• W2095913712 creator A5045393742 @default.
• W2095913712 creator A5049108786 @default.
• W2095913712 creator A5050768217 @default.
• W2095913712 creator A5053577755 @default.
• W2095913712 creator A5054516309 @default.
• W2095913712 creator A5059742070 @default.
• W2095913712 creator A5062973181 @default.
• W2095913712 creator A5066366720 @default.
• W2095913712 creator A5068002114 @default.
• W2095913712 creator A5068184780 @default.
• W2095913712 creator A5068582387 @default.
• W2095913712 creator A5069071961 @default.
• W2095913712 creator A5078694313 @default.
• W2095913712 creator A5080742431 @default.
• W2095913712 creator A5083597160 @default.
• W2095913712 creator A5088020230 @default.
• W2095913712 date "2007-07-01" @default.
• W2095913712 modified "2023-10-18" @default.
• W2095913712 title "CEP290 Mutations Are Frequently Identified in the Oculo-Renal Form of Joubert Syndrome–Related Disorders" @default.
• W2095913712 cites W1966166788 @default.
• W2095913712 cites W1989195101 @default.
• W2095913712 cites W1994353334 @default.
• W2095913712 cites W1998083408 @default.
• W2095913712 cites W2007510388 @default.
• W2095913712 cites W2016559364 @default.
• W2095913712 cites W2028651090 @default.
• W2095913712 cites W2041530623 @default.
• W2095913712 cites W2049335442 @default.
• W2095913712 cites W2064207737 @default.
• W2095913712 cites W2066041050 @default.
• W2095913712 cites W2083904901 @default.
• W2095913712 cites W2090914486 @default.
• W2095913712 cites W2091346080 @default.
• W2095913712 cites W2091684557 @default.
• W2095913712 cites W2103638516 @default.
• W2095913712 cites W2110283302 @default.
• W2095913712 cites W2112331825 @default.
• W2095913712 cites W2125636494 @default.
• W2095913712 cites W2126624378 @default.
• W2095913712 cites W2128042564 @default.
• W2095913712 cites W2139913482 @default.
• W2095913712 cites W2144877389 @default.
• W2095913712 cites W2152931318 @default.
• W2095913712 cites W2156190275 @default.
• W2095913712 cites W2166217974 @default.
• W2095913712 cites W2167309966 @default.
• W2095913712 cites W2167610910 @default.
• W2095913712 cites W2171130544 @default.
• W2095913712 doi "https://doi.org/10.1086/519026" @default.
• W2095913712 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/1950920" @default.
• W2095913712 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/17564967" @default.
• W2095913712 hasPublicationYear "2007" @default.
• W2095913712 type Work @default.
• W2095913712 sameAs 2095913712 @default.
• W2095913712 citedByCount "135" @default.
• W2095913712 countsByYear W20959137122012 @default.
• W2095913712 countsByYear W20959137122013 @default.
• W2095913712 countsByYear W20959137122014 @default.
• W2095913712 countsByYear W20959137122015 @default.
• W2095913712 countsByYear W20959137122016 @default.
• W2095913712 countsByYear W20959137122017 @default.
• W2095913712 countsByYear W20959137122018 @default.
• W2095913712 countsByYear W20959137122019 @default.
• W2095913712 countsByYear W20959137122020 @default.
• W2095913712 countsByYear W20959137122021 @default.
• W2095913712 countsByYear W20959137122022 @default.
• W2095913712 countsByYear W20959137122023 @default.
• W2095913712 crossrefType "journal-article" @default.
• W2095913712 hasAuthorship W2095913712A5000404849 @default.
• W2095913712 hasAuthorship W2095913712A5005725800 @default.
• W2095913712 hasAuthorship W2095913712A5012180571 @default.
• W2095913712 hasAuthorship W2095913712A5013393582 @default.
• W2095913712 hasAuthorship W2095913712A5013900097 @default.
• W2095913712 hasAuthorship W2095913712A5015575038 @default.
• W2095913712 hasAuthorship W2095913712A5023112376 @default.
• W2095913712 hasAuthorship W2095913712A5026370929 @default.
• W2095913712 hasAuthorship W2095913712A5029526385 @default.
• W2095913712 hasAuthorship W2095913712A5033457856 @default.
• W2095913712 hasAuthorship W2095913712A5033695524 @default.

• next