FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2097768968> ?p ?o ?g. }

• W2097768968 endingPage "25800" @default.
• W2097768968 startingPage "25790" @default.
• W2097768968 abstract "Ustilago maydis is a haploid basidiomycete with single genes for two distinct histone H3 variants. The solitary U1 gene codes for H3.1, predicted to be a replication-independent replacement histone. The U2 gene is paired with histone H4 and produces a putative replication-coupled H3.2 variant. These predictions were evaluated experimentally. U2 was confirmed to be highly expressed in the S phase and had reduced expression in hydroxyurea, and H3.2 protein was not incorporated into transcribed chromatin of stationary phase cells. Constitutive expression of U1 during growth produced ∼25% of H3 as H3.1 protein, more highly acetylated than H3.2. The level of H3.1 increased when cell proliferation slowed, a hallmark of replacement histones. Half of new H3.1 incorporated into highly acetylated chromatin was lost with a half-life of 2.5 h, the fastest rate of replacement H3 turnover reported to date. This response reflects the characteristic incorporation of replacement H3 into transcribed chromatin, subject to continued nucleosome displacement and a loss of H3 as in animals and plants. Although the two H3 variants are functionally distinct, neither appears to be essential for vegetative growth. KO gene disruption transformants of the U1 and U2 loci produced viable cell lines. The structural and functional similarities of the Ustilago replication-coupled and replication-independent H3 variants with those in animals, in plants, and in ciliates are remarkable because these distinct histone H3 pairs of variants arose independently in each of these clades and in basidiomycetes. Ustilago maydis is a haploid basidiomycete with single genes for two distinct histone H3 variants. The solitary U1 gene codes for H3.1, predicted to be a replication-independent replacement histone. The U2 gene is paired with histone H4 and produces a putative replication-coupled H3.2 variant. These predictions were evaluated experimentally. U2 was confirmed to be highly expressed in the S phase and had reduced expression in hydroxyurea, and H3.2 protein was not incorporated into transcribed chromatin of stationary phase cells. Constitutive expression of U1 during growth produced ∼25% of H3 as H3.1 protein, more highly acetylated than H3.2. The level of H3.1 increased when cell proliferation slowed, a hallmark of replacement histones. Half of new H3.1 incorporated into highly acetylated chromatin was lost with a half-life of 2.5 h, the fastest rate of replacement H3 turnover reported to date. This response reflects the characteristic incorporation of replacement H3 into transcribed chromatin, subject to continued nucleosome displacement and a loss of H3 as in animals and plants. Although the two H3 variants are functionally distinct, neither appears to be essential for vegetative growth. KO gene disruption transformants of the U1 and U2 loci produced viable cell lines. The structural and functional similarities of the Ustilago replication-coupled and replication-independent H3 variants with those in animals, in plants, and in ciliates are remarkable because these distinct histone H3 pairs of variants arose independently in each of these clades and in basidiomycetes. Core histones provide the packaging proteins for DNA in eukaryotic cells. During the S phase when genomic DNA is duplicated, replication-coupled expression of histone genes provides new protein to assemble newly replicated DNA. Histone chaperones assist in the creation of new nucleosomes to maintain a stable, compacted, repressed state of chromatin. Within this context, regulatory proteins modulate chromatin environments to facilitate access to the DNA for gene transcription. The components and processes that allow RNA polymerases to transcribe a chromatin template, such as epigenetic modifications of DNA and histones, are being identified and intensely studied. The processes of nucleosome displacement from DNA by transcribing RNA polymerases and of nucleosome reassembly from available histones remain poorly understood. In research going back decades, it was observed that the composition of nucleosomes across transcribed gene regions, identified in part by high levels of histone acetylation, changed over time. Replication-coupled (RC) 2The abbreviations used are: RCreplication-coupledAcKacetylated lysineAUTacid urea TritonqRTquantitative reverse transcriptionRIreplication-independentSDsynthetic dextroseppipeptidyl-prolyl isomeraseCBXcarboxinLBleft borderRBright bordernnewmmain. histone H3 variants like H3.2 in birds were replaced by histone H3.3, a constitutively expressed form of animal histone H3. This histone is now known as a replacement histone or as a replication-independent (RI) H3 variant (1Urban M.K. Zweidler A. Dev. Biol. 1983; 95: 421-428Crossref PubMed Scopus (80) Google Scholar, 2Ridsdale J.A. Davie J.R. Nucleic Acids Res. 1987; 15: 1081-1096Crossref PubMed Scopus (74) Google Scholar). Specialized chaperones such as HIRA and Daxx selectively bind these RI H3 proteins at a small region, residues 87–90, which is uniquely different between RI and RC forms (3Lewis P.W. Elsaesser S.J. Noh K.M. Stadler S.C. Allis C.D. Proc. Natl. Acad. Sci. U.S.A. 2010; 107: 14075-14080Crossref PubMed Scopus (559) Google Scholar, 4Elsaesser S.J. Goldberg A.D. Allis C.D. Curr. Opin. Genet. Dev. 2010; 20: 110-117Crossref PubMed Scopus (124) Google Scholar). In the S phase, RC and RI variants are both present for replication associated chaperones to assemble nucleosomes. Outside of the S phase, the transcribed genes are only repackaged using new RI H3 proteins. The basis for this selectivity is found in one or more of the following reasons: outside of the S phase, RC H3 proteins are not synthesized, histone H3 molecules from displaced nucleosomes cannot be reused in nucleosome assembly, and transcription-associated chaperones like HIRA use only RI H3 sequence variants. replication-coupled acetylated lysine acid urea Triton quantitative reverse transcription replication-independent synthetic dextrose peptidyl-prolyl isomerase carboxin left border right border new main. Many of these processes have been identified and studied in Saccharomyces cerevisiae as a simple model system. However, this yeast makes only a single H3 protein from two histone H3 genes. This H3 is produced in a replication-coupled pattern of expression with significant H3 protein availability outside of the S phase. It acts like an animal H3.3 in that it is used by HIRA (4Elsaesser S.J. Goldberg A.D. Allis C.D. Curr. Opin. Genet. Dev. 2010; 20: 110-117Crossref PubMed Scopus (124) Google Scholar). In Schizosaccharomyces pombe, a single H3 protein is produced, partly from two RC H3 genes and partly from two constitutive ones (5Takayama Y. Takahashi K. Nucleic Acids Res. 2007; 35: 3223-3237Crossref PubMed Scopus (36) Google Scholar). Neither model organism can be used to study the contribution of histone H3 variants in replicative and replacement nucleosome assembly. Study of the functions provided by RC and RI H3 variants in animals and in plants is limited because the multiplicity of genes of both types prevents effective use of gene knock-out and replacement approaches. In each case, the duplication of the ancestral histone H3 and the structural and functional differentiation into replicative RC and replacement RI H3 variants arose independently (6Waterborg J.H. Biochem. Cell Biol. 2011; (in press)PubMed Google Scholar, 7Thatcher T.H. MacGaffey J. Bowen J. Horowitz S. Shapiro D.L. Gorovsky M.A. Nucleic Acids Res. 1994; 22: 180-186Crossref PubMed Scopus (40) Google Scholar, 8Waterborg J.H. Robertson A.J. J. Mol. Evol. 1996; 43: 194-206Crossref PubMed Scopus (47) Google Scholar). Gorovsky and co-workers (7Thatcher T.H. MacGaffey J. Bowen J. Horowitz S. Shapiro D.L. Gorovsky M.A. Nucleic Acids Res. 1994; 22: 180-186Crossref PubMed Scopus (40) Google Scholar) have used the diploid protist Tetrahymena as a model system. In ciliates, distinct RC and RI H3 genes have arisen independently from their appearance in animals and in plants (6Waterborg J.H. Biochem. Cell Biol. 2011; (in press)PubMed Google Scholar, 7Thatcher T.H. MacGaffey J. Bowen J. Horowitz S. Shapiro D.L. Gorovsky M.A. Nucleic Acids Res. 1994; 22: 180-186Crossref PubMed Scopus (40) Google Scholar, 8Waterborg J.H. Robertson A.J. J. Mol. Evol. 1996; 43: 194-206Crossref PubMed Scopus (47) Google Scholar). In Tetrahymena with 2 RC and 2 RI loci, complete knock-out of both RC or both RI loci produces viable vegetative cells. In RC knockouts, replication results in dramatically reduced cell proliferation rates and hypoploidy, likely because of insufficient nucleosome formation using only RI H3 histone. Proficient growth required up-regulation of RI loci. Conversely, RI knockouts are viable but fail to produce viable spores (9Cui B. Liu Y. Gorovsky M.A. Mol. Cell. Biol. 2006; 26: 7719-7730Crossref PubMed Scopus (58) Google Scholar). The validity of these results for animals or plants has not been confirmed. The sequence differences between the RC and RI H3 variants in Tetrahymena involve many more residues than the distinctive three to five that exist between animal and plant H3 variants. Ahmad and Henikoff (10Ahmad K. Henikoff S. Mol. Cell. 2002; 9: 1191-1200Abstract Full Text Full Text PDF PubMed Scopus (881) Google Scholar) had suggested that the basidiomycete Cryptococcus might contain a replacement H3 variant. Genome sequencing of the related corn smut Ustilago maydis revealed that this haploid organism has two distinct H3 genes. One is paired with the single histone H4 gene, an organization often seen for RC histones, and the other one is a solitary gene, like animal H3.3, with a replacement-like variant sequence at residues 89 and 90 (11Kämper J. Kahmann R. Bölker M. Ma L.J. Brefort T. Saville B.J. Banuett F. Kronstad J.W. Gold S.E. Müller O. Perlin M.H. Wösten H.A. de Vries R. Ruiz-Herrera J. Reynaga-Peña C.G. Snetselaar K. McCann M. Pérez-Martín J. Feldbrügge M. Basse C.W. Steinberg G. Ibeas J.I. Holloman W. Guzman P. Farman M. Stajich J.E. Sentandreu R. González-Prieto J.M. Kennell J.C. Molina L. Schirawski J. Mendoza-Mendoza A. Greilinger D. Münch K. Rössel N. Scherer M. Vranes M. Ladendorf O. Vincon V. Fuchs U. Sandrock B. Meng S. Ho E.C. Cahill M.J. Boyce K.J. Klose J. Klosterman S.J. Deelstra H.J. Ortiz-Castellanos L. Li W. Sanchez-Alonso P. Schreier P.H. Häuser-Hahn I. Vaupel M. Koopmann E. Friedrich G. Voss H. Schlüter T. Margolis J. Platt D. Swimmer C. Gnirke A. Chen F. Vysotskaia V. Mannhaupt G. Güldener U. Münsterkötter M. Haase D. Oesterheld M. Mewes H.W. Mauceli E.W. DeCaprio D. Wade C.M. Butler J. Young S. Jaffe D.B. Calvo S. Nusbaum C. Galagan J. Birren B.W. Nature. 2006; 444: 97-101Crossref PubMed Scopus (870) Google Scholar) (see Fig. 1). We have evaluated the expression and stability of the Ustilago histone H3 proteins. We have concluded that the solitary H3 gene indeed has all the functional characteristics of a replacement RI H3 variant and that the H4-paired H3 gene is an RC variant. The similarities of the Ustilago H3 variants in gene structural organization, in the differences of the polypeptides produced, in the selectivity of incorporation into replicative and transcription linked nucleosomes, and in protein stability with the RC and RI H3 variants in plants and in animals is remarkable. It provides insight in the conserved nature of nucleosome assembly processes because the RC-RI H3 divergences arose hundreds of millions of years apart, each time at the ancestral root of what have become broad clades of diverse, multicellular eukaryotes (6Waterborg J.H. Biochem. Cell Biol. 2011; (in press)PubMed Google Scholar). We have begun to exploit the possibilities for homologous gene replacement in U. maydis (12Brachmann A. König J. Julius C. Feldbrügge M. Mol. Genet. Genomics. 2004; 272: 216-226Crossref PubMed Scopus (182) Google Scholar) and complementation by plasmid-based histone H3 mutants to evaluate the contribution of these two H3 variants in nucleosome assembly during transcription and replication. The viability of strains with KO U1 or U2 loci, coding for the RI H3.1 and RC H3.2 variants, respectively, is reported. U. maydis 521, strain 9021 obtained from the Fungal Genetics Stock Center (University of Missouri-Kansas City, Kansas City, MO) and defined as WT, was grown in synthetic dextrose (SD) medium (6.7 g of Difco yeast nitrogen base without amino acids (Benton-Dickinson, Sparks, MI) with 20 g of glucose/liter) at 30 °C on 2% agar or in liquid culture at 150 rpm with typical experimental use at ∼107 cells/ml. Cell density was determined by hematocytometer counting. Stationary phase conditions developed for WT cells above 2 × 107 cells/ml in SD medium. Labeling in vivo with [3H]acetic acid (20 Ci/mmol; MP Biomedicals, Irvine, CA) was performed at 4 mCi/liter for 5 min, unless specified otherwise, after 10 min of preincubation at 10 μg/ml cycloheximide (Sigma), added from 2 mg/ml stock in ethanol. Labeling with [4,5-3H]l-lysine (60 Ci/mmol; MP Biomedicals) was performed at 0.4 mCi/liter for 30 min, unless specified otherwise, and with [35S]l-methionine (540 Ci/mmol; MP Biomedicals) at 0.1 mCi/liter for 20 min. Cell cycle progression was arrested in the S phase by the addition of 10% (w/v) hydroxyurea to 1 mg/ml (13García-Muse T. Steinberg G. Pérez-Martín J. Eukaryot. Cell. 2003; 2: 494-500Crossref PubMed Scopus (75) Google Scholar) in 1-liter log cultures at 2.2 × 106 cells/ml for 90 min. The cells were released from the block by washing with preconditioned SD medium. Tritiated lysine (50 μCi) was added to each culture during the last 30 min prior to cell collection after the culture was concentrated to 250 ml by centrifugation (5 min, 800 × g). The distribution of cells across the G1, S, and G2/M phases was determined by flow cytometry as described (13García-Muse T. Steinberg G. Pérez-Martín J. Eukaryot. Cell. 2003; 2: 494-500Crossref PubMed Scopus (75) Google Scholar) in a FACScalibur 877 (Benton-Dickinson) with ModFit LT (Verity Software) data analysis. Histones were extracted and purified from cell pellets essentially as described (14Waterborg J.H. J. Biol. Chem. 1990; 265: 17157-17161Abstract Full Text PDF PubMed Google Scholar). Cells from 0.25 to 2.0 liters of culture were collected by centrifugation (5 min, 800 × g) and resuspended into two to four pellet volumes of 40% GuCl in KPi (40% guanidine HCl, 0.05 m KH2PO4, 0.05 m K2HPO4, adjusted by KOH to pH 6.8, with 1.4 mm 2-mercaptoethanol). The cells were sonicated on ice in aliquots of 15 ml for 5 min twice with a Branson Sonifier 400 with medium tip at 25% initial output with cooling break, which resulted in 90+ % cell breakage, clarified (10 min, 30,000 × g), incubated on ice for 15 min at 0.25 n HCl, clarified (30 min, 30,000 × g), diluted with 0.1 m KPi, pH 6.8, to the refractive index of 5% GuGl in KPi, adjusted to 1.4 mm 2-mercaptoethanol, and incubated overnight under rocking with 1 ml of settled BioRex70 resin (200–400 mesh; Bio-Rad) per extract from 2 × 1010 cells, an experimentally optimized ratio for the Ustilago procedure. After repeated washing by 1 × g settling of the resin from 5% GuCl in KPi until the supernatant was clear, resin was placed in a small column and washed with 8 volumes of 5% GuCl in KPi, and histones were eluted by 10 volumes 40% GuCl in KPi. Histones were dialyzed in 3,500 molecular weight cut-off Spectra/Por 3 dialysis membranes (Spectrum Labs, Rancho Dominguez, CA) thrice against 100 volumes of 2.5% acetic acid with 1.4 mm 2-mercaptoethanol and recovered by lyophylization. Histone H3 was purified by reversed phase HPLC on Zorbax Protein-Plus columns (0.4 × 25 cm, New England Nuclear) as described (14Waterborg J.H. J. Biol. Chem. 1990; 265: 17157-17161Abstract Full Text PDF PubMed Google Scholar). Crude histones were dissolved in 0.25 ml of 8 m urea in 1 m acetic acid and injected in the column, equilibrated at 1 ml/min with 40% acetonitrile (Fisher) in 0.1% TFA (Sigma), washed for 2 min in this solvent, and eluted by a gradient from 40 to 55% acetonitrile in 0.1% TFA over 45 min. The two histone H3 variants co-eluted 43 min after injection, as monitored by absorbance at 214 nm. They were identified by acid urea Triton (AUT) gel electrophoresis of lyophilized column fractions based on protein size and characteristic affinity for Triton X-100 (15Waterborg J.H. Walker J.M. The Protein Protocols Handbook. Humana Press, Totowa, NJ2002: 103-111Google Scholar, 16Waterborg J.H. Walker J.M. The Protein Protocols Handbook. Humana Press, Totowa, NJ2002: 113-123Google Scholar). Semi-preparative purification of histone H3 used Vydac C4 columns (214TP510, 1.0 × 25 cm; Grace, Deerfield, IL) with the same elution conditions at 3 ml/min. AUT gel electrophoresis was performed in 15- or 30-cm-long gels with Triton X-100 (Bio-Rad) at 6 mm, a concentration optimized for Ustilago histone H3 variant separation, as described (15Waterborg J.H. Walker J.M. The Protein Protocols Handbook. Humana Press, Totowa, NJ2002: 103-111Google Scholar, 16Waterborg J.H. Walker J.M. The Protein Protocols Handbook. Humana Press, Totowa, NJ2002: 113-123Google Scholar). Proteins were quantitated by densitometry of gels, stained with Coomassie Brilliant Blue R-250, and destained in 7% acetic acid, 20% methanol. Specific radioactivity was determined by densitometry of fluorographic exposures exactly as described (17Waterborg J.H. J. Biol. Chem. 1998; 273: 27602-27609Abstract Full Text Full Text PDF PubMed Scopus (32) Google Scholar, 18Waterborg J.H. Robertson A.J. Tatar D.L. Borza C.M. Davie J.R. Plant Physiol. 1995; 109: 393-407Crossref PubMed Scopus (37) Google Scholar). Total RNA was isolated with TRIzol reagent (Invitrogen) using 0.4–0.6 mm glass beads for cell breakage for 3 min in a Mini-Beadbeater-16 (Biospec Products, Bartlesville, OK). Genomic DNA was digested with DNase I. The qRT-PCR procedure with separate cDNA synthesis step was performed according to the manufacturer's instructions using the Superscript III Platinum two-step qRT-PCR kit with SYBR Green (Invitrogen) in an Applied Biosystems 7500 thermal cycler (Invitrogen). Ustilago peptidyl-prolyl isomerase (ppi) (GenBank NW_101009, locus UM03726.1) was used as a constitutively expressed reference gene (19Flor-Parra I. Vranes M. Kämper J. Pérez-Martín J. Plant Cell. 2006; 18: 2369-2387Crossref PubMed Scopus (62) Google Scholar, 20Scherer M. Heimel K. Starke V. Kämper J. Plant Cell. 2006; 18: 2388-2401Crossref PubMed Scopus (74) Google Scholar). Primers used for the amplification of histone genes (see Fig. 1A) U1 (U1F and U1R), U2 (U2F and U2R), and H4 (H4F and H4R) and for the ppi gene (ppiF and ppiR) are listed in Table 1. Histone mRNA qRT-PCR levels were quantitated as 2−ΔCt, relative to ppi levels, following the manufacturer's instructions.TABLE 1PCR primersPrimer namePrimer sequencePCRaPCR product in bp from DNA templates and, in parentheses, from RNA/cDNA templates.U1FAGCGTCTCGTTCGTGAGATT344 (235)U1RCGTTAGAGGCAAATGTGGAGTU2FTCCAACACATAACTTCTCACTCG292 (175)U2RAGGCTTCTTGACACCACCAGH4FAAAGGCGGCAAGGGTCTCG362 (260)H4RTTGAGTGCGTAAACAACGTCGAGCppiFTTCCCAAGACTGCCAAGAAC267 (267)ppiRCGACGGTGGTGATGAAGAACU1KOLBFTCGATGAGCTCCCTGTTCGCTACCCTCTCT863U1KOLBRTGGTGGCCATCTAGGCCAGGGTGTTGGAACGU1KORBFATAGGCCTGAGTGGCCTCGTCTCTCTTTCGCAT1043U1KORBRAGTCTGAATTCCACCGATCCTCCTATACCAU2KOLBFTCAGAGTCGACCGCACTTATCGTGCTAGTCC1020U2KOLBRTGGTGGCCATCTAGGCCAGAAGCCGAATGAGCAGTGTU2KORBFATAGGCCTGAGTGGCCTATAGTGGGCGTCTGAATC1015U2KORBRAGTCTAAGCTTTCCTTGTTCACCGCTCGTa PCR product in bp from DNA templates and, in parentheses, from RNA/cDNA templates. Open table in a new tab Transformation of U. maydis was modified from published procedures (12Brachmann A. König J. Julius C. Feldbrügge M. Mol. Genet. Genomics. 2004; 272: 216-226Crossref PubMed Scopus (182) Google Scholar, 21Tsukuda T. Carleton S. Fotheringham S. Holloman W.K. Mol. Cell. Biol. 1988; 8: 3703-3709Crossref PubMed Scopus (228) Google Scholar) as follows. Cells (5 × 106), subcultured under continuous logarithmic growth in SD medium for at least 4 days, were collected at 105 cells/ml culture density by centrifugation for 5 min at 1100 × g, gently washed with 30 ml of SCS (20 mm sodium citrate, pH 5.8, 1 m sorbitol), and resuspended in 1 ml SCS. Protoplasts were produced by adding 2 ml of 128 mg/ml Vinoflow FCE (Novo, Gusmer Enterprises, Mountainside, NJ) in SCS and gentle mixing for 10 min, with microscopic verification of protoplasting. Protoplasts were collected by centrifugation for 10 min at 1100 × g, washed twice with 1 ml of SCS and once with 1 ml of STC (1 m sorbitol, 10 mm Tris·HCl, pH 7.5, 100 mm CaCl2), and resuspended in 1 ml of ice-cold STC. A mixture of 5 μl of transforming DNA at 1 mg/ml in STC and 1 μl of 15 mg/ml heparin (Sigma) in STC was added to protoplasts (106 in 0.05 ml) on ice and incubated for 10 min. A solution of 0.5 ml of 40% (w/v) PEG 4000 (Sigma) in STC was added and incubation on ice was continued for 15 min followed by the addition of 0.5 ml STC. Protoplasts were centrifuged for 5 min at 1100 × g, and the pellet was resuspended in 0.2 ml of STC. Aliquots (0.02 ml) were plated on 1% SD agar containing 1 m sorbitol and 2 μg/ml carboxin and grown at 30 °C. Transformants were collected after 4–5 days. Carboxin (CBX) (5,6-dihydro-2-methyl-1,4-oxathi-ine-3-carboxanilide; Vitavax) and CBX resistance plasmid pGR3 were kind gifts from S. Gold (Athens, GA). Used without linearization as a transformation reference, pGR3 yielded thousands of transformants per plate in this procedure. Genomic DNA was isolated by cetyl trimethylammonium bromide (22Stewart Jr., C.N. Via L.E. BioTechniques. 1993; 14: 748-750PubMed Google Scholar), as modified (23Pitkin J.W. Panaccione D.G. Walton J.D. Microbiology. 1996; 142: 1557-1565Crossref PubMed Scopus (227) Google Scholar), by the addition of 1% cetyl trimethylammonium bromide (Sigma) in 0.1 m Tris·HCl, pH 7.5, 0.7 m NaCl, 10 mm EDTA, 14 mm 2-mercaptoethanol to pelleted cells, vigorous vortexing for 3 min with 0.4–0.6-mm glass beads, incubation for 45 min at 65 °C, the addition of 1 volume of chloroform:isoamyl alcohol (24:1, v/v), centrifugation for 5 min at 12,000 × g, DNA precipitation from the aqueous phase with 0.9 m ammonium acetate in 2-propanol, and a wash of the DNA with 70% ethanol. For the U1 KO construct, a 863-bp U1 left border (LB) sequence was amplified by PCR in a MJ Research PTC-225 PCR cycler (GMI, Ramsey, MN) using primer pair U1KOLBF and U1KOLBR, and a 1043-bp U1 right border (RB) sequence by primer pair U2KORBF and U2KORBR. The transformation construct was assembled by ligation of EcoRI- and SacI-digested plasmid pGEM-4Z (Promega, Madison, WI) to SacI- and SfiI-digested U1 LB, the CBX cassette excised by SfiI from pMF1-c (12Brachmann A. König J. Julius C. Feldbrügge M. Mol. Genet. Genomics. 2004; 272: 216-226Crossref PubMed Scopus (182) Google Scholar), kindly provided by M. Feldbrügge (Düsseldorf, Germany), and the SfiI- and EcoRI-digested U1 RB. The construct was linearized by XbaI or SmaI for use in transformation through double-strand DNA repair-based homologous recombination (24Kojic M. Mao N. Zhou Q. Lisby M. Holloman W.K. Mol. Microbiol. 2008; 67: 1156-1168Crossref PubMed Scopus (26) Google Scholar). The equivalent U2 KO transformation construct was ligated using HindIII- and SalI-restricted pGEM-4Z, the SalI- and SfiI-digested 1020-bp U2 LB amplified by PCR primer pair U2KOLBF and U2KORBR, the CBX cassette excised by SfiI from pMF1-c, and the SfiI- and HindIII-digested 1015-bp U2 RB amplified by primer pair U2KORBF and U2KORBR and linearized by SacI for use in transformation. Constructs were verified by restriction digestion and sequencing. CBX-resistant colonies were subcultured into liquid SD at 3 μg/ml carboxin. Genomic DNA was prepared, and homologous recombination at the targeted U1 and U2 loci was analyzed by PCR using a variety of primer pairs that uniquely recognized sequences within the transforming constructs, the carboxin resistance cassette, and sequences inside and beyond the border sequences. These primer sequences will be provided upon request. Two U1KO transformation experiments produced 65 CBX-resistant clones that grew in liquid SD and continued growth when selection was removed. Eight strains contained KO recombination events at the U1 locus and likely were heterokaryons. Clone 47 was identified as a homokaryon U1 knock-out containing the CBX cassette with error-free homologous recombination in LB and RB sequences, as confirmed by sequencing. Multiple confirmed U2 knock-out strains were obtained from recombinant heterokaryon strains that contained both wild-type and knocked out U2 loci in varying ratios, as measured by PCR analysis (data not shown). Continued culture under selection produced stable, slow growing homokaryon lines that subsequently could be maintained without carboxin selection and that contained only the CBX-interrupted U2 locus as verified by PCR analysis and sequencing. Transformed KO lines maintain viability when stored at −80 °C in 15% glycerol. Sequencing of the genome of the haploid basidiomycete U. maydis revealed the existence of two single-copy histone H3 genes (11Kämper J. Kahmann R. Bölker M. Ma L.J. Brefort T. Saville B.J. Banuett F. Kronstad J.W. Gold S.E. Müller O. Perlin M.H. Wösten H.A. de Vries R. Ruiz-Herrera J. Reynaga-Peña C.G. Snetselaar K. McCann M. Pérez-Martín J. Feldbrügge M. Basse C.W. Steinberg G. Ibeas J.I. Holloman W. Guzman P. Farman M. Stajich J.E. Sentandreu R. González-Prieto J.M. Kennell J.C. Molina L. Schirawski J. Mendoza-Mendoza A. Greilinger D. Münch K. Rössel N. Scherer M. Vranes M. Ladendorf O. Vincon V. Fuchs U. Sandrock B. Meng S. Ho E.C. Cahill M.J. Boyce K.J. Klose J. Klosterman S.J. Deelstra H.J. Ortiz-Castellanos L. Li W. Sanchez-Alonso P. Schreier P.H. Häuser-Hahn I. Vaupel M. Koopmann E. Friedrich G. Voss H. Schlüter T. Margolis J. Platt D. Swimmer C. Gnirke A. Chen F. Vysotskaia V. Mannhaupt G. Güldener U. Münsterkötter M. Haase D. Oesterheld M. Mewes H.W. Mauceli E.W. DeCaprio D. Wade C.M. Butler J. Young S. Jaffe D.B. Calvo S. Nusbaum C. Galagan J. Birren B.W. Nature. 2006; 444: 97-101Crossref PubMed Scopus (870) Google Scholar): one on chromosome 11 as a solitary histone, named U1 (GenBank AACP01000135.1, locus UM03916.1) and one, named U2, in a divergently transcribed gene pair with histone H4 on chromosome 6 (GenBank AACP01000090.1, locus UM02709.1) (Fig. 1A). These histone forms differ only in a few amino acids, including residues 89–90 (Fig. 1B). This region defines the replacement character of animal histone H3.3 (4Elsaesser S.J. Goldberg A.D. Allis C.D. Curr. Opin. Genet. Dev. 2010; 20: 110-117Crossref PubMed Scopus (124) Google Scholar, 25Zweidler A. Dev. Biochem. 1980; 15: 47-56Google Scholar), that interacts with the specific replication-independent histone chaperones HIRA and Daxx (3Lewis P.W. Elsaesser S.J. Noh K.M. Stadler S.C. Allis C.D. Proc. Natl. Acad. Sci. U.S.A. 2010; 107: 14075-14080Crossref PubMed Scopus (559) Google Scholar) and that exists in the independently evolved replacement H3 variants of higher plants (8Waterborg J.H. Robertson A.J. J. Mol. Evol. 1996; 43: 194-206Crossref PubMed Scopus (47) Google Scholar, 26Waterborg J.H. J. Biol. Chem. 1993; 268: 4912-4917Abstract Full Text PDF PubMed Google Scholar, 27Waterborg J.H. Plant Physiol. 1991; 96: 453-458Crossref PubMed Scopus (36) Google Scholar, 28Waterborg J.H. Plant Mol. Biol. 1992; 18: 181-187Crossref PubMed Scopus (20) Google Scholar) and ciliates (7Thatcher T.H. MacGaffey J. Bowen J. Horowitz S. Shapiro D.L. Gorovsky M.A. Nucleic Acids Res. 1994; 22: 180-186Crossref PubMed Scopus (40) Google Scholar). The characteristic sequence at residues 87–90 was the basis for the suggestion that the basidiomycete Cryptococcus might also contain this type of replacement histone H3 (10Ahmad K. Henikoff S. Mol. Cell. 2002; 9: 1191-1200Abstract Full Text Full Text PDF PubMed Scopus (881) Google Scholar). We chose to use U. maydis as the model system (29Steinberg G. Perez-Martin J. Trends Cell Biol. 2008; 18: 61-67Abstract Full Text Full Text PDF PubMed Scopus (90) Google Scholar) to evaluate the existence of a replacement histone H3 in basidiomycetes. We anticipated that the methionine-containing U2 gene, which shares its promoter region with the single histone H4 gene (Fig. 1), would be expressed in the S phase. BioRex70-based histone isolation from whole cells under denaturing conditions to preserve post-synthetic modifications and protein integrity was followed by reversed phase chromatography. The co-eluting histone H3 variants were separated by AUT gel electrophoresis (Fig. 2A) and named in order of increasing gel mobility H3.1 and H3.2, based on the standard method of core histone variant nomenclature (30Zweidler A. Methods Cell Biol. 1978; 17: 223-233Crossref PubMed Scopus (312) Google Scholar). [35S]Methionine labeling identified U2 as the gene that codes for histone variant H3.2 (Fig. 2B) based on the single methionine in the mature protein (Fig. 1B). This indirectly identified U1 as the gene that produces histone H3.1 (Fig. 1A). The relative amounts of the two histone H3 variants varied with culture conditions. Continuous subculture to maintain logarithmic growth resulted in cells with up to 80% of histone H3 in the H3.2 form (lanes A and C in Fig. 2C and lane 0 h in Fig. 3A). When cultures were allowed to reach near stationary phase (2 × 107 cells/ml), the relative amount of H3.1 protein increased to more than 30%, whereas continued culture into the full stationary phase, when cell budding ceases, cell walls thicken, and cell density stabilizes, produces cultures with up to 50% H3.1 protein (lane E in Fig. 2B and Fig. 3). Such a gradual replacement of proliferation associated protein by another form, nam" @default.
• W2097768968 created "2016-06-24" @default.
• W2097768968 creator A5026387452 @default.
• W2097768968 creator A5030030578 @default.
• W2097768968 creator A5066454372 @default.
• W2097768968 date "2011-07-01" @default.
• W2097768968 modified "2023-09-27" @default.
• W2097768968 title "Identification of a Replication-independent Replacement Histone H3 in the Basidiomycete Ustilago maydis" @default.
• W2097768968 cites W1492928323 @default.
• W2097768968 cites W1617934133 @default.
• W2097768968 cites W1752502457 @default.
• W2097768968 cites W1858856545 @default.
• W2097768968 cites W1966218941 @default.
• W2097768968 cites W1970324732 @default.
• W2097768968 cites W1991295268 @default.
• W2097768968 cites W2007497503 @default.
• W2097768968 cites W2010648413 @default.
• W2097768968 cites W2012765618 @default.
• W2097768968 cites W2013766359 @default.
• W2097768968 cites W2031603331 @default.
• W2097768968 cites W2036847516 @default.
• W2097768968 cites W2038504509 @default.
• W2097768968 cites W2040722846 @default.
• W2097768968 cites W2043793978 @default.
• W2097768968 cites W2045959185 @default.
• W2097768968 cites W2047407619 @default.
• W2097768968 cites W2059330824 @default.
• W2097768968 cites W2061390923 @default.
• W2097768968 cites W2066958696 @default.
• W2097768968 cites W2071955851 @default.
• W2097768968 cites W2074589964 @default.
• W2097768968 cites W2075342392 @default.
• W2097768968 cites W2079730564 @default.
• W2097768968 cites W2088924735 @default.
• W2097768968 cites W2090389483 @default.
• W2097768968 cites W2090954579 @default.
• W2097768968 cites W2092185523 @default.
• W2097768968 cites W2092368988 @default.
• W2097768968 cites W2101239798 @default.
• W2097768968 cites W2103059070 @default.
• W2097768968 cites W2115932024 @default.
• W2097768968 cites W2117936698 @default.
• W2097768968 cites W2120085393 @default.
• W2097768968 cites W2127107911 @default.
• W2097768968 cites W2129804465 @default.
• W2097768968 cites W2138342074 @default.
• W2097768968 cites W2144792857 @default.
• W2097768968 cites W2144854713 @default.
• W2097768968 cites W2160646902 @default.
• W2097768968 cites W2164419678 @default.
• W2097768968 cites W2166174738 @default.
• W2097768968 cites W2169640176 @default.
• W2097768968 doi "https://doi.org/10.1074/jbc.m111.254383" @default.
• W2097768968 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/3138321" @default.
• W2097768968 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/21646347" @default.
• W2097768968 hasPublicationYear "2011" @default.
• W2097768968 type Work @default.
• W2097768968 sameAs 2097768968 @default.
• W2097768968 citedByCount "4" @default.
• W2097768968 countsByYear W20977689682012 @default.
• W2097768968 countsByYear W20977689682013 @default.
• W2097768968 countsByYear W20977689682020 @default.
• W2097768968 crossrefType "journal-article" @default.
• W2097768968 hasAuthorship W2097768968A5026387452 @default.
• W2097768968 hasAuthorship W2097768968A5030030578 @default.
• W2097768968 hasAuthorship W2097768968A5066454372 @default.
• W2097768968 hasBestOaLocation W20977689681 @default.
• W2097768968 hasConcept C104317684 @default.
• W2097768968 hasConcept C116834253 @default.
• W2097768968 hasConcept C12590798 @default.
• W2097768968 hasConcept C159047783 @default.
• W2097768968 hasConcept C2781222273 @default.
• W2097768968 hasConcept C54355233 @default.
• W2097768968 hasConcept C59822182 @default.
• W2097768968 hasConcept C64927066 @default.
• W2097768968 hasConcept C86803240 @default.
• W2097768968 hasConceptScore W2097768968C104317684 @default.
• W2097768968 hasConceptScore W2097768968C116834253 @default.
• W2097768968 hasConceptScore W2097768968C12590798 @default.
• W2097768968 hasConceptScore W2097768968C159047783 @default.
• W2097768968 hasConceptScore W2097768968C2781222273 @default.
• W2097768968 hasConceptScore W2097768968C54355233 @default.
• W2097768968 hasConceptScore W2097768968C59822182 @default.
• W2097768968 hasConceptScore W2097768968C64927066 @default.
• W2097768968 hasConceptScore W2097768968C86803240 @default.
• W2097768968 hasIssue "29" @default.
• W2097768968 hasLocation W20977689681 @default.
• W2097768968 hasLocation W20977689682 @default.
• W2097768968 hasLocation W20977689683 @default.
• W2097768968 hasLocation W20977689684 @default.
• W2097768968 hasOpenAccess W2097768968 @default.
• W2097768968 hasPrimaryLocation W20977689681 @default.
• W2097768968 hasRelatedWork W1983887894 @default.
• W2097768968 hasRelatedWork W1991523530 @default.
• W2097768968 hasRelatedWork W2002128513 @default.
• W2097768968 hasRelatedWork W2020824267 @default.
• W2097768968 hasRelatedWork W2057944944 @default.
• W2097768968 hasRelatedWork W2080053800 @default.

• next