FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2098601281> ?p ?o ?g. }

• W2098601281 endingPage "13091" @default.
• W2098601281 startingPage "13083" @default.
• W2098601281 abstract "The ColE7 operon is an SOS response regulon, which encodes bacteriocin ColE7 to kill susceptible Escherichia coli and its related enterobacteria under conditions of stress. We have observed for the first time that polyamines confer limited resistance against ColE7 on E. coli cells. Thus, this study aims to investigate the role of polyamines in modulating the protective effect of the E. coli cells against colicin. In the experiments, we surprisingly found that endogenous polyamines are also essential for ColE7 production, and the rate of polyamine synthesis is directly related to the SOS response. Our experimental results further indicated that exogenous polyamines suppress the expression of TolA, BtuB, OmpF, and OmpC proteins that are responsible for ColE7 uptake. Moreover, two-dimensional gel electrophoresis revealed that the production of two periplasmic proteins, PotD and OppA, is increased in E. coli cells under ColE7 exposure. Based on these observations, we propose that endogenous polyamines may play a dual role in the ColE7 system. Polyamines may participate in initiating the expression of the SOS response of the ColE7 operon and simultaneously down-regulate proteins that are essential for colicin uptake, thus conferring a survival advantage on colicin-producing E. coli under stress conditions in the natural environment. The ColE7 operon is an SOS response regulon, which encodes bacteriocin ColE7 to kill susceptible Escherichia coli and its related enterobacteria under conditions of stress. We have observed for the first time that polyamines confer limited resistance against ColE7 on E. coli cells. Thus, this study aims to investigate the role of polyamines in modulating the protective effect of the E. coli cells against colicin. In the experiments, we surprisingly found that endogenous polyamines are also essential for ColE7 production, and the rate of polyamine synthesis is directly related to the SOS response. Our experimental results further indicated that exogenous polyamines suppress the expression of TolA, BtuB, OmpF, and OmpC proteins that are responsible for ColE7 uptake. Moreover, two-dimensional gel electrophoresis revealed that the production of two periplasmic proteins, PotD and OppA, is increased in E. coli cells under ColE7 exposure. Based on these observations, we propose that endogenous polyamines may play a dual role in the ColE7 system. Polyamines may participate in initiating the expression of the SOS response of the ColE7 operon and simultaneously down-regulate proteins that are essential for colicin uptake, thus conferring a survival advantage on colicin-producing E. coli under stress conditions in the natural environment. Polyamines (putrescine, spermidine, and spermine) are aliphatic cations ubiquitous to all living organisms (1Igarashi K. Kashiwagi K. Biochem. Biophys. Res. Commun. 2000; 271: 559-564Crossref PubMed Scopus (737) Google Scholar). They have been shown to affect membrane permeability, gene expression, intracellular signaling, and apoptosis through noncovalent interactions or specific conjugation with proteins, nucleic acids, phospholipids, and other acidic substances (2Bachrach U. Wang Y.C. Tabib A. News Physiol. Sci. 2001; 16: 106-109PubMed Google Scholar, 3Bolter B. Soll J. EMBO J. 2001; 20: 935-940Crossref PubMed Scopus (71) Google Scholar, 4Yoshida M. Kashiwagi K. Shigemasa A. Taniguchi S. Yamamoto K. Makinoshima H. Ishihama A. Igarashi K. J. Biol. Chem. 2004; 279: 46008-46013Abstract Full Text Full Text PDF PubMed Scopus (124) Google Scholar, 5Coffino P. Nat. Rev. Mol. Cell Biol. 2001; 2: 188-194Crossref PubMed Scopus (303) Google Scholar). Because of their important regulatory functions, the biosynthesis, degradation, uptake, and excretion of polyamines are stringently regulated in order to maintain appropriate cellular levels (6Igarashi K. Ito K. Kashiwagi K. Res. Microbiol. 2001; 152: 271-278Crossref PubMed Scopus (79) Google Scholar, 7Igarashi K. Kashiwagi K. Biochem. J. 1999; 344: 633-642Crossref PubMed Scopus (224) Google Scholar). Recently, polyamines have been shown to mediate the production of RecA, which together with LexA controls the SOS response regulon (8Kim I.G. Oh T.J. Toxicol. Lett. 2000; 116: 143-149Crossref PubMed Scopus (24) Google Scholar, 9Oh T.J. Kim I.G. Cell Biol. Toxicol. 1999; 15: 291-297Crossref PubMed Scopus (10) Google Scholar, 10Oh T.J. Kim I.G. Biochem. Biophys. Res. Commun. 1999; 264: 584-589Crossref PubMed Scopus (13) Google Scholar). Polyamines are also known to modulate the gating of ion channels such as N-methyl-d-aspartate receptors of neurons and the bacteria outer membrane porins OmpF, OmpC, and PhoE (11Liu N. Benedik M.J. Delcour A.H. Biochim. Biophys. Acta. 1997; 1326: 201-212Crossref PubMed Scopus (23) Google Scholar, 12Iyer R. Wu Z. Woster P.M. Delcour A.H. J. Mol. Biol. 2000; 297: 933-945Crossref PubMed Scopus (58) Google Scholar, 13Williams K. Biochem. J. 1997; 325: 289-297Crossref PubMed Scopus (439) Google Scholar). In this modulation, putrescine and spermidine have been shown to bind to the aspartic acid residues located at positions 113 and 121 of OmpF and position 105 of OmpC, altering the charge and pore size of these porins and membrane permeability of E. coli cells (12Iyer R. Wu Z. Woster P.M. Delcour A.H. J. Mol. Biol. 2000; 297: 933-945Crossref PubMed Scopus (58) Google Scholar, 14Dela Vega A.L. Delcour A.H. J. Bacteriol. 1996; 178: 3715-3721Crossref PubMed Scopus (92) Google Scholar). Bacteriocins are one of the most abundant and diverse classes of antimicrobial toxins produced by all major lineages of eubacteria and archaebacteria (15Riley M.A. Wertz J.E. Annu. Rev. Microbiol. 2002; 56: 117-137Crossref PubMed Scopus (877) Google Scholar). The major function of bacteriocins appears to mediate population dynamics within species. One class of bacteriocins, the colicins produced by Escherichia coli, have served as the model for exploring the ecological role of these potent toxins (16Riley M.A. Gordon D.M. Trends Microbiol. 1999; 7: 129-133Abstract Full Text Full Text PDF PubMed Scopus (280) Google Scholar). All colicins found to date are plasmid-encoded. For example, the colicin E7 (ColE7) operon contains cea, cei, and cel genes located on a 6.2-kb native plasmid (pColE7-K317) (17Lu F.M. Chak K.F. Mol. Gen. Genet. 1996; 251: 407-411Crossref PubMed Scopus (27) Google Scholar). The ColE7 operon is transcribed as a polycistronic mRNA in the order cea-cei-cel by the ColE7 promoter that has two SOS boxes (ATCTGTACATAAAACCAGTGGTTTTATGTACAGAT) located in an inverted repeat orientation and is regulated by the LexA repressor (17Lu F.M. Chak K.F. Mol. Gen. Genet. 1996; 251: 407-411Crossref PubMed Scopus (27) Google Scholar). The cea is a toxin structural gene, which encodes the DNase ColE7 of 576 amino acid residues, and the product of cei gene composed of 87 amino acids is the ColE7 inhibitor (Im7). Im7 binds to the C-terminal DNase (T2A) domain of ColE7 forming a ColE7-Im7 complex and keeps ColE7 inactive inside the ColE7 producers (18Ku W.Y. Liu Y.W. Hsu Y.C. Liao C.C. Liang P.H. Yuan H.S. Chak K.F. Nucleic Acids Res. 2002; 30: 1670-1678Crossref PubMed Scopus (50) Google Scholar, 19Ko T.P. Liao C.C. Ku W.Y. Chak K.F. Yuan H.S. Structure. 1999; 7: 91-102Abstract Full Text Full Text PDF PubMed Scopus (168) Google Scholar). In addition, the cei gene is also transcribed independently from its own constitutive promoter that is active at a low level (20Soong B.W. Hsieh S.Y. Chak K.F. Mol. Gen. Genet. 1994; 243: 477-481Crossref PubMed Scopus (6) Google Scholar). The cel gene encodes the lysis protein (Lys-7) for ColE7 secretion. Lys-7 is translated as a 47-amino acid precursor and then processed to a mature form of 28 amino acids (21Chak K.F. Kuo W.S. Lu F.M. James R. J. Gen. Microbiol. 1991; 137: 91-100Crossref PubMed Scopus (80) Google Scholar). The translocation mechanism of colicin across the membrane of E. coli and the mode of action of ColE7 have been well documented (22Lazdunski C. Bouveret E. Rigal A. Journet L. Lloubes R. Benedetti H. Int. J. Med. Microbiol. 2000; 290: 337-344Crossref PubMed Scopus (15) Google Scholar, 23James R. Kleanthous C. Moore G.R. Microbiology. 1996; 142: 1569-1580Crossref PubMed Scopus (185) Google Scholar, 24Lazdunski C.J. Bouveret E. Rigal A. Journet L. Lloubes R. Benedetti H. J. Bacteriol. 1998; 180: 4993-5002Crossref PubMed Google Scholar). Once ColE7 binds to the outer membrane receptor BtuB through its internal receptor binding (R) domain, it further translocates into the envelope of susceptible cells through interactions between the N-terminal membrane translocation (T) domain and the outer membrane porins OmpF or OmpC as well as the Tol/Pal translocation system, which consists of the TolA, TolB, TolQ, TolR, and Pal proteins (22Lazdunski C. Bouveret E. Rigal A. Journet L. Lloubes R. Benedetti H. Int. J. Med. Microbiol. 2000; 290: 337-344Crossref PubMed Scopus (15) Google Scholar, 24Lazdunski C.J. Bouveret E. Rigal A. Journet L. Lloubes R. Benedetti H. J. Bacteriol. 1998; 180: 4993-5002Crossref PubMed Google Scholar). As a result, the DNase T2A domain extends into the periplasmic space. The T2A domain of ColE7 is then cleaved from the rest of the colicin and transported into the cytoplasm to hydrolyze the chromosome of susceptible cells (25Liao C.C. Hsiao K.C. Liu Y.W. Leng P.H. Yuen H.S. Chak K.F. Biochem. Biophys. Res. Commun. 2001; 284: 556-562Crossref PubMed Scopus (22) Google Scholar, 26de Zamaroczy M. Mora L. Lecuyer A. Geli V. Buckingham R.H. Mol. Cell. 2001; 8: 159-168Abstract Full Text Full Text PDF PubMed Scopus (49) Google Scholar). It has been claimed that proteins interacting with colicins during translocation are all indispensable for colicin uptake (22Lazdunski C. Bouveret E. Rigal A. Journet L. Lloubes R. Benedetti H. Int. J. Med. Microbiol. 2000; 290: 337-344Crossref PubMed Scopus (15) Google Scholar, 27James R. Penfold C.N. Moore G.R. Kleanthous C. Biochimie (Paris). 2002; 84: 381-389Crossref PubMed Scopus (77) Google Scholar). In this study, we use ColE7 as a research model to investigate the roles of polyamines in the ColE7 production and the ColE7 transportation. We found for the first time that endogenous polyamines are essential for triggering ColE7 production under mitomycin C induction. We also found that both endogenous polyamines and exogenous spermidine render limited resistance to E. coli cells against ColE7, suggesting that polyamines play a role in restricting colicin translocation across the E. coli cell membrane. By using this ColE7 model, we have demonstrated in E. coli that the presence of endogenous polyamines induces ColE7 production but restricts ColE7 uptake. Thus, the ecological role of polyamines in conferring survival advantages for a colicin-producing cell is discussed. Bacterial Strains, Plasmids, and Bacterial Cultures—E. coli strains used in this study are listed in Table 1. Strain W3110 was purchased from the ATCC (Manassas, VA). M15(pREP4), JM101, and JM109 were from our own collections and were used as hosts for expression of recombinant proteins. Polyamine-deficient mutants HT306, HT414, and HT375 were obtained from the Coli Genetic Stock Center, Yale University. HT252 and D18 were from the ATCC. HT375 and D18 were defective in spermidine biosynthesis and produced only putrescine (28Tabor C.W. Tabor H. Hafner E.W. J. Biol. Chem. 1978; 253: 3671-3676Abstract Full Text PDF PubMed Google Scholar). HT252, HT306, and HT414 were defective in both putrescine and spermidine biosynthesis (29Hafner E.W. Tabor C.W. Tabor H. J. Biol. Chem. 1979; 254: 12419-12426Abstract Full Text PDF PubMed Google Scholar, 30Tabor H. Hafner E.W. Tabor C.W. J. Bacteriol. 1980; 144: 952-956Crossref PubMed Google Scholar, 31Tabor H. Tabor C.W. Cohn M.S. Hafner E.W. J. Bacteriol. 1981; 147: 702-704Crossref PubMed Google Scholar). Strain AB1111, obtained from Coli Genetic Stock Center, Yale University, has many identical genomic markers of all the polyamine mutants used in this work, so that AB1111 and W3110 were used as polyamine wild type controls. The plasmid pColE7-K317 containing the ColE7 operon has been described previously (17Lu F.M. Chak K.F. Mol. Gen. Genet. 1996; 251: 407-411Crossref PubMed Scopus (27) Google Scholar). Vectors pQE30 and pQE70 (Qiagen, Valencia, CA) were used to generate recombinant proteins with the His6 tag at the N or C termini, respectively. E. coli cultures were grown in LB or M9 medium. The M9 medium in this study was supplemented with 0.4 mm threonine, 0.4 mm proline, 0.2 mm histidine and methionine, 0.8 mm leucine, 1 mm serine, and 0.01% thiamine (32Neidhardt F.C. Bloch P.L. Smith D.F. J. Bacteriol. 1974; 119: 736-747Crossref PubMed Google Scholar). Appropriate antibiotics were added to culture media as required.TABLE 1The E. coli strains used in this studyStrainsGenotypeSource or Ref.W3110F-, mcrA mcrB In(rrnD-rrnE)1, λ-ATCCJM101F′, [traD36 proAB+ lacIq lacZΔM15] supE thi Δ(lac-proAB)Ref. 63Yanisch-Perron C. Vieira J. Messing J. Gene (Amst.). 1985; 33: 103-119Crossref PubMed Scopus (11472) Google ScholarJM109F′, [traD36 proAB+ lacIq lacZΔM15] recA1 supE44 endA1 hsdR17 gyrA96 relA1 thi Δ (lac-proAB)M15QiagenAB1111F-, thr-1 proA2 thi-1 lacY1 galK2 mtl-1 xyl-5 ara-14 supE44 str-25 leu-6 Rac-0 hisC3, λ-Coli Genetic Stock Center, Yale UniversityHT252 (EWH319)F-, Δ(speA speB) Δ(speC glc) ΔspeD thr-1 proA2 thi-1 lacY1 galK2 mtl-1 xyl-5 ara-14 supE44 str-25, λ-ATCC (29Hafner E.W. Tabor C.W. Tabor H. J. Biol. Chem. 1979; 254: 12419-12426Abstract Full Text PDF PubMed Google Scholar)HT306F-, Δ(speB-speA)97 glc-1 ΔspeD98 thr-1 proA2 thi-1 lacY1 galK2 mtl-1 xyl-5 ara-14 supE44 str-25 ampA1 cadA2, λ-Coli Genetic Stock Center (30Tabor H. Hafner E.W. Tabor C.W. J. Bacteriol. 1980; 144: 952-956Crossref PubMed Google Scholar)HT414F-, Δ(speA speB)97 glc-1 thr-1 thi-1 lacY1 supE44 rplL9 fhuA21 hsdS1, λ-Coli Genetic Stock CenterD18speD3-1ATCC (28Tabor C.W. Tabor H. Hafner E.W. J. Biol. Chem. 1978; 253: 3671-3676Abstract Full Text PDF PubMed Google Scholar)HT375F-, ΔspeD98 lacZ43(Fs) strCGSC (28Tabor C.W. Tabor H. Hafner E.W. J. Biol. Chem. 1978; 253: 3671-3676Abstract Full Text PDF PubMed Google Scholar) Open table in a new tab Construction of Recombinant Plasmids pQE30-tolA, pQE30-tolB, pQE30-btuB, pQE30-pal, and pQE30-ceiE7—Portions of the tolA, tolB, btuB, pal, or ceiE7 genes were amplified by PCR from E. coli K12 chromosome or from pColE7-K317 using primer pairs shown in Table 2. The amplified DNA fragments of the tolA, tolB, btuB, or pal genes were cloned into the BamHI, KpnI, HindIII, or SalI sites of pQE30, thus fusing the His6 tag to the N terminus of each protein. Each recombinant plasmid was introduced into E. coli M15 containing pREP4, which encodes lacIq. The expressed recombinant proteins, except for BtuB, were purified by nickel-nitrilotriacetic acid (Qiagen) affinity column chromatography as described previously (25Liao C.C. Hsiao K.C. Liu Y.W. Leng P.H. Yuen H.S. Chak K.F. Biochem. Biophys. Res. Commun. 2001; 284: 556-562Crossref PubMed Scopus (22) Google Scholar). The BtuB protein was purified by elution from a 12.5% SDS-PAGE after electrophoresis.TABLE 2PCR primers for construction of recombinant plasmids pQE30-tolA, pQE30-tolB, pQE30-btuB, pQE30-pal, and pQE30-ceiE7GenesPrimer pairsPCR productbptolA5′-CGCGGATCCGATGATATTTTCGGT5′-ACGCGTCGACTTACGGTTTGAAGTCC403tolB5′-CGGGGTACCGAAGTCCGCATTGTG5′-CCCAAGCTTTCACAGATACGGCGA1247btuB5′-CGGGGTACCGATACCAGCCCGGAT5′-CCCAAGCTTTCAGAAGGTGTAGCT1746pal5′-GCGGGATCCTGTTCTTCCAACAAG5′-ACGCGTCGACTTAGTAAACCAGTACC478ceiE75′-TAATATGGGATCCAAAAATAGTATTAGTG5′-CATAAGCTTTCCTTGTTGTGAAAGAAT278 Open table in a new tab Western Blotting—Rabbit polyclonal antibodies against the ColE7-Im7 complex, OmpF, TolA, TolB, BtuB, and Pal proteins were produced in this study. The antigen used to raise the anti-OmpF antibody was a synthetic peptide (KGNGENSYGGNGDMTY) corresponding to amino acid residues 47–62 of the OmpF protein. Other antigens used were the purified recombinant proteins from E. coli described above. Preparation of the anti-OmpC antibody has been described previously (33Yu S.L. Ko K.L. Chen C.S. Chang Y.C. Syu W.J. J. Bacteriol. 2000; 182: 5962-5968Crossref PubMed Scopus (37) Google Scholar). Monoclonal antibody against the σ70 was purchased from NeoClone (Madison, WI). The procedure for Western blotting was the same as described previously (25Liao C.C. Hsiao K.C. Liu Y.W. Leng P.H. Yuen H.S. Chak K.F. Biochem. Biophys. Res. Commun. 2001; 284: 556-562Crossref PubMed Scopus (22) Google Scholar). The σ70 was used as an internal control because its synthesis was independent of polyamines (34Yoshida M. Kashiwagi K. Kawai G. Ishihama A. Igarashi K. J. Biol. Chem. 2001; 276: 16289-16295Abstract Full Text Full Text PDF PubMed Scopus (43) Google Scholar). The primary antibodies were used at a 1:50,000 dilution, and the secondary antibodies, anti-rabbit IgG-horseradish peroxidase and anti-mouse IgG-horseradish peroxidase (Santa Cruz Biotechnology, Santa Cruz, CA), were diluted 5000- and 2500-fold, respectively. Images on x-ray films were scanned by a laser scanning densitometer (Amersham Biosciences), and band densities were quantified with the ImageQuant software (version 5.2; Amersham Biosciences). Assay of ColE7 Expression in Wild Type and Polyamine-defective Mutant Strains—Plasmid pColE7-K317 was introduced into AB1111, W3110, HT375, D18, HT252, HT306, and HT414 strains to investigate the effects of polyamines on ColE7 expression in various genetic backgrounds. The cells were grown overnight in M9 medium and diluted 100-fold into fresh M9 medium to grow overnight again for completely eliminating contaminations of exogenous polyamines. The overnight bacteria cultures were then diluted 100-fold into fresh M9 medium. When cell density reached A600 of ∼0.3, the culture was divided into two portions, and mitomycin C (MMC) 2The abbreviations used are: MMC, mitomycin C; MALDI-TOF, matrix-assisted laser desorption ionization time-of-flight; HPLC, high pressure liquid chromatography. was added directly to one of them to a final concentration of 0.5 μg/ml. ColE7 production in these cells with or without MMC induction was assessed by Western blotting at every 30-min interval for 2 h. For determining whether exogenous polyamines rescue ColE7 expression in polyamine-deficient mutants, cells were grown to A600 of 0.3 and then divided into several aliquots. Polyamines (putrescine or spermidine alone or mixture of putrescine and spermidine) were then added to each aliquot at concentrations ranging from 0 to 4 mm. MMC (0.5 μg/ml) was then added 30 min after addition of polyamines to induce ColE7 production. ColE7 expression was monitored by Western blotting as described above. It was noted that flasks used for cell cultures were pre-washed with diluted HCl to deplete any exogenous polyamine contamination. Purification of Native ColE7-Im7 Complex—One liter of LB medium was inoculated with a 10-ml overnight culture of W3110(pColE7-K317). ColE7-Im7 complex was isolated from the culture as described by Liao et al. (25Liao C.C. Hsiao K.C. Liu Y.W. Leng P.H. Yuen H.S. Chak K.F. Biochem. Biophys. Res. Commun. 2001; 284: 556-562Crossref PubMed Scopus (22) Google Scholar), and the purity of the isolated ColE7-Im7 complex was determined by SDS-PAGE as described by Chak et al. (35Chak K.F. Hsieh S.Y. Liao C.C. Kan L. Proteins. 1998; 32: 17-25Crossref PubMed Scopus (11) Google Scholar). Susceptibility of Cells to the ColE7-Im7 Complex—Wild type E. coli strains and polyamine-deficient mutants were grown in M9 medium to an A600 of 0.4–0.6, and then 1 × 109 cells were mixed with 5 ml of soft agar in M9 medium and overlaid on a M9 agar plate containing 10 ml of bottom agar as a lawn. After a brief evaporation of the moisture on the lawn, filter paper disks impregnated with 10, 5, 2.5, or 1.25 μg of native ColE7-Im7 were placed on the lawn. The plates were incubated at 37 °C for 48 h, and the size of the clear zone surrounding the disks was measured. To investigate effects of exogenous polyamines on the susceptibility of these cells to ColE7-Im7, both top and bottom agars were made to contain 0–4 mm putrescine, spermidine, or a mixture of putrescine and spermidine. Viable Counting of E. coli against ColE7-Im7—Wild type E. coli cells, W3110 and AB1111, and polyamine-defective mutants were grown in M9 medium to an A600 of 0.5. The cell cultures were then incubated with a final concentration of 3 ng/ml (sublethal dosage) of purified native ColE7-Im7 complex for 5 min. The cells were washed twice, and then 10-fold serial dilutions were made. The 10–5 to 10–7 dilutions were separately plated on LB agar plates. The plates were incubated at 37 °C for 48 h, and visible colonies were then counted. Determination of Polyamines by HPLC—E. coli cells, with or without MMC (0.05–0.25 μg/ml) or ColE7-Im7 (0.2 mg/ml) treatment, were harvested and assayed for their intracellular spermidine and putrescine concentrations. 5 × 108 cells were pelleted, resuspended in 250 μl of pure water, and then processed for HPLC analysis as described previously (36Kabra P.M. Lee H.K. Lubich W.P. Marton L.J. J. Chromatogr. 1986; 380: 19-32Crossref PubMed Scopus (238) Google Scholar, 37Morgan D.M.L. Polyamine Protocols. Humana Press, Inc., New Jersey1998: 119-123Google Scholar). The internal standard 1,7-diaminoheptane, standard spermidine, and putrescine (Sigma) were treated and analyzed in an identical manner as controls. Samples were analyzed on an HPLC system equipped with sample controller (Waters 600E) and automated sample injector (S5200 sample injection, SFD, Germany) using a Luna C18 column (00G-4252-E0, 4.6 × 250 mm Luna, Phenomenex, Torrance, CA) with a 1-ml/min flow rate. Analysis of polyamines was monitored by a fluorescence detector (FP-2020 Plus, Jasco, Tokyo, Japan) with an excitation wavelength of 340 nm and emission wavelength of 515 nm. All data were stored and analyzed using the SISC ChemStation (Scientific Information Service Corporation, Taipei, Taiwan), which quantifies each compound by calculating the peak area of an HPLC. Identification and quantification of spermidine or putrescine in a sample were achieved by comparing the peak retention time and peak volume of the sample to those of standard spermidine or putrescine that was analyzed in an identical manner. Two-dimensional Gel Electrophoresis and Identification of Periplasmic Proteins of E. coli Cells—W3110(pColE7-K317) cells were grown in LB medium to an A600 of 1 and then treated with or without 0.2 mg/ml of native ColE7-Im7 for 2 h. Periplasmic proteins of these cells were then isolated after osmotic shock (38Nossal N.G. Heppel L.A. J. Biol. Chem. 1966; 241: 3055-3062Abstract Full Text PDF PubMed Google Scholar) for two-dimensional gel analysis. An immobilized pH gradient strip (13 cm, linear pH 4–7) was used in this study. Isoelectric focusing was performed on the IPGphor™ system (Amersham Biosciences) at 20 °C for a total of 93,890 Vhr including 30 V for 13 h, followed sequentially by 500 V for 1 h, 1000 V for 1 h, 4000 V for 2 h, 6000 V for 2 h, and 8000 V for 9 h. Preparative two-dimensional gels were stained overnight with 0.2% (w/v) Coomassie Brilliant Blue R-250 in 30% methanol and 5% acetic acid and then destained with 30% methanol. The analytical two-dimensional gels were stained with ammoniacal silver stain as described previously (39Pasquali C. Fialka I. Huber L.A. Electrophoresis. 1997; 18: 2573-2581Crossref PubMed Scopus (121) Google Scholar). Data acquisition for both preparative and analytical two-dimensional gels was achieved using the Image Master 2D Elite system (version 3.01, Lab San version 3.0, Amersham Biosciences). Spots representing differentially expressed proteins were excised manually and then transferred to an ultra-rigid skirted 96-well PCR plate (Thermofast® 96, Abgene, UK) for automatic in-gel digestion according to the procedures described in the MassPREP user's guide (Waters Associates, Milford, MA). The digested samples were subjected to MALDI-TOF mass spectrometry. Protein identification was performed as described previously (40Chen F.C. Shen L.F. Tsai M.C. Chak K.F. Biochem. Biophys. Res. Commun. 2003; 312: 708-715Crossref PubMed Scopus (13) Google Scholar). Lack of ColE7 Production in Polyamine-deficient E. coli—Polyamines previously have been shown as an SOS-inducing mediator of E. coli (8Kim I.G. Oh T.J. Toxicol. Lett. 2000; 116: 143-149Crossref PubMed Scopus (24) Google Scholar, 9Oh T.J. Kim I.G. Cell Biol. Toxicol. 1999; 15: 291-297Crossref PubMed Scopus (10) Google Scholar, 10Oh T.J. Kim I.G. Biochem. Biophys. Res. Commun. 1999; 264: 584-589Crossref PubMed Scopus (13) Google Scholar), and the ColE7 operon is known to be regulated by an SOS-responsive promoter (17Lu F.M. Chak K.F. Mol. Gen. Genet. 1996; 251: 407-411Crossref PubMed Scopus (27) Google Scholar). To study to what extent polyamines are involved in colicin production, we examined the expression of ColE7 in wild type E. coli strains (W3110 and AB1111) and polyamine-deficient E. coli strains (HT375, D18, HT252, HT306, and HT414). The plasmid pColE7-K317 was introduced into these strains, and ColE7 production in cells with or without MMC treatment was determined by Western blotting every 30 min for 2 h. ColE7 production was significantly induced in W3110(pColE7-K317) and AB1111(pColE7-K317) at 60 min after MMC treatment (Fig. 1A). The spermidine-defective strains D18(pColE7-K317) and HT375(pColE7-K317) produced less ColE7 under MMC treatment at a 2-h time point (Fig. 1B). In contrast, the strains HT252, HT306, and HT414 containing pColE7-K317 produced none or very little ColE7 even at the 2-h time point (Fig. 1B). To ensure polyamines are essential for the expression of ColE7, we set up an experiment to test if exogenous polyamine can rescue ColE7 expression in polyamine-defective mutants. The rescue experiment showed that exogenous polyamines effectively rescue the ColE7 expression in strains HT252, HT306, and HT414 (Fig. 1C), suggesting that polyamines play a crucial role in regulating the expression of the ColE7 operon. To find out whether the regulation of ColE7 production by polyamines is coupled with SOS response, we determined intracellular contents of putrescine and spermidine before and after MMC (0.05 or 0.25 μg/ml) treatment at various time points. We observed that putrescine and spermidine levels were induced significantly in W3110(pColE7-K317) 30 min after MMC treatment (Fig. 1D). Similar results were obtained from E. coli strains AB1111(pColE7-K317) and W3110 (data not shown). These data indicated that biosynthesis of spermidine and putrescine in E. coli cells is indeed coupled with the SOS response. Endogenous and Exogenous Polyamines Provide Limited Protection of E. coli against Colicin—It is already known that polyamines modulate the outer membrane permeability of E. coli cells (14Dela Vega A.L. Delcour A.H. J. Bacteriol. 1996; 178: 3715-3721Crossref PubMed Scopus (92) Google Scholar). To investigate whether endogenous polyamines affect the susceptibility of E. coli to ColE7, wild type E. coli and E. coli defective in spermidine or in both putrescine and spermidine synthesis were assayed for their susceptibility to ColE7. Interestingly, larger clear zones surrounding the disks of HT252, HT306, and HT414 strains, defective in both spermidine and putrescine production, were observed in all four tested ColE7 concentrations compared with the controls (Fig. 2A). The strains D18 and HT37, defective in spermidine production, were also sensitive to ColE7 (Fig. 2A), and the viable counting assay indicated about 3-fold more sensitivity to ColE7 of stains HT375 and D18 compared with the controls (data not shown). These results might suggest that endogenous polyamine confers resistance on E. coli cells against ColE7. To study the fine-tuning of polyamines in regulating the susceptibility of E. coli to ColE7, the agar plates containing 0–4 mm concentrations of exogenous polyamines were made to examine the sensitivity of polyamine-defective mutants to ColE7. Addition of putrescine and spermidine or only spermidine up to 0.1 mm significantly reduces the clear zone size of mutants HT252, HT306, and HT414 compared with the mutants without exogenous polyamine addition (Fig. 2B). It was noted that addition of polyamines beyond the 0.1 mm dose does not further increase the protective effect of the mutants against colicin. Similar protective effect of the wild type strains (W3110 and AB1111) has also been observed, indicating that probably 0.1 mm of exogenous polyamines is sufficient for exerting the limited protection of the cells against colicin. Response of E. coli Proteins Involved in ColE7 Translocation to Polyamines—Proteins such as TolA, TolB, BtuB, OmpC, OmpF, and Pal are essential for the translocation of colicins across the E. coli cell membrane (41Lazzaroni J.C. Dubuisson J.F. Vianney A. Biochimie (Paris). 2002; 84: 391-397Crossref PubMed Scopus (94) Google Scholar, 42Kurisu G. Zakharov S.D. Zhalnina M.V. Bano S. Eroukova V.Y. Rokitskaya T.I. Antonenko Y.N. Wiener M.C. Cramer W.A. Nat. Struct. Biol. 2003; 10: 948-954Crossref PubMed Scopus (125) Google Scholar). Because polyamines (putrescine or spermidine) have been proved to render E. coli cells the limited resistance to ColE7 (Fig. 2), experiments were then designed to resolve whether polyamine alters the production of proteins involved in the translocation process of colicin. The SDS-PAGE analysis of W3110(pColE7-K317) treated with or without 4 mm spermidine was shown in Fig. 3A, and Western blotting against BtuB, TolA, OmpC, OmpF, TolB, Pal, and RpoD was shown in Fig. 3B. Results of Western blotting demonstrated that production of BtuB, TolA, Om" @default.
• W2098601281 created "2016-06-24" @default.
• W2098601281 creator A5005245547 @default.
• W2098601281 creator A5019463541 @default.
• W2098601281 creator A5027191105 @default.
• W2098601281 creator A5043382078 @default.
• W2098601281 creator A5045814399 @default.
• W2098601281 creator A5051379791 @default.
• W2098601281 creator A5051508882 @default.
• W2098601281 creator A5063534321 @default.
• W2098601281 date "2006-05-01" @default.
• W2098601281 modified "2023-10-15" @default.
• W2098601281 title "The Critical Roles of Polyamines in Regulating ColE7 Production and Restricting ColE7 Uptake of the Colicin-producing Escherichia coli" @default.
• W2098601281 cites W126427411 @default.
• W2098601281 cites W136635294 @default.
• W2098601281 cites W1510680448 @default.
• W2098601281 cites W1513994171 @default.
• W2098601281 cites W1521759491 @default.
• W2098601281 cites W1546075073 @default.
• W2098601281 cites W1559752837 @default.
• W2098601281 cites W1563103338 @default.
• W2098601281 cites W1590759449 @default.
• W2098601281 cites W1607164652 @default.
• W2098601281 cites W1612160157 @default.
• W2098601281 cites W1679966592 @default.
• W2098601281 cites W1781531090 @default.
• W2098601281 cites W1797512117 @default.
• W2098601281 cites W1867012516 @default.
• W2098601281 cites W1867400316 @default.
• W2098601281 cites W1897047747 @default.
• W2098601281 cites W1972704395 @default.
• W2098601281 cites W1979547460 @default.
• W2098601281 cites W1979550058 @default.
• W2098601281 cites W1984093557 @default.
• W2098601281 cites W1991929655 @default.
• W2098601281 cites W1993729354 @default.
• W2098601281 cites W2002952229 @default.
• W2098601281 cites W2008615192 @default.
• W2098601281 cites W2010195006 @default.
• W2098601281 cites W2011481958 @default.
• W2098601281 cites W2023807790 @default.
• W2098601281 cites W2028255595 @default.
• W2098601281 cites W2028622989 @default.
• W2098601281 cites W2030129662 @default.
• W2098601281 cites W2030960641 @default.
• W2098601281 cites W2037308427 @default.
• W2098601281 cites W2041357720 @default.
• W2098601281 cites W2041865310 @default.
• W2098601281 cites W2046712716 @default.
• W2098601281 cites W2048960186 @default.
• W2098601281 cites W2049966753 @default.
• W2098601281 cites W2058507435 @default.
• W2098601281 cites W2061437704 @default.
• W2098601281 cites W2063177628 @default.
• W2098601281 cites W2063549906 @default.
• W2098601281 cites W2065583896 @default.
• W2098601281 cites W2076704604 @default.
• W2098601281 cites W2081646948 @default.
• W2098601281 cites W2083903130 @default.
• W2098601281 cites W2097190594 @default.
• W2098601281 cites W2099806767 @default.
• W2098601281 cites W2112453200 @default.
• W2098601281 cites W2116502500 @default.
• W2098601281 cites W2116879945 @default.
• W2098601281 cites W2117378774 @default.
• W2098601281 cites W2122446900 @default.
• W2098601281 cites W2125397171 @default.
• W2098601281 cites W2145007018 @default.
• W2098601281 cites W2152967503 @default.
• W2098601281 cites W2166562937 @default.
• W2098601281 cites W2172039578 @default.
• W2098601281 cites W2790070205 @default.
• W2098601281 cites W70832276 @default.
• W2098601281 doi "https://doi.org/10.1074/jbc.m511365200" @default.
• W2098601281 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/16549429" @default.
• W2098601281 hasPublicationYear "2006" @default.
• W2098601281 type Work @default.
• W2098601281 sameAs 2098601281 @default.
• W2098601281 citedByCount "24" @default.
• W2098601281 countsByYear W20986012812012 @default.
• W2098601281 countsByYear W20986012812013 @default.
• W2098601281 countsByYear W20986012812015 @default.
• W2098601281 countsByYear W20986012812016 @default.
• W2098601281 countsByYear W20986012812018 @default.
• W2098601281 countsByYear W20986012812019 @default.
• W2098601281 countsByYear W20986012812021 @default.
• W2098601281 crossrefType "journal-article" @default.
• W2098601281 hasAuthorship W2098601281A5005245547 @default.
• W2098601281 hasAuthorship W2098601281A5019463541 @default.
• W2098601281 hasAuthorship W2098601281A5027191105 @default.
• W2098601281 hasAuthorship W2098601281A5043382078 @default.
• W2098601281 hasAuthorship W2098601281A5045814399 @default.
• W2098601281 hasAuthorship W2098601281A5051379791 @default.
• W2098601281 hasAuthorship W2098601281A5051508882 @default.
• W2098601281 hasAuthorship W2098601281A5063534321 @default.
• W2098601281 hasBestOaLocation W20986012811 @default.
• W2098601281 hasConcept C104317684 @default.
• W2098601281 hasConcept C139719470 @default.

• next