FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2099612400> ?p ?o ?g. }

• W2099612400 endingPage "1445" @default.
• W2099612400 startingPage "1434" @default.
• W2099612400 abstract "Article2 March 1998free access The novel homeoprotein Prep1 modulates Pbx–Hox protein cooperativity Jens Berthelsen Jens Berthelsen Dipartimento di Genetica e Biologia dei Microrganismi dell'Università, via Olgettina 58, 20132 Milan, Italy Molecular Genetics Unit, via Olgettina 58, 20132 Milan, Italy Search for more papers by this author Vincenzo Zappavigna Vincenzo Zappavigna TIGET, H.S. Raffaele, via Olgettina 58, 20132 Milan, Italy Search for more papers by this author Elisabetta Ferretti Elisabetta Ferretti Dipartimento di Genetica e Biologia dei Microrganismi dell'Università, via Olgettina 58, 20132 Milan, Italy Molecular Genetics Unit, via Olgettina 58, 20132 Milan, Italy Search for more papers by this author Fulvio Mavilio Fulvio Mavilio TIGET, H.S. Raffaele, via Olgettina 58, 20132 Milan, Italy Search for more papers by this author Francesco Blasi Corresponding Author Francesco Blasi Dipartimento di Genetica e Biologia dei Microrganismi dell'Università, via Olgettina 58, 20132 Milan, Italy Molecular Genetics Unit, via Olgettina 58, 20132 Milan, Italy Search for more papers by this author Jens Berthelsen Jens Berthelsen Dipartimento di Genetica e Biologia dei Microrganismi dell'Università, via Olgettina 58, 20132 Milan, Italy Molecular Genetics Unit, via Olgettina 58, 20132 Milan, Italy Search for more papers by this author Vincenzo Zappavigna Vincenzo Zappavigna TIGET, H.S. Raffaele, via Olgettina 58, 20132 Milan, Italy Search for more papers by this author Elisabetta Ferretti Elisabetta Ferretti Dipartimento di Genetica e Biologia dei Microrganismi dell'Università, via Olgettina 58, 20132 Milan, Italy Molecular Genetics Unit, via Olgettina 58, 20132 Milan, Italy Search for more papers by this author Fulvio Mavilio Fulvio Mavilio TIGET, H.S. Raffaele, via Olgettina 58, 20132 Milan, Italy Search for more papers by this author Francesco Blasi Corresponding Author Francesco Blasi Dipartimento di Genetica e Biologia dei Microrganismi dell'Università, via Olgettina 58, 20132 Milan, Italy Molecular Genetics Unit, via Olgettina 58, 20132 Milan, Italy Search for more papers by this author Author Information Jens Berthelsen1,2, Vincenzo Zappavigna3, Elisabetta Ferretti1,2, Fulvio Mavilio3 and Francesco Blasi 1,2 1Dipartimento di Genetica e Biologia dei Microrganismi dell'Università, via Olgettina 58, 20132 Milan, Italy 2Molecular Genetics Unit, via Olgettina 58, 20132 Milan, Italy 3TIGET, H.S. Raffaele, via Olgettina 58, 20132 Milan, Italy ‡J.Berthelsen and V.Zappavigna contributed equally to this work *Corresponding author. E-mail: [email protected] The EMBO Journal (1998)17:1434-1445https://doi.org/10.1093/emboj/17.5.1434 PDFDownload PDF of article text and main figures. ToolsAdd to favoritesDownload CitationsTrack CitationsPermissions ShareFacebookTwitterLinked InMendeleyWechatReddit Figures & Info The products of the mammalian Pbx and Drosophila exd genes are able to interact with Hox proteins specifically and to increase their DNA binding affinity and selectivity. In the accompanying paper we show that Pbx proteins exist as stable heterodimers with a novel homeodomain protein, Prep1. Here we show that Prep1–Pbx interaction presents novel structural features: it is independent of DNA binding and of the integrity of their respective homeodomains, and requires sequences in the N-terminal portions of both proteins. The Prep1–Pbx protein–protein interaction is essential for DNA-binding activity. Prep1–Pbx complexes are present in early mouse embryos at a time when Pbx is also interacting with Hox proteins. The use of different interaction surfaces could allow Pbx to interact with Prep1 and Hox proteins simultaneously. Indeed, we observe the formation of a ternary Prep1–Pbx1–HOXB1 complex on a HOXB1-responsive target in vitro. Interaction with Prep1 enhances the ability of the HOXB1–Pbx1 complex to activate transcription in a cooperative fashion from the same target. Our data suggest that Prep1 is an additional component in the transcriptional regulation by Hox proteins. Introduction The homeodomain protein Pbx1 was originally discovered in human pre-B acute lymphoid leukemia (preB-ALL) as a C-terminal fusion to the 483 N-terminal residues of the IgK enhancer-binding protein E2A-E12 (Kamps et al., 1990; Nourse et al., 1990). The E2A–Pbx fusion appears to produce a novel chimeric protein with Pbx DNA-binding specificity and E2A transactivation properties. Pbx itself does not appear to be a transactivator but the fusion to the E2A protein confers transactivating and oncogenic properties (Kamps et al., 1991; Dedera et al., 1993; Kamps and Baltimore, 1993; Uckun et al., 1993; Van Dijk et al., 1993; Lu et al., 1994, 1995; Monica et al., 1994; Hunger, 1996). The Pbx family includes two other members, Pbx2 and Pbx3 (Monica et al., 1993). Pbx1 and Pbx3, in addition, exist in two alternatively spliced forms, Pbx1a and -1b, Pbx3a and -3b (Kamps et al., 1990; Nourse et al., 1990). The sequence of Pbx proteins is highly conserved and shares extensive homology with the Caenorhabditis elegans protein ceh-20 and Drosophila Exd; together they constitute the PBC class of homeodomain proteins (Burglin and Ruvkun, 1992; Monica et al., 1993). Besides the homeodomain, PCB family proteins contain two highly homologous regions in their N-terminal part, termed PCB-A and PCB-B, of unknown function (Burglin and Ruvkun, 1992). Pbx1a, -2 and -3a are all 50 kDa proteins with major differences only in the first 43 amino acids and minor differences in the C-terminal portion. The alternative b forms of Pbx1 and Pbx3 are C-terminally truncated with an apparent molecular mass of 40 kDa (Monica et al., 1993). The Drosophila Pbx homologue extradenticle (Exd) (Rauskolb et al., 1993) cooperatively interacts with homeobox proteins encoded by the Homeotic Complex selector genes, determining the expression pattern of homeotic target genes (Chan et al., 1994; Rauskolb and Wieschaus, 1994; Popperl et al., 1995). Exd acts as a co-factor directing different homeotic selector proteins to different target genes (Wilson and Desplan, 1995). Similarly, the Pbx proteins display cooperative binding with a subset of the Hox proteins (Chang et al., 1995, 1996; Knoepfler and Kamps, 1995; Lu et al., 1995; Phelan et al., 1995; Van Dijk et al., 1995; Chan et al., 1996; Chan and Mann, 1996; Lu and Kamps, 1996; Peltenburg and Murre, 1996), cooperating in activating promoters containing a Pbx responsive element (PRS) (White, 1994; Lu et al., 1995; Phelan et al., 1995; Wilson and Desplan, 1995; Mann and Chan, 1996). Pbx can further direct different HOX proteins to slightly different target sequences (Chang et al., 1996). The interaction between Pbx and Hox proteins requires both homeodomains, a stretch of 20 aa C-terminal to the Pbx homeodomain and the conserved pentapeptide sequence YPWMX or a similar ANW amino acid motif N-terminal to the Hox homeodomain (Chang et al., 1995, 1996; Knoepfler and Kamps, 1995; Lu et al., 1995; Phelan et al., 1995; Van Dijk et al., 1995; Chan et al., 1996; Chan and Mann, 1996; Lu and Kamps, 1996; Mann and Chan, 1996; Peltenburg and Murre, 1996). Intracellularly, Pbx is found complexed with a novel homeodomain protein Prep1 (Berthelsen et al., 1998). The Prep1–Pbx complex forms a DNA-binding activity factor previously identified and purified as the Urokinase Enhancer Factor 3 (UEF3), a factor important for the regulation of the urokinase enhancer, as well as of several other AP-1 controlled promoters (Nerlov et al., 1992; Berthelsen et al., 1996; De Cesare et al., 1996, 1997). By complexing, Prep1 and Pbx acquire a strong DNA-binding activity (Berthelsen et al., 1998). Unlike the Pbx–Hox complex, Prep1 and Pbx dimerize efficiently in solution independently of the presence of the DNA target site, and the complex is resistant to high salt concentrations and to chromatographic manipulations. Interestingly, Prep1 does not contain any YPWM or similar motif; in fact there is no W residue N-terminal to the homeodomain of Prep1. Prep1 and Pbx most likely exist as a stable complex in the nucleus, as stable Prep1–Pbx complexes can be isolated from nuclear extracts (Berthelsen et al., 1998). In this paper we explore the consequence of the Prep1–Pbx complex formation with respect to Hox protein activity. Prep1 and Pbx interaction broadens the DNA-target selectivity of both. Indeed, the Prep1–Pbx complex not only binds to the TGACAG sequence of the urokinase enhancer by which it was originally purified, but binds with equal affinity to Pbx and Pbx–Hox-responsive sequences (PRS). The interaction between Prep1 and Pbx requires sequences in the N-terminus of both proteins, but is independent of the integrity of the homeodomains, showing that the Prep1–Pbx interaction is clearly different from the Pbx–Hox interaction. On the other hand, both N-terminal sequences and intact homeodomains are required for DNA binding of Prep1–Pbx. We further find nuclear Prep1–Pbx complexes in 9.5 days post conception (d.p.c.) mouse embryos at a time when Pbx functionally interacts with Hox proteins. Thus the formation of a Prep1–Pbx complex may interfere with the formation and/or the function of a Hox–Pbx complex. In fact, Pbx interaction with Prep1 or Hoxb1 is not mutually exclusive; instead, in co-transfection experiments Prep1 is shown to stimulate the transactivating activity of HOXB1–Pbx. We also show that Prep1, Pbx and HOXB1 together can form a ternary complex on PRS-like DNA targets. Even though Prep1 and Pbx contain similar homeodomains, Prep1, unlike Pbx, does not bind directly to HOXB1. Overall these data suggest that Prep1 is an additional co-factor of Pbx–Hox regulated transcription. Results DNA binding specificity of the Prep1–Pbx complex Pbx proteins alone bind preferentially to the Pbx responsive sequence (PRS) TTGATTGAT, identified by PCR-mediated binding-site selection (Lu et al., 1994). This sequence is also a high affinity binding site for Pbx–Hox heterodimers (Chang et al., 1995; Mann and Chan, 1996) and is present in the oligonucleotides oPRS (Lu et al., 1994) and oHP used in this study (Table I). Similar sites binding Pbx–Hoxb1 complexes are present in the autoregulatory element (b1-ARE) of the Hoxb1 gene (Popperl et al., 1995). In particular we have used an oligonucleotide containing the third repeat (R3) of the b1-ARE (B1-R3, see Table I for sequences). The PRS nonanucleotide sequence is quite different from the urokinase enhancer Prep1–Pbx target sequence, TGACAG, present in the o-1 oligonucleotide, which is efficiently bound by the Prep1/Pbx heterodimer (Berthelsen et al., 1998). We have tested whether Prep1–Pbx can also bind the PRS motif. To this end we have performed EMSA analysis employing both crude HeLa nuclear extracts and in vitro translated proteins (Figure 1). Using crude nuclear extracts with labeled o-1 we observe that formation of the two complexes (UC and LC) can be competed specifically by excess unlabeled o-1 oligonucleotide and equally efficiently by the oHP oligonucleotide (Figure 1A). The mutated oHPm that is unable to bind Pbx and Pbx–HOX (Chang et al., 1995) is also unable to compete for binding to o-1. Similarly, when using labeled oHP as a probe in EMSA with HeLa nuclear extracts we see formation of two complexes indistinguishable from those obtained with o-1 (Figure 1B). Formation of the two complexes is specifically competed by both the o-1 and oHP, with equal efficiency. The complexes formed by o-1 and oHP in fact seem to be identical as they are recognized by both anti-Prep1 and anti-Pbx antibodies (Figure 1A and B). Interestingly, the complexes bound to the oHP target contained both Pbx and Prep1, and not Pbx alone. This suggests that Prep1–Pbx binds equally well to the different core binding sites, TGACAG and TGATTGAT. To confirm this, we have tested the DNA binding specificity of Prep1–Pbx1a complex produced in vitro. Both o-1 (Figure 1C) and oHP (Figure 1D) produce a retarded complex of equal intensity that in both cases is sensitive to anti-Prep1 antibodies (Figure 1C and D, last lanes). In this case, all the PRS containing oligonucleotides that we employed, as well as o-1, competed with equal efficiency for binding of the Prep1–Pbx complex to either the o-1 or oHP target. None of the mutated oligonucleotides used were able to compete. On the basis of the above experiments we conclude that the Prep1–Pbx complex exhibits a high affinity, specific DNA binding towards both the TGACAG and the TGATTGAT motifs. Figure 1.DNA-binding specificity of the Prep1–Pbx heterodimers. Comparison of UEF3 DNA binding to either the o-1 or oHP oligonucleotides. (A) EMSA analysis with labeled o-1 oligonucleotide and HeLa nuclear extract (HeLa NE), showing formation of UC and LC complexes. Binding was competed by addition of excess unlabeled oligonucleotides, as indicated, using 50- and 500-fold molar excess. The nature of the retarded complexes were accessed by co-incubation with antibodies against Prep1 (αPrep1), Pbx1 (αPbx1), Pbx (αPbx1/2/3) or preimmune sera (PI). (B) Same conditions as in (A), but using labeled oHP oligonucleotide as probe. (C) DNA-binding specificity of in vitro produced Prep1–Pbx1 complex. EMSA analysis with o-1 oligonucleotide and in vitro co-translated Prep1–Pbx1a products. The binding specificity was assessed by competition with various oligonucleotides; the sequences of these are shown in Table I. Competition was performed by addition of 50- and 500-fold molar excess cold oligonucleotides. To verify that the observed band contained Prep1, we co-incubated with αPrep1 or PI. (D) Same conditions as in (C), but using labeled oHP oligonucleotide as probe. The reticulocyte lysate contains a non-specific endogenous activity that binds the o-1 and the oHP, oligonucleotides (marked by Lys). Download figure Download PowerPoint Table 1. Oligonucleotides used in this study o-17 CAGCAATCAGCATGACAGCCTCCAGC o-17mI ............CTCG.......... o-1 CACCTGAGAGTGACAGAAGGAAGGCAGGGAG o-1m .........T.C................... oHP CGAATTGATTGATGCACTAATTGGAG oHPm ....CC.................... oPRS CGAAATTGATTGATGCGCCCCGCGCT oPRSm ....CC.................... B1-R3 GATCCGGGGGGTGATGGATGGGCGCTGGGA Comparison of the o-17 and o-1 oligonucleotides containing the two different uPA promoter UEF3 binding sites and their mutated homologs. A dot indicates an identical base. The core binding site is shown in bold letters. Below, comparison of the three oligonucleotides containing binding sites for Pbx and Pbx–Hox, shown in bold. Prep1–Pbx1a interaction requires N-terminal sequences of both proteins The interaction between Prep1 and Pbx has different properties than that between Pbx and Hox proteins (Berthelsen et al., 1998). To characterize further the interaction between Prep1 and Pbx proteins we have employed mutations of both proteins and tested for their ability to form complexes and to bind DNA. To address the importance of the Prep1 homeodomain we constructed two mutations within the Prep1 homeodomain (Figure 2A): Prep1HDI50Q contains a glutamine residue at position 50 in the homeodomain instead of an isoleucine, a position important in determining the DNA-binding specificity (Treismann et al., 1989); the entire homeodomain (residues 259–318) is deleted in Prep1ΔHD. To test the role of the N-terminal conserved portion of Prep1, we further employed a Prep1 with the two Meis-homologous regions, HR1 and HR2 (residues 58–137) deleted (Berthelsen et al., 1998). The constructs were translated in vitro together with Pbx1b (Figure 2B, left) and immunoprecipitated with anti-Pbx1 antibodies (Figure 2B, right). Both homeodomain mutants, Prep1HDI50Q and Prep1ΔHD, are co-precipitated as efficiently as wild-type Prep1, suggesting that the Prep1 homeodomain is not involved in the Pbx1 interaction in solution. In contrast, Prep1ΔHR1+2 does not co-precipitate with Pbx1b, indicating that the Prep1 HR1 and HR2 regions include the Pbx1 interaction domain. We further tested the DNA-binding ability of the co-translates by EMSA, using two different Prep1–Pbx DNA target sites, the o-1 and b1R3 oligonucleotides (Figure 2C). DNA binding of the Prep1HDI50Q–Pbx1b complex is impaired with respect to wild-type Prep1–Pbx1b on both target sites. No binding is observed when using co-translates of Pbx1b with Prep1ΔHD or Prep1ΔHR1+2. Overall, this shows that the Prep1 homeodomain, while not being required for Prep1–Pbx1 interaction, is important for DNA binding of the complex. In addition, since the homeodomain is still present in the Prep1ΔHR1+2 the loss of DNA-binding activity of this mutant protein when co-translated with Pbx1 suggests that pre-formation of a Prep1–Pbx complex is required for DNA binding. Figure 2.Pbx-interacting domains of Prep1. (A) Schematic representation of Prep1 and Prep1 mutants, showing the position of the homeodomain (HD) and of the Meis-homologous regions, HR1 and HR2. Blank spaces represent deletions. (B) Left panel: SDS–PAGE of in vitro translated Pbx1b and Prep1 constructs, as indicated. As observed before (Berthelsen et al., 1998), in vitro translated Prep1 display a major full-length product, and several minor truncated products. Right: immunoprecipitation of in vitro translated Pbx1b (lane 1), Prep1 (lane 2) and co-translation of Pbx1b with different Prep1 derivatives, as indicated (lanes 3–6). The translates were immunoprecipitated with anti-Pbx1 antibodies and Protein A–Sepharose, and the precipitates were resolved by SDS–PAGE. Bands corresponding to Pbx1b and Prep1 derivatives are indicated by arrows. Molecular weights are indicated. We used Pbx1b in this study to be able to discriminate between the migration of the PrepΔHR1+2 product (co-migrates with Pbx1a) and Pbx1. (C) EMSA analysis of cooperative DNA binding of Pbx1b and Prep1 mutants. The co-translates, as indicated, were incubated with the TGACAG-containing o-1 oligonucleotide (left panel) or with the Hoxb-1 promoter b1-ARE R3-site (right panel). Bands corresponding to the Pbx1b–Prep complex are indicated by arrows. An endogenous factor present in the lysate (marked by ‘Lys’) binding strongly to the o-1 oligonucleotide, and weakly to the R3-oligonucleotide, is observed. Download figure Download PowerPoint In order to find the Prep1 interacting surfaces of Pbx1, we repeated the experiments with Pbx1a mutants (Figure 3A). Pbx1aΔ283–285 contains a small deletion in the homeodomain and is functionally unable to interact with HOXB1 (Di Rocco et al., 1997). We took further advantage of the naturally occurring Pbx mutant, E2A–Pbx1. The oncogenic fusion product E2A–Pbx1 contains the transactivating domain of the E2A protein, substituting the first 88 residues of Pbx1 including part of the PCB-A domain. In addition, we used a Pbx1a deleted of the first 140 residues including all of the PCB-A domain, but still having an intact PCB-B domain (Di Rocco et al., 1997). These Pbx1a constructs were co-translated in vitro with Prep1 (Figure 3B, left) and analyzed by immunoprecipitation and EMSA experiments. Immunoprecipitation with an anti-Prep1 serum (Figure 3B, right) shows that both full length Pbx1a and Pbx1aΔ283–285 co-precipitate with Prep1. In contrast, bands corresponding to Pbx1aΔ1–140 or E2A–Pbx1a are not co-precipitated. Thus, as in the case of Prep1, sequences in the N-terminal part of Pbx and not in the homeodomain seem to be important for interaction with Prep1. When tested for DNA binding (Figure 3C), we observe that of the co-translates only Prep1–Pbx1a can bind the target sites o-1 or R3, while no DNA-binding activity is observed with the Pbx1a mutants, Pbx1aΔ283–285, Pbx1Δ1–140 or E2A–Pbx1a. Figure 3.Prep1-interacting domains of Pbx1. (A) Schematic representation of Pbx1a and the Pbx1a mutants, showing the position of the homeodomain (HD) and of the conserved PBC-A and PBC-B regions. Blank spaces represent deletions. (B) Left panel: SDS–PAGE of in vitro translated Prep1, Pbx1a constructs or E2A–Pbx1a, as indicated. As observed before (Berthelsen et al., 1998), in vitro translated Prep1 display a major full-length product, and several minor truncated products. Right: immunoprecipitation of in vitro translated Prep1 (lane 1), Pbx1b (lane 2) and co-translates of Prep1 with different Pbx1a derivatives or E2A–Pbx1a, as indicated (lanes 3–5). The translates were immunoprecipitated with anti-Prep1 antibodies and Protein A–Sepharose and the precipitates were resolved by SDS–PAGE. Bands corresponding to Prep1 and Pbx1a derivatives are indicated by arrows. Molecular weights are indicated. (C) EMSA analysis of cooperative DNA binding of Prep1 and Pbx1a mutants. The Prep1–Pbx1a-derivative co-translates, as indicated, were incubated with the TGACAG-containing o-1 oligonucleotide (left panel) or with the Hoxb-1 promoter b1-ARE R3-site (right panel). Bands corresponding to the Prep–Pbx1a complex are indicated by arrows. An endogenous factor present in the lysate (marked by ‘Lys’) binding strongly to the o-1 oligonucleotide, and weakly to the R3-oligonucleotide, is observed. Download figure Download PowerPoint In conclusion, formation of the Prep1–Pbx complex prior to binding seems to be mandatory for DNA binding of the complex as mutations that interrupt complex formation also interrupt DNA binding. Further, the dimerization surfaces of Prep1 and Pbx1 include the N-terminus of both proteins but not the homeodomains. Hence the interaction involves novel dimerization domains. Prep1–Pbx complexes are present during mouse embryogenesis We have searched for the presence of DNA-binding Prep1–Pbx complexes in nuclear extracts isolated from E9.5 d.p.c. mouse embryos. EMSA shows specific DNA-binding activity, giving two retarded bands identical to those of HeLa cells (Figure 3). Incubation with specific antibodies further shows that both bands are inhibited by anti-Prep1 antibodies. Moreover, antibodies directed against Pbx1 or against all Pbxa forms (αPbx1/2/3) inhibit formation of, or supershift, either of the two complexes, UC and LC, and a combination of antibodies recognizing Pbx1 and Pbx2 inhibit formation of both complexes. These results show that the retarded bands observed in embryonic extracts are complexes of Prep1 with Pbx1a, Pbx1b or Pbx2. As in the case of HeLa cell extracts (Berthelsen et al., 1998), we have not found Pbx3 associated with Prep1 in the 9.5 d.p.c. mouse embryonic extracts. In conclusion, Pbx proteins are found complexed with Prep1 at a time during development where Pbx is also known to functionally interact with Hox proteins. Thus the presence of the Prep1–Pbx complexes might interfere with the function of a Pbx–Hox complex. Prep1 enhances Pbx–HOX-dependent transactivation To investigate whether Prep1 could interfere with the formation and functioning of a Hox–Pbx complex we chose the transcriptional activation of the Hoxb-1 autoregulatory element (b1-ARE) by the HOXB1–Pbx1 complex as a model system. We have previously shown that a Pbx1–HOXB1 complex cooperatively binds to, and activates transcription from, the R3 site contained in the b1-ARE (Di Rocco et al., 1997). We have also shown above that a Prep1–Pbx1 complex can bind to the R3 site of the b1-ARE. We analyzed the effect of co-expression of Prep1 on the Pbx1–HOXB1-dependent transactivation through the b1-ARE enhancer in transient transfections of COS cells. The b1-ARE basal activity is not stimulated by either Pbx1a, HOXB1 or Prep1 alone (data not shown). Co-transfection of HOXB1 and Pbx1a induces a 4 to 5-fold activation of transcription, as previously reported (Di Rocco et al., 1997). Co-expression of Prep1 with either Pbx1 or HOXB1 does not significantly stimulate the b1-ARE reporter activity (Figure 5C) even though transfected cells displayed increased DNA-binding activity, as shown by EMSA (data not shown). However, co-expression of Prep1 with both Pbx1 and HOXB1, instead of antagonizing the HOXB1–Pbx1 complex transcriptional activation, causes an additional increase of the reporter activity (9-fold over basal level). In order to understand whether the stimulation of the HOXB1–Pbx1 complex activity requires the DNA binding function of Prep1, we employed the Prep1ΔHD and the Prep1HD50Q mutants in the cotransfection experiments, which have impaired DNA-binding functions. Both mutants are still able to enhance the transcriptional activity of the HOXB1–Pbx1 complex activity, the Prep1ΔHD mutant causing an even higher stimulation of the complex activity. Thus, the DNA-binding activity by Prep1 is not required for enhancing the HOXB1–Pbx1-mediated transcriptional activation. Next we tested Prep1ΔHR1+2, which is unable to form a stable complex with Pbx proteins in vitro. Prep1ΔHR1+2 has lost the ability to enhance HOXB1–Pbx1 complex activity. We also tested a HOXB1 mutant lacking the N-terminal activation domain (HOXB1HD, Figure 5A and B). This mutant can still complex with Pbx1 and causes a low level activation of the reporter (Di Rocco et al., 1997). Co-expression of Prep1 with HOXB1HD and Pbx1 leads to an enhancement of the activation displayed by HOXB1HD and Pbx1 (Figure 5C). Finally, we tested a Pbx1 mutant representing a deletion of the first 140 amino acids, which comprises the conserved PBC-A domain. The Pbx1Δ1–140 mutant, while being unable to interact stably with Prep1 in vitro, is able to form a transcriptionally active complex with HOXB1 on the b1-ARE region. The activity of the HOXB1–Pbx1Δ1–140 complex cannot be further enhanced by co-expression with Prep1 (Figure 5C). Figure 4.Prep1—Pbx complexes are present in mouse embryos. EMSA analysis of nuclear extracts of 9.5 d.p.c. mouse embryos (lanes 2–9) and of HeLa nuclear extracts (HeLa NE, lane 1) using the TGACAG motif (o-1 oligonucleotide). The subunit composition of the complexes was investigated by co-incubating the binding reaction with specific antibodies as indicated. PI: preimmune serum. A combination of αPbx1 and αPbx2 antibodies inhibits all binding. Download figure Download PowerPoint Figure 5.Prep1 enhances Pbx1–HOXB1 transcriptional activity. (A) Schematic representation of HOXB1 and HOXB1 mutants used in this study. The homeodomain (HD) and the conserved pentapeptide motif, YPWMX, are shown. Blank spaces represent deletions. (B) SDS–PAGE analysis of in vitro translated HOXB1 derivatives. (C) Luciferase activity assayed from extracts of transiently transfected COS cells. Cells were transfected with 8 μg of the pAdMLR3 reporter construct, with 4 μg of the pSGHOXB1 or the pSGB1HD expression constructs, together with 8 μg of the pSGPbx1a or PSGPbx1Δ1–140 expressors, where indicated. Cells were also cotransfected with 8 μg of pSGPrep1 or of the pSGPrep1 mutant derivatives as indicated. 0.2 μg of the pCMVb-gal plasmid were co-transfected as an internal standard. Bars represent the mean luciferase activity ±SEM of at least four independent experiments. Download figure Download PowerPoint In conclusion, these results indicate that Prep1, instead of preventing the formation of the Pbx1–HOXB1 complex or sequestering Pbx1 in an inactive complex on the b1-ARE, is able to further enhance transcriptional activity of the HOXB1–Pbx1 complex on the b1-ARE. While the DNA-binding function of Prep1 is not required for stimulation of the HOXB1–Pbx1 complex activity, the interaction surfaces between Prep1 and Pbx1 are necessary for stimulation. This suggests that Prep1 can directly interact with and stimulate a DNA-bound HOXB1–Pbx1 complex through Pbx. Prep1, Pbx and HOXB1 form a ternary complex on DNA We have analyzed by EMSA whether Prep1 can affect the formation of a Pbx–Hox complex. Complexes of Prep1–Pbx1a and Pbx1a–HOXB1 can bind to the b1-ARE R3 element, and can be distinguished by their different mobility (Figure 6A, lanes 3 and 6). No complexes are observed with Prep1 and HOXB1 (Figure 6, lane 7). When all three proteins are present (Figure 6, lane 8) the Pbx–HOXB1 band disappears, substituted by a slower migrating band. This slow migrating band, which might represent a ternary Prep1–Pbx1a–HOXB1 complex on DNA, is not observed when we use a homeodomain-less HOXB1 mutant (HOXB1ΔHD, see Figure 5A and B), indicating that formation of this complex requires HOXB1 DNA-binding function (Figure 6A, lanes 13–15). Similarly, no slow migrating retarded band is observed by using the Prep1ΔHR1+2 mutant that is unable to complex with Pbx (Figure 6B, lanes 1–2). Further proof that the slower migrating band represents a ternary Prep1–Pbx1a–HOXB1 complex is obtained by the use of specific anti-Prep1 and anti-Pbx1 antibodies which inhibit the formation of both the slower migrating band as well as the Prep1–Pbx complex (Figure 6B). Most interestingly, the Prep1 homeodomain is not required for the assembly of the ternary complex on DNA. In fact, mutation or deletion of the Prep1 homeodomain, that reduces or abolishes DNA binding of the Prep1–Pbx complex (Prep1ΔHD and Prep1HD50Q), increases the intensity of the ternary complex (Figure 5A, lanes 4 and 5). These results are in agreement with our transfection experiments (Figure 5C) where we observe enhancement of the HOXB1–Pbx1 complex activity by Prep1 mutated in the homeodomain. Figure 6.Prep1 interacts with a HOX–Pbx complex. (A) EMSA analysis of combinations of the Prep1, Pbx1a and HOXB1 in vitro translated proteins, and mutated derivatives thereof, as indicated, using an oligonucleotide representing the R3 sequence of the b1-ARE enhancer. Migration of the various complexes are indicated with arrows. The EMSA was performed with 0.5 μg poly-dIdC per reaction and 3 mM spermidine. With this lower amount of non-specific competitor, the Prep1HD50Q–Pbx1a complex bind" @default.
• W2099612400 created "2016-06-24" @default.
• W2099612400 creator A5039993807 @default.
• W2099612400 date "1998-03-02" @default.
• W2099612400 modified "2023-10-07" @default.
• W2099612400 title "The novel homeoprotein Prep1 modulates Pbx-Hox protein cooperativity" @default.
• W2099612400 cites W1497949622 @default.
• W2099612400 cites W1753052292 @default.
• W2099612400 cites W1814044767 @default.
• W2099612400 cites W1941286715 @default.
• W2099612400 cites W1975197215 @default.
• W2099612400 cites W1981372072 @default.
• W2099612400 cites W1987691601 @default.
• W2099612400 cites W1997936885 @default.
• W2099612400 cites W1998020029 @default.
• W2099612400 cites W2015828720 @default.
• W2099612400 cites W2019932776 @default.
• W2099612400 cites W2028275307 @default.
• W2099612400 cites W2035777673 @default.
• W2099612400 cites W2039007871 @default.
• W2099612400 cites W2055166643 @default.
• W2099612400 cites W2057433337 @default.
• W2099612400 cites W2065732097 @default.
• W2099612400 cites W2066666893 @default.
• W2099612400 cites W2078119356 @default.
• W2099612400 cites W2088956217 @default.
• W2099612400 cites W2094226065 @default.
• W2099612400 cites W2094446130 @default.
• W2099612400 cites W2103466846 @default.
• W2099612400 cites W2107155162 @default.
• W2099612400 cites W2118509382 @default.
• W2099612400 cites W2119318224 @default.
• W2099612400 cites W2119846739 @default.
• W2099612400 cites W2126394433 @default.
• W2099612400 cites W2137162173 @default.
• W2099612400 cites W2139128323 @default.
• W2099612400 cites W2140679819 @default.
• W2099612400 cites W2141034679 @default.
• W2099612400 cites W2141668026 @default.
• W2099612400 cites W214611139 @default.
• W2099612400 cites W2149111956 @default.
• W2099612400 cites W2154073211 @default.
• W2099612400 cites W2163601202 @default.
• W2099612400 cites W2166425787 @default.
• W2099612400 cites W2171759834 @default.
• W2099612400 cites W225957511 @default.
• W2099612400 cites W2327948153 @default.
• W2099612400 cites W2429511752 @default.
• W2099612400 cites W264579827 @default.
• W2099612400 cites W4859545 @default.
• W2099612400 cites W82518400 @default.
• W2099612400 cites W1997958467 @default.
• W2099612400 doi "https://doi.org/10.1093/emboj/17.5.1434" @default.
• W2099612400 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/1170491" @default.
• W2099612400 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/9482740" @default.
• W2099612400 hasPublicationYear "1998" @default.
• W2099612400 type Work @default.
• W2099612400 sameAs 2099612400 @default.
• W2099612400 citedByCount "205" @default.
• W2099612400 countsByYear W20996124002012 @default.
• W2099612400 countsByYear W20996124002013 @default.
• W2099612400 countsByYear W20996124002014 @default.
• W2099612400 countsByYear W20996124002015 @default.
• W2099612400 countsByYear W20996124002016 @default.
• W2099612400 countsByYear W20996124002017 @default.
• W2099612400 countsByYear W20996124002018 @default.
• W2099612400 countsByYear W20996124002019 @default.
• W2099612400 countsByYear W20996124002020 @default.
• W2099612400 countsByYear W20996124002021 @default.
• W2099612400 countsByYear W20996124002022 @default.
• W2099612400 countsByYear W20996124002023 @default.
• W2099612400 crossrefType "journal-article" @default.
• W2099612400 hasAuthorship W2099612400A5039993807 @default.
• W2099612400 hasBestOaLocation W20996124002 @default.
• W2099612400 hasConcept C104317684 @default.
• W2099612400 hasConcept C111039654 @default.
• W2099612400 hasConcept C121587040 @default.
• W2099612400 hasConcept C166014724 @default.
• W2099612400 hasConcept C169760540 @default.
• W2099612400 hasConcept C51639874 @default.
• W2099612400 hasConcept C54355233 @default.
• W2099612400 hasConcept C70721500 @default.
• W2099612400 hasConcept C86339819 @default.
• W2099612400 hasConcept C86803240 @default.
• W2099612400 hasConcept C94966510 @default.
• W2099612400 hasConcept C95444343 @default.
• W2099612400 hasConceptScore W2099612400C104317684 @default.
• W2099612400 hasConceptScore W2099612400C111039654 @default.
• W2099612400 hasConceptScore W2099612400C121587040 @default.
• W2099612400 hasConceptScore W2099612400C166014724 @default.
• W2099612400 hasConceptScore W2099612400C169760540 @default.
• W2099612400 hasConceptScore W2099612400C51639874 @default.
• W2099612400 hasConceptScore W2099612400C54355233 @default.
• W2099612400 hasConceptScore W2099612400C70721500 @default.
• W2099612400 hasConceptScore W2099612400C86339819 @default.
• W2099612400 hasConceptScore W2099612400C86803240 @default.
• W2099612400 hasConceptScore W2099612400C94966510 @default.
• W2099612400 hasConceptScore W2099612400C95444343 @default.

• next