FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2100561498> ?p ?o ?g. }

• W2100561498 endingPage "39822" @default.
• W2100561498 startingPage "39815" @default.
• W2100561498 abstract "The molecular engine that drives bidirectional replication fork movement from the Escherichia colireplication origin (oriC) is the replicative helicase, DnaB. At oriC, two and only two helicase molecules are loaded, one for each replication fork. DnaA participates in helicase loading; DnaC is also involved, because it must be in a complex with DnaB for delivery of the helicase. Since DnaA induces a local unwinding of oriC, one model is that the limited availability of single-stranded DNA at oriC restricts the number of DnaB molecules that can bind. In this report, we determined that one DnaB helicase or one DnaB-DnaC complex is bound to a single-stranded DNA in a biologically relevant DNA replication system. These results indicate that the availability of single-stranded DNA is not a limiting factor and support a model in which the site of entry for DnaB is altered so that it cannot be reused. We also show that 2–4 DnaA monomers are bound on the single-stranded DNA at a specific site that carries a DnaA box sequence in a hairpin structure. The molecular engine that drives bidirectional replication fork movement from the Escherichia colireplication origin (oriC) is the replicative helicase, DnaB. At oriC, two and only two helicase molecules are loaded, one for each replication fork. DnaA participates in helicase loading; DnaC is also involved, because it must be in a complex with DnaB for delivery of the helicase. Since DnaA induces a local unwinding of oriC, one model is that the limited availability of single-stranded DNA at oriC restricts the number of DnaB molecules that can bind. In this report, we determined that one DnaB helicase or one DnaB-DnaC complex is bound to a single-stranded DNA in a biologically relevant DNA replication system. These results indicate that the availability of single-stranded DNA is not a limiting factor and support a model in which the site of entry for DnaB is altered so that it cannot be reused. We also show that 2–4 DnaA monomers are bound on the single-stranded DNA at a specific site that carries a DnaA box sequence in a hairpin structure. single-stranded DNA single-stranded DNA-binding protein adenosine 5′-O- (thiotriphosphate) The Escherichia coli chromosomal origin (oriC) has two major roles (reviewed in Refs. 1Messer W. Weigel C. Neidhardt F.C. Ingraham J.L. Low K.B. Magasanik B. Schaechter M. Umbarger H.E. 2nd Ed. Escherichia coli and Salmonella typhimurium: Cellular and Molecular Biology. 2. American Society for Microbiology, Washington, D. C.1996: 1579-1601Google Scholar and 2Kaguni J.M. Mol. Cells. 1997; 7: 145-157PubMed Google Scholar). One is to act as a site where DNA replication is controlled so that it occurs only once per cell cycle. The second is to serve as a locus where the replication fork machinery is assembled, involving a series of orchestrated steps. An important event at oriC is the binding of DnaA protein to specific sequences named DnaA boxes (3Fuller R.S. Funnell B.E. Kornberg A. Cell. 1984; 38: 889-900Abstract Full Text PDF PubMed Scopus (462) Google Scholar). A second essential step in the assembly process is the DnaA-dependent recruitment of DnaB (4Marszalek J. Kaguni J.M. J. Biol. Chem. 1994; 269: 4883-4890Abstract Full Text PDF PubMed Google Scholar, 5Sutton M.D. Carr K.M. Vicente M. Kaguni J.M. J. Biol. Chem. 1998; 273: 34255-34262Abstract Full Text Full Text PDF PubMed Scopus (132) Google Scholar). Studies on the native structure of DnaB have firmly established that it is a hexamer of identical subunits arranged as a toroidal structure with a central opening (6Reha K.L. Hurwitz J. J. Biol. Chem. 1978; 253: 4043-4050PubMed Google Scholar, 7Arai K. Yasuda S. Kornberg A. J. Biol. Chem. 1981; 256: 5247-5252Abstract Full Text PDF PubMed Google Scholar, 8Turner J. Hingorani M.M. Kelman Z. O'Donnell M. EMBO J. 1999; 18: 771-783Crossref PubMed Scopus (157) Google Scholar, 9Donate L.E. Llorca O. Barcena M. Brown S.E. Dixon N.E. Carazo J.M. J. Mol. Biol. 2000; 303: 383-393Crossref PubMed Scopus (17) Google Scholar). Its stability requires the presence of Mg2+ ion; removal of the metal ion by dialysis or chelation is needed to dissociate the DnaB hexamer into its subassemblies (10Bujalowski W. Klonowska M.M. Jezewska M.J. J. Biol. Chem. 1994; 269: 31350-31358Abstract Full Text PDF PubMed Google Scholar). However, the form of DnaB that is required at the stage of initiation at oriC is as a complex with its partner, DnaC (11Wahle E. Lasken R.S. Kornberg A. J. Biol. Chem. 1989; 264: 2463-2468Abstract Full Text PDF PubMed Google Scholar, 12Wahle E. Lasken R.S. Kornberg A. J. Biol. Chem. 1989; 264: 2469-2475Abstract Full Text PDF PubMed Google Scholar). Assembly of this complex requires the binding of ATP to DnaC, with the nucleotide serving to alter the conformation of an N-terminal domain of DnaC so that it can bind to DnaB (13Ludlam A.V. McNatt M.W. Carr K.M. Kaguni J.M. J. Biol. Chem. 2001; 276: 27345-27353Abstract Full Text Full Text PDF PubMed Scopus (39) Google Scholar). Each DnaC monomer is present at a 1:1 ratio with each DnaB protomer (14Wickner S. Hurwitz J. Proc. Natl. Acad. Sci. U. S. A. 1975; 72: 921-925Crossref PubMed Scopus (113) Google Scholar, 15Lanka E. Schuster H. Nucleic Acids Res. 1983; 11: 987-997Crossref PubMed Scopus (25) Google Scholar, 16Kobori J.A. Kornberg A. J. Biol. Chem. 1982; 257: 13770-13775Abstract Full Text PDF PubMed Google Scholar). Whereas it is the DnaB-DnaC complex that is active at the stage of initiation, DnaB liberated from DnaC is active during DNA synthesis. The association of DnaC with DnaB inhibits the enzymatic activities of this essential helicase, and the hydrolysis of ATP bound to DnaC is required to release DnaC from DnaB (5Sutton M.D. Carr K.M. Vicente M. Kaguni J.M. J. Biol. Chem. 1998; 273: 34255-34262Abstract Full Text Full Text PDF PubMed Scopus (132) Google Scholar, 12Wahle E. Lasken R.S. Kornberg A. J. Biol. Chem. 1989; 264: 2469-2475Abstract Full Text PDF PubMed Google Scholar, 17Funnell B.E. Baker T.A. Kornberg A. J. Biol. Chem. 1987; 262: 10327-10334Abstract Full Text PDF PubMed Google Scholar). Once DnaB is situated at the apex of the replication fork, the helicase acts to unwind the parental DNA as each DNA strand is copied by DNA polymerase III holoenzyme. These events are facilitated by a functional coupling, involving an interaction between DnaB as it moves in the 5′-to-3′ direction on the lagging strand template and the tau subunit of DNA polymerase III holoenzyme (18Kim S. Dallmann H.G. McHenry C.S. Marians K.J. Cell. 1996; 84: 643-650Abstract Full Text Full Text PDF PubMed Scopus (303) Google Scholar). When this physical interaction is maintained, DnaB moves at a 20-fold faster rate than the speed of DnaB translocation alone. At oriC, it has been proposed that an AT-rich region unwound by DnaA protein serves as the entry site for DnaB (19Bramhill D. Kornberg A. Cell. 1988; 52: 743-755Abstract Full Text PDF PubMed Scopus (512) Google Scholar). Footprinting studies map DnaB to this region, in support of the model (20Fang L. Davey M.J. O'Donnell M. Mol. Cell. 1999; 4: 541-553Abstract Full Text Full Text PDF PubMed Scopus (165) Google Scholar). Other results indicate that only two DnaB hexamers are bound atoriC (20Fang L. Davey M.J. O'Donnell M. Mol. Cell. 1999; 4: 541-553Abstract Full Text Full Text PDF PubMed Scopus (165) Google Scholar, 21Carr K.M. Kaguni J.M. J. Biol. Chem. 2001; 276: 44919-44925Abstract Full Text Full Text PDF PubMed Scopus (54) Google Scholar). Because DnaA induces a limited degree of unwinding, one model is that only two DnaB hexamers can bind because the available single-stranded DNA (ssDNA)1 is only sufficient for one DnaB hexamer for each DNA strand. We have relied on a simple replication system to study the process of recruitment of DnaB onto DNA and to address the question of whether the availability of ssDNA influences the number of helicase molecules that can bind. With a single-stranded DNA carrying a DnaA box in a hairpin structure (M13 A-site), DnaA bound to this site forms a structure that in turn is recognized by the DnaB-DnaC complex to form an intermediate termed the prepriming complex (5Sutton M.D. Carr K.M. Vicente M. Kaguni J.M. J. Biol. Chem. 1998; 273: 34255-34262Abstract Full Text Full Text PDF PubMed Scopus (132) Google Scholar, 22Masai H. Nomura N. Arai K. J. Biol. Chem. 1990; 265: 15134-15144Abstract Full Text PDF PubMed Google Scholar). Following the release of DnaC, DnaB is then free to move on the ssDNA. The transient binding of primase to DnaB results in primers that are formed at apparently random locations (23Lu Y.B. Ratnakar P.V. Mohanty B.K. Bastia D. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 12902-12907Crossref PubMed Scopus (99) Google Scholar,24Chang P. Marians K.J. J. Biol. Chem. 2000; 275: 26187-26195Abstract Full Text Full Text PDF PubMed Scopus (37) Google Scholar). These primers are then extended by DNA polymerase holoenzyme in conversion of the ssDNA to duplex form. In this system, DNA replication is dependent on a single DnaA box-containing sequence, and only one DNA strand is synthesized on the ssDNA template. By comparison, DNA replication from oriC is more complicated because a duplex DNA is involved, and each parental DNA strand is bound by DnaB to support bidirectional replication fork movement. Priming and DNA synthesis occur on both strands of the parental duplex. In this report, we sought to characterize further the molecular composition of the complex formed by the binding of DnaA, DnaB, and DnaC protein to the ssDNA carrying the DnaA box hairpin. The major objective was to test the model that the amount of ssDNA available influences the number of DnaB molecules that can bind. Several independent methods were used. In the first, a 379-nucleotide-long ssDNA bearing the DnaA box hairpin and covered by SSB was used to demonstrate the binding of DnaA in gel mobility shift assays. The second involved a primer extension assay to demonstrate the binding and positions of these proteins to the DnaA box hairpin. In the third approach, we used immunoblot analysis to determine the ratio of DnaA, DnaB, and DnaC protein assembled on the ssDNA. These results show that DnaA protein bound to the DnaA box hairpin recruits only a single DnaB hexamer and strongly suggest that the availability of ssDNA is not a limiting factor in the loading of DnaB onto DNA. M13 A-site ssDNA (25Nomura N. Masai H. Inuzuka M. Miyazaki C. Ohtsubo E. Itoh T. Sasamoto S. Matsui M. Ishizaki R. Arai K. Gene (Amst.). 1991; 108: 15-22Crossref PubMed Scopus (47) Google Scholar), purified proteins, and antibodies have been described previously (4Marszalek J. Kaguni J.M. J. Biol. Chem. 1994; 269: 4883-4890Abstract Full Text PDF PubMed Google Scholar, 26Marszalek J. Kaguni J.M. J. Biol. Chem. 1992; 267: 19334-19340Abstract Full Text PDF PubMed Google Scholar). M13 −40 universal primer (17-mer) and ATPγS were from U.S. Biochemical Corp. The large fragment of DNA polymerase I was from Roche Molecular Biochemicals. Horseradish peroxidase-conjugated goat anti-mouse and goat anti-rabbit were from Bio-Rad. Oligonucleotides (GCGGATAACAATTTCACAC and CAGTGCCAAGCTTGGCTGCAG) were synthesized by a campus facility and were used to PCR-amplify the region containing the DnaA box hairpin. These primers are derived from M13mp8, the DNA vector used to construct M13 A-site. After PCR amplification, the product was digested with HindIII endonuclease that cleaves within the latter primer and then end-filled at this restriction site with [α-32P]dATP and the large fragment of DNA polymerase I to label specifically the viral strand ssDNA fragment. In Fig.1 B, the primer corresponding to the viral strand was first radiolabeled with T4 polynucleotide kinase and [γ-32P]ATP, and then the unincorporated label was removed by passing the sample over a Sephadex G25 spin column before PCR amplification. The PCR-amplified DNA was then combined with a 3-fold molar excess of M13 A-site ssDNA in 1× SSC, placed in a water bath at 100 °C, and allowed to cool gradually to room temperature to anneal the PCR-amplified DNA strand that is complementary to the M13 A-site viral ssDNA. The DNA of viral strand sense remains single-stranded. The sample was then electrophoresed in a 1% agarose gel in buffer containing 90 mm Tris borate, pH 8.9, and 1 mm EDTA. The 379-nucleotide-long ssDNA carrying the DnaA box hairpin was then isolated from a gel slice (QiaQuick spin column; Qiagen). The identity of the isolated ssDNA fragment was confirmed by use of strand-specific oligonucleotides that annealed to both the isolated ssDNA fragment and the viral M13 A-site ssDNA. As a negative control, an oligonucleotide of the same sense as the viral strand did not anneal to either the isolated ssDNA fragment or the viral M13 A-site ssDNA. The concentration of the isolated ssDNA fragment was determined by specific radioactivity and by agarose gel electrophoresis and staining with ethidium bromide relative to known amounts of a DNA fragment of similar size. Reactions (10 μl) contained 5.8 fmol of 32P-labeled ssDNA fragment bearing the DnaA box hairpin (379 nucleotides long) in ABC Buffer (40 mmHEPES-KOH, pH 8.0, 40 mm potassium glutamate, 4% (w/v) sucrose, 8 mm magnesium acetate, 0.1 mg/ml bovine serum albumin, and 2 mm dithiothreitol), SSB, DnaA, and ATP as indicated. Reactions were incubated at 25 °C for 10 min and then analyzed by native gel electrophoresis. Polyacrylamide gel electrophoresis (4%, 38:1 acrylamide/bisacrylamide) was in buffer containing 50 mm Tris-HCl, pH 8.0, 0.38 mglycine, 8 mm MgCl2, and 1 mm EDTA as described (27Sun W. Godson G.N. J. Bacteriol. 1996; 178: 6701-6705Crossref PubMed Google Scholar). The gels (13 cm, 11 cm, 1.5 mm) were run in this buffer at 60–70 V for 6–7 h or at 30 V for 14 h and then were dried and autoradiographed. Reactions (25 μl) contained M13 A-site ssDNA annealed to the −40 universal primer (50 ng), SSB (1 μg), DnaA (45 ng), DnaB (50 ng), and DnaC (25 ng) as indicated and ATPγS (0.1 mm) as indicated in ABC Buffer. After incubation for 10 min at 30 °C, deoxynucleotides (50 μm each including [α-32P]dCTP, 400 cpm/pmol of total nucleotide) and the large fragment of DNA polymerase I (2 units) were added, followed by incubation at 37 °C for 5 min. Samples were denatured in a boiling water bath and then electrophoretically separated on a sequencing gel followed by autoradiography to visualize the extension products. DNA sequencing reactions by the dideoxy chain terminating method with the singly primed M13 A-site template described above provided molecular weight markers to map the 3′-ends of the primer extension products. Reactions of prepriming complex formation (100 μl), a 50-fold scale up of a standard replication reaction in terms of DNA and replication protein components, contained M13 A-site ssDNA (5 μg), SSB (30 μg), DnaA (2.8 μg), DnaB (10 μg), and DnaC (5 μg) as indicated in ABC Buffer supplemented with 0.1 mm ATP or 0.1 mmATPγS. After incubation at 25 °C for 10 min, samples were applied onto gel filtration columns (Sepharose 4B, 0.7 × 13 cm; AmershamBiosciences) equilibrated in ABC Buffer supplemented with 0.1 mm ATP or 0.1 mm ATPγS, as indicated. Fractions of 200 μl were collected, and the isolated prepriming complexes were analyzed by quantitative immunoblotting. Fractions from gel filtration chromatography were analyzed by agarose gel electrophoresis to identify void volume fractions containing M13 A-site ssDNA and, where indicated, to quantitate the amount of DNA by comparison with known amounts of M13 A-site ssDNA that was co-electrophoresed and used to prepare a standard curve. The ethidium bromide-stained gels were photographed and analyzed with an Eastman Kodak Co. EDAS 120 gel documentation system. To quantitate the amounts of the respective proteins bound to the ssDNA, samples were electrophoretically separated by SDS-polyacrylamide gel electrophoresis and then transferred to nitrocellulose membranes (BA-85; Schleicher and Schuell) alongside known amounts of the respective purified protein to prepare a standard curve. The blots were probed with either M43 monoclonal antibody for DnaA (28Marszalek J. Zhang W. Hupp T.R. Margulies C. Carr K.M. Cherry S. Kaguni J.M. J. Biol. Chem. 1996; 271: 18535-18542Abstract Full Text Full Text PDF PubMed Scopus (55) Google Scholar) or a combination of affinity-purified polyclonal antibodies for DnaB and DnaC. Chemiluminescence (SuperSignal; Pierce) of immune complexes of horseradish peroxidase conjugated to the secondary antibody was analyzed with a Bio-Rad model GS505 molecular imager and associated software. Previous studies indicate that DnaA protein recognizes and binds to a DnaA box sequence in a putative hairpin structure, as indicated by footprinting studies with DNase I and dimethyl sulfate and by mutational analysis of the DnaA box hairpin (22Masai H. Nomura N. Arai K. J. Biol. Chem. 1990; 265: 15134-15144Abstract Full Text PDF PubMed Google Scholar). To confirm these observations, we developed assay conditions to measure the binding of DnaA protein to a 379-nucleotide-long ssDNA fragment carrying the DnaA box hairpin. Because prepriming complex formation occurs on an ssDNA covered by SSB, the amount of SSB needed to saturate the DNA was first explored. The binding site size for SSB is 65 ± 3 nucleotides at the moderate ionic strength used in this experiment (29Lohman T.M. Bujalowski W. Biochemistry. 1994; 33: 6167-6176Crossref PubMed Scopus (25) Google Scholar, 30Overman L.B. Bujalowski W. Lohman T.M. Biochemistry. 1988; 27: 456-471Crossref PubMed Scopus (141) Google Scholar, 31Bujalowski W. Lohman T.M. J. Mol. Biol. 1987; 195: 897-907Crossref PubMed Scopus (68) Google Scholar), and recent studies confirm that the ssDNA wraps around the SSB tetramer, with each dimer capable of binding an oligonucleotide of 35 residues (32Kozlov A.G. Lohman T.M. Biochemistry. 2002; 41: 6032-6044Crossref PubMed Scopus (82) Google Scholar). The hairpin of 62 bases is stable in the presence of SSB because it remains sensitive to DNase I cleavage (22Masai H. Nomura N. Arai K. J. Biol. Chem. 1990; 265: 15134-15144Abstract Full Text PDF PubMed Google Scholar). The left arm of 110 nucleotides can accommodate two tetramers, with one tetramer bound to 65 nucleotides and the second tetramer bound to 35 nucleotides via one of its dimers. The right arm of 207 nucleotides is long enough to be bound by three SSB tetramers. Our observation of five complexes with increasing SSB is consistent with these expectations. Once conditions established the level of SSB that was saturating for this ssDNA fragment, the effect of DnaA on the mobility of the SSB-ssDNA complex was examined. At the highest levels of DnaA, a single, more slowly migrating complex was detected (Fig.1 B). Complexes of intermediate mobility were not observed. As described below, 2–4 DnaA monomers are bound to the DnaA box hairpin. Thus, binding of DnaA to this sequence appears to be concerted because only a single shifted complex was observed. It is noteworthy that in this replication system, the level of SSB is not critical as long as it is at or above the level needed to cover the ssDNA (data not shown). The conclusion from this set of experiments is that DnaA is able to bind to the hairpin structure (as will be shown below also) to form a single discrete complex despite the abundant presence of SSB. Experiments were also performed to measure the binding of DnaA to the ssDNA fragment without SSB or at subsaturating SSB (data not shown). Under either condition, DnaA did not form discrete complexes but bound nonspecifically to the ssDNA fragment based on the formation of complexes that migrated as a smear. This was observed only at the highest levels tested (under reaction conditions as described in Fig.1 B; range of DnaA from 0.09 to 2.8 pmol in increments that varied 2-fold). These results suggest that the binding of SSB to the ssDNA masks sites of nonspecific binding of DnaA. Because of the appearance of discrete SSB-ssDNA complexes at subsaturating SSB, the possibility arises that SSB is not binding randomly and that the stem-loop structure imposes an order in the binding of SSB to the ssDNA. However, Sun and Godson observed the formation of discrete complexes using ssDNA from the lacZcoding region (33Sun W. Godson G.N. J. Biol. Chem. 1993; 268: 8026-8039Abstract Full Text PDF PubMed Google Scholar). They concluded that SSB did not bind to this DNA in a phased manner from results of in situcopper-phenanthroline footprinting of complexes separated by gel mobility shift. Based on these observations, the several discrete SSB-ssDNA complexes formed at subsaturating SSB are not likely to reflect specific binding of SSB to the ssDNA. An independent approach to measure the binding of DnaA (and other proteins) to the DnaA box hairpin relied on a primer extension assay. In this method, no nuclease was used to generate an end point at which the DNA polymerase terminates DNA synthesis. Instead, the ability of a stably bound protein to hinder progress of the DNA polymerase results in a unique primer extension product. A primer was annealed downstream of the hairpin, and then SSB and the indicated proteins were added to allow binding to the ssDNA before primer extension and detection of the single-stranded DNAs by autoradiography (Fig. 2, lanes 1–5). In all lanes, including the control with no other added protein except SSB, radioactive material was observed that remained at or very near the wells of the sequencing gel. This DNA may have arisen by renaturation of the labeled DNA to the ssDNA template. A population of DNAs in all lanes at a position one-fourth of the way into the gel presumably represents primer extension products due to DNA synthesis well beyond the DnaA box hairpin. With DnaA alone on the SSB-coated ssDNA, an extension product was observed that mapped to within the DnaA box sequence (lane 2, summarized in Fig. 2 B). The additional inclusion of DnaB alone and in combination with DnaC but in the absence of nucleotide (required to form the DnaB-DnaC complex) did not appreciably alter the abundance of this DNA; nor were other new products seen (lanes 3 and 4). Upon inclusion of DnaB and DnaC but with omission of DnaA, this DNA was not observed, so its appearance is dependent on the binding of DnaA to the DnaA box hairpin. In the absence of DnaA, DnaB, and DnaC, no stop sites were observed that we could attribute to the DnaA box hairpin. Apparently, the stem-loop structure itself does not serve as a pause site for the DNA polymerase. The failure to detect terminations due to SSB bound to the ssDNA may indicate that the bound SSB is not an obstacle or that SSB, if bound randomly to the ssDNA, gives rise to primer extension products whose 3′-ends are not at discrete sites. ATPγS was included in one set of reactions (Fig. 2, lanes 6–9), because this analogue supports the formation of the DnaB-DnaC complex but, since it is poorly if at all hydrolyzed, does not support the release of DnaC from DnaB (5Sutton M.D. Carr K.M. Vicente M. Kaguni J.M. J. Biol. Chem. 1998; 273: 34255-34262Abstract Full Text Full Text PDF PubMed Scopus (132) Google Scholar, 11Wahle E. Lasken R.S. Kornberg A. J. Biol. Chem. 1989; 264: 2463-2468Abstract Full Text PDF PubMed Google Scholar). Inclusion of this nucleotide did not affect the abundance of the primer extension product formed by the binding of DnaA to the DnaA box hairpin, nor were other products observed (lane 6 compared withlane 2). Evidently, the stability of DnaA bound to the hairpin is comparable in the presence or absence of ATPγS. Upon further supplementation with the DnaB-DnaC complex (Fig. 2,lane 8), additional terminations were seen (summarized in Fig. 2 B). The appearance of these products required the inclusion of DnaA (compare with Fig. 2, lane 9). The primer extension product that mapped to the 3′-side of the hairpin was 10 nucleotides from the stop site within the DnaA box where DnaA is bound. On the 5′ side of the hairpin, a less abundant primer extension product mapped 10 residues upstream from the nucleotide that is paired to the base where termination occurs due to DnaA binding. As will be described below, evidence indicates that a single DnaB hexamer or a single DnaB-DnaC complex is bound. For a model to account for these termination sites, see “Discussion.” Since DnaA physically interacts with DnaB in the DnaB-DnaC complex in the recruitment of the helicase into the prepriming complex (4Marszalek J. Kaguni J.M. J. Biol. Chem. 1994; 269: 4883-4890Abstract Full Text PDF PubMed Google Scholar), the primer extension results suggest that the DnaB-DnaC complex is bound directly adjacent to DnaA at the DnaA box. Interestingly, the abundance of the termination product attributed to the binding of DnaA was elevated upon supplementation of the reaction containing DnaA with ATPγS, DnaB, and DnaC (Fig. 2, lane 9 compared with lane 6). As shown below, the presence or absence of DnaB and DnaC did not alter statistically the ratio of DnaA monomers bound to the DnaA box hairpin, so DnaB and DnaC do not stabilize DnaA at this site. One possible explanation for the elevated termination due to the binding of DnaA is that DnaA in the prepriming complex assumes a conformation that impedes movement of the DNA polymerase during primer extension. The results of Fig. 2 support the model of a specific nucleoprotein structure. To determine its molecular composition, quantitative immunoblot analysis of the proteins that form this nucleoprotein complex was performed. As a control, we demonstrated that the assembly of DnaA, DnaB, and DnaC on the ssDNA was specific for the DnaA box hairpin (Fig. 3). The M13 derivative carrying the DnaA box hairpin or wild type M13 was incubated with DnaA, DnaB, DnaC, and SSB. As in Fig. 2, ATPγS was included to support formation of the DnaB-DnaC complex but not the release of DnaC once the complex was bound to the ssDNA (5Sutton M.D. Carr K.M. Vicente M. Kaguni J.M. J. Biol. Chem. 1998; 273: 34255-34262Abstract Full Text Full Text PDF PubMed Scopus (132) Google Scholar, 11Wahle E. Lasken R.S. Kornberg A. J. Biol. Chem. 1989; 264: 2463-2468Abstract Full Text PDF PubMed Google Scholar). After a period of incubation, proteins bound to each ssDNA were separated from unbound protein by gel filtration chromatography. The fractions obtained were then analyzed by agarose gel electrophoresis to identify void volume fractions containing the ssDNA. Column fractions were also analyzed by immunoblotting. As shown in Fig. 3 B, DnaA, DnaB, and DnaC coeluted with the ssDNA carrying the DnaA box sequence. With the ssDNA lacking the DnaA box hairpin, DnaA was not detected in void volume fractions. The low level of DnaB and the level of DnaC that was below detection in these fractions presumably reflect nonspecific binding of the DnaB-DnaC complex to the SSB-coated ssDNA. These results indicate that formation of the prepriming complex is specific for the ssDNA carrying the DnaA box hairpin. Under the conditions described above, prepriming complexes were assembled at the DnaA box hairpin carried in M13 ssDNA, and the nucleoprotein complex was isolated by gel filtration. The isolated prepriming complex was then analyzed by quantitative immunoblotting to determine the amounts of proteins bound (see Fig. 4 for representative examples). The amount of ssDNA in the isolated complex was determined by quantitation of ethidium bromide-stained agarose gels relative to known amounts of DNA that were co-electrophoresed. Replicate experiments were performed in order to analyze the data statistically (Table I).Table IStoichiometry of DnaA, DnaB, and DnaC at the DnaA box hairpinReaction conditionsDnaADnaBDnaCnDnaA, DnaB, DnaC, and 0.1 mm ATPγS3.6 ± 0.84.0 ± 0.93.8 ± 1.63DnaA, DnaB, DnaC, and 0.1 mm ATP2.3 ± 0.54.2 ± 0.8None detected4DnaA and 0.1 mm ATPγS3.9 ± 1.95DnaA and 0.1 mm ATP2.6 ± 1.02The results from replicate experiments under the indicated experimental conditions were averaged to calculate the S.D. for the stoichiometries of DnaA, DnaB, and DnaC protein bound to the ssDNA. The termn refers to the number of replicate experiments under a given condition. Open table in a new tab The results from replicate experiments under the indicated experimental conditions were averaged to calculate the S.D. for the stoichiometries of DnaA, DnaB, and DnaC protein bound to the ssDNA. The termn refers to the number of replicate experiments under a given condition. Regardless of whether DnaB and DnaC were also included, 2–4 DnaA monomers were bound to the DnaA box hairpin. The stoichiometry of DnaA monomers per ssDNA circle is statistically indistinguishable whether the complexes were assembled and isolated with ATP or ATPγS. When DnaB and DnaC were included under conditions that support formation of the DnaB-DnaC complex, the stoichiometry of 4 ± 0.9 and 4.2 ± 0.8 DnaB monomers bound per ssDNA is consistent with a single hexamer bound in the prepriming complex. The nucleotide analogue ATPγS maintains the association of DnaC with DnaB, because ATP hydrolysis is required for the release of DnaC after DnaB has become stably bound to the ssDNA. The comparable stoichiometries of DnaC and DnaB in the prepriming complex under this condition support the conclusion that a single DnaB6-DnaC6 complex is bound per ssDNA. When the prepriming complex was assembled with ATP instead, the inability to detect DnaC in the isolated complex indicates that DnaC has been released. Conditions for the assembly of the prepriming complex include an incubation step at 20 °C for 10 min followed by isolation of the protein-DNA complex that takes another 10 min. Because the rate of DnaB translocation is estimated at 35 nucleotides/s at 30 °C (18Kim S. Dallmann H.G." @default.
• W2100561498 created "2016-06-24" @default.
• W2100561498 creator A5016708001 @default.
• W2100561498 creator A5020394380 @default.
• W2100561498 date "2002-10-01" @default.
• W2100561498 modified "2023-09-30" @default.
• W2100561498 title "Escherichia coli DnaA Protein Loads a Single DnaB Helicase at a DnaA Box Hairpin" @default.
• W2100561498 cites W1493292322 @default.
• W2100561498 cites W150420254 @default.
• W2100561498 cites W1511206323 @default.
• W2100561498 cites W1519314712 @default.
• W2100561498 cites W1524481888 @default.
• W2100561498 cites W1563195770 @default.
• W2100561498 cites W1587598493 @default.
• W2100561498 cites W1591715670 @default.
• W2100561498 cites W1594633077 @default.
• W2100561498 cites W1605117055 @default.
• W2100561498 cites W1616137642 @default.
• W2100561498 cites W1671632725 @default.
• W2100561498 cites W1725095175 @default.
• W2100561498 cites W1923290408 @default.
• W2100561498 cites W1979770466 @default.
• W2100561498 cites W1982618160 @default.
• W2100561498 cites W1988983348 @default.
• W2100561498 cites W1992075060 @default.
• W2100561498 cites W1998617624 @default.
• W2100561498 cites W1999925341 @default.
• W2100561498 cites W2000581423 @default.
• W2100561498 cites W2005954755 @default.
• W2100561498 cites W2009418759 @default.
• W2100561498 cites W2010594969 @default.
• W2100561498 cites W2019081472 @default.
• W2100561498 cites W2021236910 @default.
• W2100561498 cites W2026007247 @default.
• W2100561498 cites W2035066796 @default.
• W2100561498 cites W2042874033 @default.
• W2100561498 cites W2044016235 @default.
• W2100561498 cites W2060255621 @default.
• W2100561498 cites W2070059581 @default.
• W2100561498 cites W2074231578 @default.
• W2100561498 cites W207515165 @default.
• W2100561498 cites W2077153159 @default.
• W2100561498 cites W2084874442 @default.
• W2100561498 cites W2088553142 @default.
• W2100561498 cites W2089400644 @default.
• W2100561498 cites W2090695231 @default.
• W2100561498 cites W2094381752 @default.
• W2100561498 cites W2130421925 @default.
• W2100561498 cites W2135995702 @default.
• W2100561498 cites W2148330718 @default.
• W2100561498 cites W2149923817 @default.
• W2100561498 cites W2154475521 @default.
• W2100561498 cites W2408986500 @default.
• W2100561498 doi "https://doi.org/10.1074/jbc.m205031200" @default.
• W2100561498 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/12161435" @default.
• W2100561498 hasPublicationYear "2002" @default.
• W2100561498 type Work @default.
• W2100561498 sameAs 2100561498 @default.
• W2100561498 citedByCount "29" @default.
• W2100561498 countsByYear W21005614982012 @default.
• W2100561498 countsByYear W21005614982013 @default.
• W2100561498 countsByYear W21005614982014 @default.
• W2100561498 countsByYear W21005614982015 @default.
• W2100561498 countsByYear W21005614982016 @default.
• W2100561498 countsByYear W21005614982017 @default.
• W2100561498 countsByYear W21005614982018 @default.
• W2100561498 countsByYear W21005614982023 @default.
• W2100561498 crossrefType "journal-article" @default.
• W2100561498 hasAuthorship W2100561498A5016708001 @default.
• W2100561498 hasAuthorship W2100561498A5020394380 @default.
• W2100561498 hasBestOaLocation W21005614981 @default.
• W2100561498 hasConcept C104317684 @default.
• W2100561498 hasConcept C107827726 @default.
• W2100561498 hasConcept C116107829 @default.
• W2100561498 hasConcept C121332964 @default.
• W2100561498 hasConcept C161223559 @default.
• W2100561498 hasConcept C185592680 @default.
• W2100561498 hasConcept C2908821069 @default.
• W2100561498 hasConcept C54355233 @default.
• W2100561498 hasConcept C547475151 @default.
• W2100561498 hasConcept C552990157 @default.
• W2100561498 hasConcept C58337764 @default.
• W2100561498 hasConcept C67705224 @default.
• W2100561498 hasConcept C73573662 @default.
• W2100561498 hasConcept C86803240 @default.
• W2100561498 hasConceptScore W2100561498C104317684 @default.
• W2100561498 hasConceptScore W2100561498C107827726 @default.
• W2100561498 hasConceptScore W2100561498C116107829 @default.
• W2100561498 hasConceptScore W2100561498C121332964 @default.
• W2100561498 hasConceptScore W2100561498C161223559 @default.
• W2100561498 hasConceptScore W2100561498C185592680 @default.
• W2100561498 hasConceptScore W2100561498C2908821069 @default.
• W2100561498 hasConceptScore W2100561498C54355233 @default.
• W2100561498 hasConceptScore W2100561498C547475151 @default.
• W2100561498 hasConceptScore W2100561498C552990157 @default.
• W2100561498 hasConceptScore W2100561498C58337764 @default.
• W2100561498 hasConceptScore W2100561498C67705224 @default.
• W2100561498 hasConceptScore W2100561498C73573662 @default.

• next