FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2101813653> ?p ?o ?g. }

• W2101813653 endingPage "22928" @default.
• W2101813653 startingPage "22921" @default.
• W2101813653 abstract "The involvement of oxidative stress in freeze-thaw injury to yeast cells was analyzed using mutants defective in a range of antioxidant functions, including Cu,Zn superoxide dismutase (encoded by SOD1), Mn superoxide dismutase (SOD2), catalase A, catalase T, glutathione reductase, γ-glutamylcysteine synthetase and Yap1 transcription factor. Only those affecting superoxide dismutases showed decreased freeze-thaw tolerance, with the sod1 mutant and the sod1 sod2 double mutant being most affected. This indicated that superoxide anions were formed during freezing and thawing. This was confirmed since the sod1 mutant could be made more resistant by treatment with the superoxide anion scavenger MnCl2, or by freezing in the absence of oxygen, or by the generation of a rho0 petite. Increased expression of SOD2 conferred freeze-thaw tolerance on thesod1 mutant indicating the ability of the mitochondrial superoxide dismutase to compensate for the lack of the cytoplasmic enzyme. Free radicals generated as a result of freezing and thawing were detected in cells directly using electron paramagnetic resonance spectroscopy with eitherα-phenyl-N-tert-butylnitrone or 5,5-dimethyl-1-pyrroline-N-oxide as spin trap. Highest levels were formed in the sod1 and sod1 sod2 mutant strains, but lower levels were detected in the wild type. The results show that oxidative stress causes major injury to cells during aerobic freezing and thawing and that this is mainly initiated in the cytoplasm by an oxidative burst of superoxide radicals formed from oxygen and electrons leaked from the mitochondrial electron transport chain. The involvement of oxidative stress in freeze-thaw injury to yeast cells was analyzed using mutants defective in a range of antioxidant functions, including Cu,Zn superoxide dismutase (encoded by SOD1), Mn superoxide dismutase (SOD2), catalase A, catalase T, glutathione reductase, γ-glutamylcysteine synthetase and Yap1 transcription factor. Only those affecting superoxide dismutases showed decreased freeze-thaw tolerance, with the sod1 mutant and the sod1 sod2 double mutant being most affected. This indicated that superoxide anions were formed during freezing and thawing. This was confirmed since the sod1 mutant could be made more resistant by treatment with the superoxide anion scavenger MnCl2, or by freezing in the absence of oxygen, or by the generation of a rho0 petite. Increased expression of SOD2 conferred freeze-thaw tolerance on thesod1 mutant indicating the ability of the mitochondrial superoxide dismutase to compensate for the lack of the cytoplasmic enzyme. Free radicals generated as a result of freezing and thawing were detected in cells directly using electron paramagnetic resonance spectroscopy with eitherα-phenyl-N-tert-butylnitrone or 5,5-dimethyl-1-pyrroline-N-oxide as spin trap. Highest levels were formed in the sod1 and sod1 sod2 mutant strains, but lower levels were detected in the wild type. The results show that oxidative stress causes major injury to cells during aerobic freezing and thawing and that this is mainly initiated in the cytoplasm by an oxidative burst of superoxide radicals formed from oxygen and electrons leaked from the mitochondrial electron transport chain. reactive oxygen species superoxide anion hydroperoxy radical hydroxyl radical superoxide dismutase yeast extract peptone dextrose medium synthetic minimal dextrose medium ο-nitrophenyl-β-d-galactose α-phenyl-N-tert-butylnitrone 5,5-dimethyl-1-pyrroline-N-oxide base pair millitesla. Cryopreservation provides an excellent way of preserving living cells and storing them and has found wide application in medicine, agriculture, and food technology. However, the processes of freezing and thawing cause severe stress to cells and can lead to loss of viability. There is, therefore, a need to understand the molecular mechanisms that underlie freeze-thaw damage and how cells survive it or respond to prevent it. A number of hypotheses have been proposed to explain the damage caused by freezing and thawing; these are based on an analysis of the physical and chemical changes that occur. For example, cells are known to be damaged by physical changes associated with ice nucleation and dehydration (1Mazur P. Science. 1970; 168: 939-949Crossref PubMed Scopus (1238) Google Scholar). They can also be affected by accompanying changes in intracellular osmolarity and pH which lead to aggregation of macromolecules (2Levitt J. Meryman H.T. Cryobiology. Academic Press, New York1966: 495-563Google Scholar) and denaturation of proteins (3Franks F. Mathias S. Galfre P. Brown D. Cryobiology. 1983; 20: 298-309Crossref PubMed Scopus (69) Google Scholar, 4Clegg J.S. Seitz P. Hazelwood C.F. Cryobiology. 1982; 19: 306-316Crossref PubMed Scopus (124) Google Scholar). Oxidative damage has also been considered to be a factor since an oxidative burst has been predicted to occur during thawing (5Hermes-Lima M. Storey K.B. Am. J. Physiol. 1993; 265: R646-R652PubMed Google Scholar), and this would lead to the generation of reactive oxygen species (ROS)1 and oxidative damage to cellular components. This is supported by the observation that antioxidant defense systems of reptiles are activated by freezing stress (5Hermes-Lima M. Storey K.B. Am. J. Physiol. 1993; 265: R646-R652PubMed Google Scholar) and that overexpression of superoxide dismutase enhances the freezing tolerance of transgenic Alfalfa (6McKersie B.D. Chen Y. de Beus M. Bowley S.R. Bowler C. Inze D. D'Halluin K. Botterman J. Plant Physiol. 1993; 103: 1155-1163Crossref PubMed Scopus (284) Google Scholar). Moreover we have shown that yeast cells can become more resistant to freeze-thaw damage following treatment with a dose of hydrogen peroxide that causes cells to adapt to further peroxide stress (7Park J.-I. Grant C.M. Attfield P.V. Dawes I.W. Appl. Environ. Microbiol. 1997; 63: 3818-3824Crossref PubMed Google Scholar). Here we examine the extent to which oxidative damage occurs during freezing and thawing of cells and directly demonstrate the generation of ROS. ROS are generated as an unavoidable side reaction in living systems that rely on oxygen as the terminal electron acceptor during energy generation. One primary product of electron leakage from the respiratory chain is the superoxide anion (O⨪2) generated by the one-electron reduction of O2 (8Fridovich I. Annu. Rev. Biochem. 1995; 64: 97-112Crossref PubMed Scopus (2755) Google Scholar, 9Turrens J.F. Biosci. Rep. 1997; 17: 3-8Crossref PubMed Scopus (755) Google Scholar). This can also be formed from other enzymatic systems including xanthine oxidase or NADPH oxidase (8Fridovich I. Annu. Rev. Biochem. 1995; 64: 97-112Crossref PubMed Scopus (2755) Google Scholar). The superoxide anion disturbs the redox balance of cells by reducing and releasing metal ions from metal ion-clustered proteins or is converted to other ROS including the peroxy radical (HO⨪2) or H2O2 (10Gutteridge J.M.C. Chem. Biol. Interact. 1994; 91: 133-140Crossref PubMed Scopus (273) Google Scholar, 11Gille G. Sigler K. Folia Microbiol. 1995; 40: 131-152Crossref PubMed Scopus (199) Google Scholar). Reduced metal ions and H2O2 undergo the Fenton reaction generating one of the most reactive ROS, the hydroxyl radical (⋅OH). These ROS damage cells by reacting with many cellular molecules including proteins, lipids, and DNA (12Ames B.N. Shigenaga M.K. Hagan T.M. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 7915-7952Crossref PubMed Scopus (5446) Google Scholar, 13Moradas-Ferreira P. Costa V. Piper P. Mager W. Mol. Microbiol. 1996; 19: 651-658Crossref PubMed Scopus (235) Google Scholar). The generation of ROS is accelerated as an oxidative burst following ischemia and reoxygenation since this stimulates the conversion of dehydrogenases to oxidases and the introduction of excess O2 in the cell cytoplasm (14Roy R.S. McCord J.C. Greenwald R. Cohen G. Oxyradicals and Their Scavenging Systems. 2. Elsevier Science Publishers B.V., Amsterdam1983: 145-153Google Scholar). Freezing and thawing may form an analogous situation since cells are isolated from O2 following freezing and are re-oxygenated during thawing. This may be augmented by the attendant dehydration and rehydration processes that result from the balancing of vapor pressure between intra- and extracellular ice systems during freezing and thawing (1Mazur P. Science. 1970; 168: 939-949Crossref PubMed Scopus (1238) Google Scholar). Cells contain various enzymatic and non-enzymatic systems for detoxifying ROS (15Rock C.L. Jacob R.A. Bowen P.E. J. Am. Diet. Assoc. 1996; 96: 693-702Abstract Full Text Full Text PDF PubMed Scopus (258) Google Scholar, 16Jacob R.A. Burri B.J. Am. J. Clin. Nutr. 1996; 63: 985-990Crossref PubMed Scopus (354) Google Scholar, 17Halliwell B. Aeschbach R. Loliger J. Aruoma O.I. Food Chem. Toxicol. 1995; 33: 601-617Crossref PubMed Scopus (780) Google Scholar). One main defense system is provided by superoxide dismutases that convert O⨪2 to H2O2 (18Fridovich I. J. Biol. Chem. 1997; 272: 18515-18517Abstract Full Text Full Text PDF PubMed Scopus (1071) Google Scholar, 19Gralla E.B. Scandalios J.G. Oxidative Stress and the Molecular Biology of Antioxidant Defenses. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1997: 495-525Google Scholar) which is then disproportionated to water by catalases or peroxidases (20Ruis H. Koller F. Scandalios J.G. Oxidative Stress and the Molecular Biology of Antioxidant Defenses. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1997: 309-343Google Scholar). Yeast has two types of superoxide dismutase (SOD). The Cu,Zn-SOD encoded by theSOD1 gene is located in the cytoplasm; its level is constitutively high (about 1% of soluble protein in the cell) during fermentation and respiration (19Gralla E.B. Scandalios J.G. Oxidative Stress and the Molecular Biology of Antioxidant Defenses. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1997: 495-525Google Scholar). The Mn-SOD encoded bySOD2 is located in the mitochondrial matrix, and from a low level in fermentative cells it is induced during respiration (19Gralla E.B. Scandalios J.G. Oxidative Stress and the Molecular Biology of Antioxidant Defenses. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1997: 495-525Google Scholar) or starvation (21Flattery-O'Brien J.A. Grant C.M. Dawes I.W. Mol. Microbiol. 1997; 23: 303-312Crossref PubMed Scopus (56) Google Scholar). Other systems found in yeast include the cytoplasmic catalase encoded by CTT1, the peroxisomal catalase encoded by CTA1 (20Ruis H. Koller F. Scandalios J.G. Oxidative Stress and the Molecular Biology of Antioxidant Defenses. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1997: 309-343Google Scholar), and the glutathione-based systems including glutathione itself and various peroxidases (22Grant C.M. Dawes I.W. Redox Rep. 1996; 2: 223-229Crossref PubMed Scopus (51) Google Scholar). Here we have exploited the availability of mutations affecting oxidative stress response systems in the yeast Saccharomyces cerevisiae to characterize the nature and extent of oxidative stress encountered by cells during freezing and thawing. The mutations used included those in CTA1, CTT1, SOD1, SOD2, and YAP1 which encodes a transcriptional activator required for stress-induced expression of several oxidative defense genes (13Moradas-Ferreira P. Costa V. Piper P. Mager W. Mol. Microbiol. 1996; 19: 651-658Crossref PubMed Scopus (235) Google Scholar, 23Wu A. Wemmie J.A. Edgington N.P. Goebl M. Guevara J.L. Moye-Rowley W.S. J. Biol. Chem. 1993; 268: 18850-18858Abstract Full Text PDF PubMed Google Scholar), GSH1 which encodes γ-glutamylcysteine synthetase, and GLR1 encoding glutathione reductase (22Grant C.M. Dawes I.W. Redox Rep. 1996; 2: 223-229Crossref PubMed Scopus (51) Google Scholar). Cu,Zn-SOD and Mn-SOD were found to be involved in the recovery of cells from freeze-thaw injury, and this enabled an indication of the nature of the major species causing oxidative stress damage and where this damage occurred in the cells. The role of SODs in the process was further analyzed using mutations affecting mitochondrial activity, and the free radicals generated during freeze-thaw injury in wild-type and sod mutants have been detected and characterized using electron paramagnetic resonance (EPR) spectroscopy. 190 Yeast strains used are described in Table I. The rho0 respiratory-deficient strains, 1783rho0and KS105rho0, were generated by treating 1783 and KS105 with ethidium bromide (24Spencer J.F.T. Spencer D.M. Campbell I. Duffus J.H. Yeast: A Practical Approach. IRL Press at Oxford University Press, Oxford1988: 65-106Google Scholar). The gsh1 deletion mutant, JL-3, which was provided by J.-C. Lee (this laboratory) was isogenic to the wild-type strain, CY4 (25Grant C.M. MacIver F.H. Dawes I.W. Curr. Genet. 1996; 29: 511-515Crossref PubMed Scopus (274) Google Scholar, 26Grant C.M. Collinson L.P. Roe J.H. Dawes I.W. Mol. Microbiol. 1996; 21: 171-179Crossref PubMed Scopus (214) Google Scholar). Strains deleted for the various antioxidant genes were made using the cta1::URA3and ctt1::URA3 deletion plasmids donated by A. Hartig (Vienna) and the yap1::HIS3 deletion plasmid donated by W. S. Moye-Rowley (23Wu A. Wemmie J.A. Edgington N.P. Goebl M. Guevara J.L. Moye-Rowley W.S. J. Biol. Chem. 1993; 268: 18850-18858Abstract Full Text PDF PubMed Google Scholar).Table IYeast strains used in this studyStrainsGenotypeSource1783MAT a leu2–3, 112 ura3–52 trp1–1 his4 can1rV. C. CulottaKS105As in strain 1783 butsod1Δ::TRP1V. C. CulottaJS001As in strain 1783 but sod1Δ::LEU2 sod2Δ::URA3V. C. CulottaJS002As in strain 1783 but sod2Δ::URA3V. C. Culotta1783Rho0As in strain 1783 but RhoυThis studyKS105 Rho0As in strain KS105 but RhoυThis studyCY4MAT a ura3–52 leu2–3, 112 trp1–1 ade2–1 his3–11 can1–10025CY7As in strain CY4 butglr1Δ::URA326JL-3As in strain CY4 but gsh1Δ::LEU2J.-C. LeeJY29As in strain CY4 but yap1Δ::HIS3This studyJCA1As in strain CY4 butcta1Δ::URA3This studyJCT1As in strain CY4 but ctt1Δ::URA3This studyV. C. Culotta (Johns Hopkins) unpublished strains. The sod1Δ knock-out plasmid has been described (49Culotta V.C. Joh H.-D. Lin S.-J. Slekar K.H. Strain J. J. Biol. Chem. 1995; 270: 29991-29997Abstract Full Text Full Text PDF PubMed Scopus (142) Google Scholar). Open table in a new tab V. C. Culotta (Johns Hopkins) unpublished strains. The sod1Δ knock-out plasmid has been described (49Culotta V.C. Joh H.-D. Lin S.-J. Slekar K.H. Strain J. J. Biol. Chem. 1995; 270: 29991-29997Abstract Full Text Full Text PDF PubMed Scopus (142) Google Scholar). Strains were grown at 30 °C, with shaking at 180 rpm in 3 ml of medium in a 16 × 100-mm culture tube. For variation of aeration conditions, the methods of Longo et al. (27Longo V.D. Gralla E.B. Valentine J.S. J. Biol. Chem. 1996; 271: 12275-12280Abstract Full Text Full Text PDF PubMed Scopus (462) Google Scholar) were used. For high aeration of cultures, cells were grown at 30 °C, with shaking at 180 rpm, in 40 ml of medium in a 250-ml Erlenmeyer flask; and for low aeration of cultures, cells were incubated at 30 °C, without shaking, in 8 ml of medium in a 16 × 100-mm culture tube. These experiments were repeated with shaking of all cultures using 250-ml flasks and volumes of medium corresponding to those used in the above conditions, to minimize any problems arising from the differences in shaking; both experiments gave similar results. YEPD medium contained 2% glucose, 2% bactopeptone, and 1% yeast extract; and SD medium contained 2% glucose, 0.17% yeast nitrogen base (Difco), 0.5% ammonium sulfate (Oxoid), and auxotrophic requirements at 40 mg/liter where necessary. SD medium for anaerobic culture was supplemented with 0.1% Tween 80 and ergosterol at 30 mg/liter. Media were solidified by adding 2% agar. To avoid mutation of the sod strains they were stored on slopes in an anaerobic jar (Oxoid) which contained a gas-generating kit (Anaerobic system BR38: Oxoid). Molecular techniques were carried out as described (28Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar, 29Sherman F. Fink G.R. Hicks J.B. Methods in Yeast Genetics: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1986Google Scholar). The SOD1gene was isolated by polymerase chain reaction amplification of total yeast DNA with specific oligonucleotides (TCTCTCGCTGAACTTGTCCTTACC and GTGTTCCCTTTCTTGGTGTCTGTC), and from this aSacI/StuI cut fragment containing 722 bp of upstream untranslated region and 872 bp of coding and downstream untranslated region was cloned into the SacI/SmaI cut pRS425 vector (30Christianson T.W. Sikorski R.S. Dante M. Shero J.H. Hieter P. Gene (Amst.). 1992; 110: 119-122Crossref PubMed Scopus (1438) Google Scholar). The plasmid pYEUMn (21Flattery-O'Brien J.A. Grant C.M. Dawes I.W. Mol. Microbiol. 1997; 23: 303-312Crossref PubMed Scopus (56) Google Scholar) containing the intactSOD2 gene in YEp13 was used for overexpression. The intactCTT1 gene donated by H. Ruis was recloned into theBamHI/ClaI site of the pRS426 vector (30Christianson T.W. Sikorski R.S. Dante M. Shero J.H. Hieter P. Gene (Amst.). 1992; 110: 119-122Crossref PubMed Scopus (1438) Google Scholar). TheSOD2::lacZ fusion construct containing 558 bp of upstream untranslated region of SOD2 and 235 bp of coding sequence has been described (21Flattery-O'Brien J.A. Grant C.M. Dawes I.W. Mol. Microbiol. 1997; 23: 303-312Crossref PubMed Scopus (56) Google Scholar). Yeast transformation was performed using the lithium acetate method (31Geitz D. St. Jean A. Woods R.A. Schiestl R.H. Nucleic Acids Res. 1992; 20: 1425Crossref PubMed Scopus (2899) Google Scholar). Integrative plasmids were linearized by cleavage at the StuI site within theURA3 gene prior to transformation. Correct single copy integration was checked by Southern blot analysis (data not shown). Transformants of sod1 mutant strain were maintained anaerobically as described above. Assays for β-galactosidase were carried out usingο-nitrophenyl-β-d-galactose (ONPG) as substrate as described previously (32Rose M. Botstein D. Methods Enzymol. 1983; 101: 167-180Crossref PubMed Scopus (273) Google Scholar). Specific activity is expressed as nanomoles of ONPG hydrolyzed per min−1mg−1 protein. Protein concentrations were measured by the Bio-Rad assay method as indicated by the manufacturer. All determinations were the average of three independent experiments. Cells were harvested by centrifugation and washed in 0.1 m sodium phosphate buffer (pH 7.0) and suspended to an A 600 of 3 in the same buffer. Aliquots (0.3 ml) of cells were transferred into thin-walled 1.5-ml polycarbonate tubes (Greiner Labortechnik) and frozen at −20 °C for times indicated and then thawed at 4 °C for 40 min as described previously (7Park J.-I. Grant C.M. Attfield P.V. Dawes I.W. Appl. Environ. Microbiol. 1997; 63: 3818-3824Crossref PubMed Google Scholar). Survival was determined by diluting cells into YEPD medium at room temperature and plating on YEPD plates. Data were determined in triplicate and the two-sample t test was done where appropriate. Cells were grown at 30 °C for 2 days before colony counting. Anaerobic freezing was performed as above except that the buffer used for freezing was deoxygenated by sparging with argon for 4 h before use. Cells cultured for 1 day were harvested and diluted to an A 600 of 0.1 in fresh YEPD medium. 5 μl of each diluted culture was spotted onto YEPD plates containing either 0.1 or 0.2 mm paraquat and subsequently incubated at 30 °C for the required length of time to visualize phenotypic difference. Cells were grown to anA 600 of 1 in YEPD medium at 30 °C under the low aeration culture condition. MnCl2 was added to the culture to a final concentration of either 2 or 4 mm, and cells were cultured for 30 min before being subjected to the freeze-thaw process. MnCl2 was removed by washing cells twice before freezing. Cells at exponential growth phase (A 600 = 1) were harvested and washed in 0.1m sodium phosphate buffer (pH 7.0). Cell density was determined by measuring optical density and by colony counting. Cells were then suspended to approximately 2×109 cells/ml in 500 μl of the same buffer containing spin trap agents, either 50 mm α-phenyl-N-tert-butylnitrone (PBN) or 100 mm 5,5-dimethyl-1-pyrroline-N-oxide (DMPO). Samples were frozen at −20 °C for 2 h and thawed as described above. Thawed samples were then either transferred to an EPR flat cell or extracted into toluene. Toluene extracts were bubbled with argon in cylindrical cells for 10 min prior to EPR measurement. The increase in amplitude with time of the EPR signal of the radicals was measured and expressed in arbitrary units per about 109cells. All EPR spectra were obtained with a Bruker EMX X-band spectrometer using field modulation 100.00 kHz and either a standard rectangular (ER 4102 ST) or cylindrical (ER 4103 TM) cavity. Typical EPR spectrometer settings were as follows: gain 2 × 106 (DMPO) or 5 × 106 (PBN), modulation amplitude 0.2 mT (DMPO) or 0.1 mT (PBN), conversion time 81 ms, time constant 81 ms (DMPO) or 163 ms (PBN), sweep time 83 s, center field 347.5 mT, field scan 8 mT, power 31 milliwatts (DMPO) or 50 milliwatts (PBN), frequency 9.722 GHz, temperature 294 K, with 8 scans averaged. We have previously shown that H2O2 pretreatment could induce freeze-thaw tolerance of yeast cells (7Park J.-I. Grant C.M. Attfield P.V. Dawes I.W. Appl. Environ. Microbiol. 1997; 63: 3818-3824Crossref PubMed Google Scholar). Since such treatment induces cells to adapt to oxidative stress, this indicated that ROS generated during freezing and thawing may cause lethal damage to the cell. To test this hypothesis, and determine which oxidative stress response systems are involved in protecting cells from freeze-thaw damage, the tolerance of a range of mutants affected in various aspects of the oxidative stress response was examined. The mutants examined included those with null mutations in YAP1, GSH1, GLR1, CTA1, CTT1, SOD1, and SOD2,as well as the sod1 sod2 double mutant. YAP1encodes a transcriptional activator of several genes involved in oxidative stress and detoxification of toxic compounds (13Moradas-Ferreira P. Costa V. Piper P. Mager W. Mol. Microbiol. 1996; 19: 651-658Crossref PubMed Scopus (235) Google Scholar).GSH1 and GLR1 are responsible for producing and regenerating, respectively, the important antioxidant glutathione (22Grant C.M. Dawes I.W. Redox Rep. 1996; 2: 223-229Crossref PubMed Scopus (51) Google Scholar).CTA1 encodes the peroxisomal catalase A and CTT1the yeast cytosolic catalase which scavenge H2O2 (20Ruis H. Koller F. Scandalios J.G. Oxidative Stress and the Molecular Biology of Antioxidant Defenses. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1997: 309-343Google Scholar), whereas the SOD1 and SOD2 gene products are the superoxide dismutases that scavenge O⨪2 (18Fridovich I. J. Biol. Chem. 1997; 272: 18515-18517Abstract Full Text Full Text PDF PubMed Scopus (1071) Google Scholar, 19Gralla E.B. Scandalios J.G. Oxidative Stress and the Molecular Biology of Antioxidant Defenses. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1997: 495-525Google Scholar). The freeze-thaw tolerance of each mutant was compared with its isogenic wild type after growth to the post-diauxic shift phase (48 h in YEPD) since wild-type cells have been shown to be more resistant in this phase (7Park J.-I. Grant C.M. Attfield P.V. Dawes I.W. Appl. Environ. Microbiol. 1997; 63: 3818-3824Crossref PubMed Google Scholar). The mutants affected in the SOD genes showed a much greater sensitivity to freeze-thaw stress than their isogenic wild-type strain 1783, whereas the freeze-thaw sensitivity of the other oxidative stress mutants was much less affected relative to their wild-type strain CY4 (Fig. 1). This sensitivity was very apparent in the sod1 and sod1 sod2 double-mutant strains although the sod2, gsh1, and glr1mutants were slightly more sensitive than their isogenic wild-type strains. Since the SOD1 gene product is located in the cytoplasm, this indicates that freeze-thaw damage to cells involves superoxide radicals rather than H2O2 or compounds for which glutathione-based defense systems are important and that prevention of the damage to cells is more dependent on the cytoplasmic Cu,Zn-SOD than the mitochondrial Mn-SOD. As an initial step to try and confirm that the superoxide radicals were involved, we tested the effect on the freeze-thaw-sensitivesod1 mutant of pretreatment with MnCl2, which is known to act as a O⨪2 scavenger (33Chang E.C. Crawford B.F. Hong Z. Bilinski J. Kosman D.J. J. Biol. Chem. 1989; 266: 4417-4424Abstract Full Text PDF Google Scholar, 34Archibald F.S. Fridovich I. Arch. Biochem. Biophys. 1982; 214: 452-463Crossref PubMed Scopus (355) Google Scholar). From Fig. 2 it can be seen that pretreatment with 4 mm MnCl2 for 30 min led to a 3-fold increase in the survival of the sod1 strain. The same treatment also increased the freezing tolerance of the wild-type strain as might be expected if free radicals were generated during freezing and thawing. MgCl2 used at the same concentration as a divalent metal ion control did not induce any freezing tolerance (data not shown). We next examined the effects of overexpressing SOD1 and SOD2 in the sod1 mutant. Although the effect of SOD1 gene in multiple copies was not significantly different (Fig. 3 A; compare pRS425SOD1 with pRS425), interestingly overexpression of SOD2 (YEp13SOD2 with YEp13) led to a significant increase in survival approaching that of the wild-type strain. This indicates that higher levels of SOD in the mitochondrial compartment can compensate for the lack of the cytoplasmic enzyme; this is discussed later. The failure of the multi-copy SOD1 vector to improve the tolerance of the sod1 mutant may have been due to H2O2 produced due to the augmented activity of the cytoplasmic superoxide dismutase since in Escherichia coli and Drosophila melanogasteroverproduction of superoxide dismutase increased sensitivity to oxidative stress caused by paraquat (35Scott M.D. Meshnick S.R. Eaton J.W. J. Biol. Chem. 1987; 262: 3640-3645Abstract Full Text PDF PubMed Google Scholar, 36Stavelery B.E. Phillips J.P. Hilliker A.J. Genome. 1990; 33: 867-872Crossref PubMed Scopus (54) Google Scholar). We attempted to resolve this point by using sod1 strains transformed with multiple copy vectors carrying SOD1 and CTT1, but the interpretation of these results was hampered by the differences in growth rates of the various single and double transformants and the inability to obtain strains carrying both vectors alone as a control. On transforming the sod1 mutant containing theSOD1 multi-copy vector with another vector carryingCTT1, to remove excess H2O2, a 2-fold increase in survival was seen compared with that of thesod1 mutant transformed with the SOD1 multi-copy vector and the control plasmid pRS426. The overexpression of CTT1 alone in the sod1 mutant did not affect its freeze-thaw tolerance (data not shown). To confirm that theSOD1 and SOD2 genes were overexpressed sufficiently in the various constructs to affect cellular superoxide levels, they were tested for their sensitivity to paraquat on YEPD plates. From Fig. 3 B it can be seen that the SOD1and SOD2 constructs were resistant to paraquat and that overexpression of both SOD1 and CTT1 conferred the greatest resistance. Overexpression of both of the SOD enzymes was also demonstrated by separating them from cell extracts using polyacrylamide gel electrophoresis and activity staining using nitro blue tetrazolium (data not shown).Figure 3Overexpression of SOD1, SOD2, or CTT1 in the sod1mutant. A, transformants were grown on SD medium for 2 days, and freeze-thaw tolerance was determined by measuring viability after exposure to −20 °C. Percentage survival is expressed relative to the culture viability immediately prior to freezing (%). Data shown are means of triplicate experiments.Error bars represent the standard error of the means (p value obtained for the double transformants was 0.022). Experiments were repeated at least twice. B, the resistance to paraquat of a 1-day culture of each transformant was determined by spotting 5 μl of each diluted fraction (A 600 = 0.1) onto YEPD plates containing 0.2 mm paraquat. Experiments were repeated at least three times with similar results. A YEPD control plate showed similar growth of all strains in the absence of paraquat.View Large Image Figure ViewerDownload Hi-res image Download (PPT) The results with the sod1 mutant indicated that the cytoplasmic Cu,Zn-SOD is more important for freeze-thaw resistance than other oxidative defense systems, and this raised the question of whether the freeze-thaw sensitivity of the sod mutants was due to accumulated oxidative damage during prior culture, or to O⨪2 generation during freezing or thawing. To investigate whether freeze-thaw stress sensitivity of the sod mutants was due to the accumulated oxidative damage affecting cellular integrity, or to generation of O⨪2 during the freeze-thaw process, the sod mutants and the wild-type strain were grown under high or low aeration culture conditions, and changes in freeze-thaw tolerance of the cells were followed. If the freeze-thaw sensitivity of the sod mutants was due to the accumulated damage, then high aeration culture would decrease freezing tolerance by increased generation of ROS, and low aeration would do the opposite. Under low aeration conditions" @default.
• W2101813653 created "2016-06-24" @default.
• W2101813653 creator A5022270351 @default.
• W2101813653 creator A5044496722 @default.
• W2101813653 creator A5069317976 @default.
• W2101813653 creator A5070645740 @default.
• W2101813653 date "1998-09-01" @default.
• W2101813653 modified "2023-09-27" @default.
• W2101813653 title "The Cytoplasmic Cu,Zn Superoxide Dismutase of Saccharomyces cerevisiae Is Required for Resistance to Freeze-Thaw Stress" @default.
• W2101813653 cites W1555451001 @default.
• W2101813653 cites W1559531158 @default.
• W2101813653 cites W1574441056 @default.
• W2101813653 cites W1576158258 @default.
• W2101813653 cites W1578589309 @default.
• W2101813653 cites W1580002784 @default.
• W2101813653 cites W1904857264 @default.
• W2101813653 cites W1911339081 @default.
• W2101813653 cites W1952402412 @default.
• W2101813653 cites W1969789360 @default.
• W2101813653 cites W1975796113 @default.
• W2101813653 cites W1989105653 @default.
• W2101813653 cites W2002769318 @default.
• W2101813653 cites W2018199071 @default.
• W2101813653 cites W2019079004 @default.
• W2101813653 cites W2019421902 @default.
• W2101813653 cites W2023677185 @default.
• W2101813653 cites W2024921655 @default.
• W2101813653 cites W2043281920 @default.
• W2101813653 cites W2046711532 @default.
• W2101813653 cites W2056168344 @default.
• W2101813653 cites W2061822590 @default.
• W2101813653 cites W2073366641 @default.
• W2101813653 cites W2084054222 @default.
• W2101813653 cites W2086660631 @default.
• W2101813653 cites W2091512138 @default.
• W2101813653 cites W2095623345 @default.
• W2101813653 cites W2114443210 @default.
• W2101813653 cites W2118101975 @default.
• W2101813653 cites W2120629404 @default.
• W2101813653 cites W2127645166 @default.
• W2101813653 cites W2137771214 @default.
• W2101813653 cites W2144080251 @default.
• W2101813653 cites W2151856036 @default.
• W2101813653 cites W2224465247 @default.
• W2101813653 cites W2470982135 @default.
• W2101813653 cites W297756241 @default.
• W2101813653 cites W4237666549 @default.
• W2101813653 cites W4385616449 @default.
• W2101813653 doi "https://doi.org/10.1074/jbc.273.36.22921" @default.
• W2101813653 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/9722512" @default.
• W2101813653 hasPublicationYear "1998" @default.
• W2101813653 type Work @default.
• W2101813653 sameAs 2101813653 @default.
• W2101813653 citedByCount "128" @default.
• W2101813653 countsByYear W21018136532012 @default.
• W2101813653 countsByYear W21018136532013 @default.
• W2101813653 countsByYear W21018136532014 @default.
• W2101813653 countsByYear W21018136532015 @default.
• W2101813653 countsByYear W21018136532016 @default.
• W2101813653 countsByYear W21018136532017 @default.
• W2101813653 countsByYear W21018136532018 @default.
• W2101813653 countsByYear W21018136532019 @default.
• W2101813653 countsByYear W21018136532020 @default.
• W2101813653 countsByYear W21018136532021 @default.
• W2101813653 countsByYear W21018136532022 @default.
• W2101813653 crossrefType "journal-article" @default.
• W2101813653 hasAuthorship W2101813653A5022270351 @default.
• W2101813653 hasAuthorship W2101813653A5044496722 @default.
• W2101813653 hasAuthorship W2101813653A5069317976 @default.
• W2101813653 hasAuthorship W2101813653A5070645740 @default.
• W2101813653 hasBestOaLocation W21018136531 @default.
• W2101813653 hasConcept C185592680 @default.
• W2101813653 hasConcept C190062978 @default.
• W2101813653 hasConcept C2775838275 @default.
• W2101813653 hasConcept C2776151105 @default.
• W2101813653 hasConcept C2777576037 @default.
• W2101813653 hasConcept C2779222958 @default.
• W2101813653 hasConcept C55493867 @default.
• W2101813653 hasConceptScore W2101813653C185592680 @default.
• W2101813653 hasConceptScore W2101813653C190062978 @default.
• W2101813653 hasConceptScore W2101813653C2775838275 @default.
• W2101813653 hasConceptScore W2101813653C2776151105 @default.
• W2101813653 hasConceptScore W2101813653C2777576037 @default.
• W2101813653 hasConceptScore W2101813653C2779222958 @default.
• W2101813653 hasConceptScore W2101813653C55493867 @default.
• W2101813653 hasIssue "36" @default.
• W2101813653 hasLocation W21018136531 @default.
• W2101813653 hasOpenAccess W2101813653 @default.
• W2101813653 hasPrimaryLocation W21018136531 @default.
• W2101813653 hasRelatedWork W1688555757 @default.
• W2101813653 hasRelatedWork W1967178850 @default.
• W2101813653 hasRelatedWork W2009810460 @default.
• W2101813653 hasRelatedWork W2026244176 @default.
• W2101813653 hasRelatedWork W2054450104 @default.
• W2101813653 hasRelatedWork W2062385823 @default.
• W2101813653 hasRelatedWork W2087346710 @default.
• W2101813653 hasRelatedWork W2163943333 @default.
• W2101813653 hasRelatedWork W2405691907 @default.

• next