FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2102732162> ?p ?o ?g. }

• W2102732162 endingPage "7693" @default.
• W2102732162 startingPage "7685" @default.
• W2102732162 abstract "Mammalian spermatogenesis is a highly ordered process that occurs in mitotic, meiotic, and postmeiotic phases. The unique mechanisms responsible for this tightly regulated developmental process suggest the presence of an intrinsic genetic program composed of spermatogenic cell-specific genes. In this study, we analyzed the mouse round spermatid UniGene library currently containing 2124 gene-oriented transcript clusters, predicting that 467 of them are testis-specific genes, and systematically identified 28 novel genes with evident testis-specific expression by in silico and in vitro approaches. We analyzed these genes by Northern blot hybridization and cDNA cloning, demonstrating the presence of additional transcript sequences in five genes and multiple transcript isoforms in six genes. Genomic analysis revealed lack of human orthologues for 10 genes, implying a relationship between these genes and male reproduction unique to mouse. We found that all of the novel genes are expressed in developmentally regulated and stage-specific patterns, suggesting that they are primary regulators of male germ cell development. Using computational bioinformatics tools, we found that 20 gene products are potentially involved in various processes during spermatogenesis or fertilization. Taken together, we predict that over 20% of the genes from the round spermatid library are testis-specific, have discovered the 28 authentic, novel genes with probable spermatogenic cell-specific expression by the integrative approach, and provide new and thorough information about the novel genes by various in vitro and in silico analyses. Thus, the study establishes on a comprehensive scale a new basis for studies to uncover molecular mechanisms underlying the reproductive process. Mammalian spermatogenesis is a highly ordered process that occurs in mitotic, meiotic, and postmeiotic phases. The unique mechanisms responsible for this tightly regulated developmental process suggest the presence of an intrinsic genetic program composed of spermatogenic cell-specific genes. In this study, we analyzed the mouse round spermatid UniGene library currently containing 2124 gene-oriented transcript clusters, predicting that 467 of them are testis-specific genes, and systematically identified 28 novel genes with evident testis-specific expression by in silico and in vitro approaches. We analyzed these genes by Northern blot hybridization and cDNA cloning, demonstrating the presence of additional transcript sequences in five genes and multiple transcript isoforms in six genes. Genomic analysis revealed lack of human orthologues for 10 genes, implying a relationship between these genes and male reproduction unique to mouse. We found that all of the novel genes are expressed in developmentally regulated and stage-specific patterns, suggesting that they are primary regulators of male germ cell development. Using computational bioinformatics tools, we found that 20 gene products are potentially involved in various processes during spermatogenesis or fertilization. Taken together, we predict that over 20% of the genes from the round spermatid library are testis-specific, have discovered the 28 authentic, novel genes with probable spermatogenic cell-specific expression by the integrative approach, and provide new and thorough information about the novel genes by various in vitro and in silico analyses. Thus, the study establishes on a comprehensive scale a new basis for studies to uncover molecular mechanisms underlying the reproductive process. In sexual reproduction, diploid cells divide to form haploid cells, and the haploid cells from two individuals fertilize to form new diploid cells. This process, producing unpredictably dissimilar offspring, requires intricate and elaborate molecular and cellular events such as genetic recombination and the formation of gametes specialized for fertilization. Male germ cell development or spermatogenesis is a tightly regulated developmental process that occurs in successive mitotic, meiotic, and postmeiotic phases (1Eddy E.M. Reprod. Fertil. Dev. 1995; 7: 695-704Crossref PubMed Scopus (38) Google Scholar, 2Eddy E.M. Semin. Cell Dev. Biol. 1998; 9: 451-457Crossref PubMed Scopus (161) Google Scholar, 3Eddy E.M. Recent Prog. Horm. Res. 2002; 57: 103-128Crossref PubMed Scopus (346) Google Scholar). The process occurs in the epithelial lining of seminiferous tubules, in testis. Spermatogonial stem cells, located around the outer region next to the basal lamina surrounding the seminiferous tubule, undergo mitosis, and some of them differentiate into later stage spermatogonia that gradually become primary spermatocytes. These cells continue through the first meiotic division to become secondary spermatocytes. Subsequently, the second meiotic division occurs in rapid succession to produce spermatids. These haploid spermatids are then remodeled into spermatozoa by spermiogenesis. The major events in spermiogenesis are chromatin condensation and morphological changes. This tightly regulated process accompanying meiotic progression and the drastic changes in cell morphology suggests the presence of a highly organized network of genes expressed during spermatogenesis. The regulation of gene expression during spermatogenesis occurs at three levels: intrinsic, interactive, and extrinsic (3Eddy E.M. Recent Prog. Horm. Res. 2002; 57: 103-128Crossref PubMed Scopus (346) Google Scholar). The intrinsic program determines which genes are utilized and when the genes are expressed. The interactive process between germ cells and somatic cells is necessary for germ cell proliferation and progression. The extrinsic influences such as steroid and peptide hormones regulate the interactive process. Among these three levels of gene regulation, the intrinsic genetic program involves germ cell- and stage-specific gene expression. Recent high throughput genomics projects have focused on the identification of cell- and tissue-specific transcriptomes that are expected to uncover fundamental insights into biological processes. Data bases for expressed sequence tags (ESTs) 1The abbreviations used are: EST, expressed sequence tag; RACE, rapid amplification of cDNA ends; RT, reverse transcription. provide important information for discovery of novel genes with tissue-specific expression profiles. One such data base is UniGene, which provides information on gene-oriented clusters and tissue types of gene expression. The ESTs in UniGene are organized into clusters, and each cluster is composed of sequences overlapping with at least one other member of the same cluster but not with members of any other cluster. Thus, each cluster is likely to contain sequences corresponding to a single gene. In silico biology is becoming a rapidly expanding, powerful tool in modern biotechnology. The UniGene data base combined with other computational bioinformatics data bases provides a great deal of information for predicting the tissue specificity of gene expression, genomic nature, and the structure and function of novel gene products. Comprehensive understanding of spermatogenesis requires identification and functional characterization of unique genes, since this developmental process is regulated by a precisely programmed cell- and stage-specific gene expression. In this study, utilizing one of the mouse spermatogenic cell UniGene libraries, we discovered a number of novel testicular genes. Our various expression analyses suggest that these genes are specifically expressed and developmentally regulated in mouse spermatogenic cells. Further, we predict that proteins encoded by these genes have significant functions in various processes during spermatogenesis or fertilization. The study is unique in the aspects of systematic identification and in depth characterization of a number of novel genes implicated in the intrinsic genetic program, which determines the sequence of events composing male germ cell development. RT-PCR—Total RNA was isolated from tissues or cells using a Micro-to-Midi Total RNA Purification System (Invitrogen), and subsequently, cDNA was synthesized by random hexamer and oligo(dT) priming using Omniscript reverse transcriptase (Qiagen). To determine the tissue distribution of novel gene expression, PCR experiments were performed using cDNAs from multiple tissues (skeletal muscle, brain, lung, heart, liver, kidney, testis, and spleen) of male mice. To test whether transcripts are expressed at particular stages of spermatogenesis, prepubertal and adult male mice (age range 8–90 days) were sacrificed, and total RNA isolated from their testes was used for reverse transcription. To investigate whether the novel genes are expressed in somatic cells of testis, RT-PCR was performed using total RNA isolated from a Sertoli cell line (4Vidal F. Lopez P. Lopez-Fernandez L.A Ranc F. Scimeca J.C. Cuzin F. Rassoulzadegan M. J. Cell Sci. 2001; 114: 435-443PubMed Google Scholar) or the germ cell-lacking testes of W/Wv mutant mice (5Geissler E.N. Ryan M.A. Housman D.E. Cell. 1988; 55: 185-192Abstract Full Text PDF PubMed Scopus (1037) Google Scholar). Gene-specific primers are listed in Table I. PCR was performed for 30 cycles of 94 μg for 30 s, 55 μg for 30 s, and 72 μg for 1 min. The primers for glyceraldehyde-3-phosphate dehydrogenase as a control were forward primer, 5′-TGA AGG TCG GAG TCA ACG GAT TTG GT-3′ and reverse primer, 5′-CAT GTG GGC CAT GAG GTC CAC CAC-3′.Table IList of novel genes and gene-specific primers designed for RT-PCR analysisUniGene IDGene descriptionPCR primersPCR (bp)Forward (5′-3′)Reverse (5′-3′)Mm.322314922501K12Ri, hypothetical proteinGGCTGAAGCTTCATTTGCAGGAGATCGGAGGTGAGCTGCC369Mm.348411700015M15Rik, hypothetical proteinGCTGGATGGGACATCATTTCCTGGTGCCAATTCTCAGTGC370Mm.456111700027D21Rik, hypothetical proteinCAACAGGTGCCCGTTGGCTGCTCTGACGGCACGGCTGGAG434Mm.461144922502D21Rik, hypothetical proteinCCTCCATGGATTCTTCAAGGGAGCTGCAGGACAGGGTGAG325Mm.461171700016K02Rik, hypothetical proteinGTAGCTTTATCTAGGGCCCCCGTCCTGTTTGCTCTCAGAC317Mm.52511aMm52511 was named ATPase, Class I, type 8B, member 3 (Atp8b3) during manuscript preparation.1700122B10Rik (Atp8b3)CCTCTTGTCTTTGGATGCTGGGCTTCACAGTACACTCTGG351Mm.1488584930449C09Rik, unknown ESTCCCTACATCCCACCGCAGAGGGAGGTCTCTCTTGAGACAG404Mm.1581744933433O19Rik, unknown ESTGACGCGGAATTCCCTGGGACGTGAAGAGATGCTATACCCC347Mm.2728461700030J22Rik, hypothetical proteinGAACACTCCCTAGACACTTCCAGCCATGGACAGCTTCCTC320Mm.2733131700011I03Rik, hypothetical proteinCCCAGATATTGAGACCTCAGGTTAAGTTTCTCCTGGGAGG364Mm.297290LOC226356, hypothetical proteinCACACCGCTCTCGGCAAAGCGTGGGGCAGGGACATCTATG392Mm.3070841700019A02Rik, hypothetical proteinCGACATGTTTGAGGAGGAAGGTTCCAGGCGCCTTCTCTTC263Mm.338094Transcribed sequenceGGGTAGAGGGAACTGATGTGGATCTGTCTGTCCATTGAGC377Mm.353417Transcribed sequenceCCAGGATCCAGAAGACTTATCTTTCATGAGTACTGGGACC365Mm.338644930578I06Rik, hypothetical proteinGGGCGACAGCACCTGCGGAGGTTGACCTCCTGATCCTGGC351Mm.46105mRNA similar to 1700010D01RikCTGTTACAGGATGTTGAGCCCTCCTTTAGGTGGCATGCTG360Mm.487911700092M07Rik, unknown ESTCTGCTGTCAGGACAAGAACCGAGGACTAAGACCAGGGTTG279Mm.672341700090G07Rik, hypothetical proteinCCCTGTTGACAGCATGCCTGGCCGCTCGTTCTCCTGGTGC308Mm.729384932416O05Rik, unknown ESTCCCAGGCTTGGTACCTTAGGGTCAGTCTGTCCACCCTTTG312Mm.849744921511C16Rik, hypothetical proteinCTCTCTGGTGTGGAATACAGGACAAATGACCTGCTGCTTC361Mm.873281700093K21Rik, hypothetical proteinGGCTTGCCGATGAAGCCTAGCGACCCAGTACCCTCAGTCG384Mm.1488484921511C04Rik, hypothetical proteinGAAGGAGAGTGGCTACCCACGCCAATTCAGCCGCTCCAGG340Mm.1570494933424G06Rik, unclassifiableGGGCTTCAGGATACCAGCTCCCATGGCAGCAGTCCTCCTG409Mm.1581344933433G08Rik, unknown ESTCGACAGACAGAAGAACACAGGGGCCTTTCACCATTCAGAC380Mm.1581594933416O17Rik, unclassifiableCTCTATGCCCTCTCAGACTGGTTCAGCTCTGTCCAAGATG304Mm.2627142900090M10Rik, hypothetical proteinGTCTCCTCCTTATACACTCCGGAGAGGATCCGGAGCAGAG385Mm.152658Transcribed sequenceCCAATGTCCTTGGATGGAAGGGTCCATGATATCTTGCTCC319Mm.266854Transcribed sequenceCGGCAGACTCGCGATTCTTGCAAGAAAGGTCATGTCAGCG249a Mm52511 was named ATPase, Class I, type 8B, member 3 (Atp8b3) during manuscript preparation. Open table in a new tab Northern Blot Analysis—Total RNA was isolated from each tissue using a TRI Reagent (Molecular Research Center, Inc.), heated at 65 °C for 5 min, and separated on a 1.2% agarose gel containing 1.8% formaldehyde. The gels were washed extensively in water to remove formaldehyde and transferred to a Hybond-XL membrane (Amersham Biosciences). Each Northern blot included two 10-μg RNA samples extracted from the testis and liver of male mice. The blots were prehybridized for 30 min at 68 °C in Rapid-hyb buffer (Amersham Biosciences), followed by hybridization for 2 h at 68 °C in the presence of cDNA probe. Probes were derived from PCR products amplified with gene-specific primers (Table I) and labeled with [α-32P]dCTP (PerkinElmer Life Sciences) using the Prime-It random priming kit (Stratagene). The blots were washed four times in 2× SSC, 0.05% SDS at room temperature for 10 min and twice in 0.1× SSC, 0.1% SDS at 68 °C for 10 min. The blots were exposed to Hyperfilm (Amersham Biosciences) with intensifying screens at –70 °C. Rapid Amplification of cDNA Ends (RACE)—To determine the transcription initiation or termination site of novel genes, 5′- or 3′-RACE was performed with the SMART™ RACE cDNA Amplification Kit (Clontech) as described by the supplier. Briefly, first strand cDNA synthesis was performed using 1 μg of testis poly(A)+ RNA, the 5′/3′ cDNA synthesis primer, SMART II™ oligonucleotide, and PowerScript™ reverse transcriptase. This cDNA was then used in a PCR using universal primer mix and gene-specific primers with the following parameters: 5 s at 94 °C, 10 s at 68 °C, 3 min at 72 °C for 30 cycles. The resulting PCR products were resolved on a low melting agarose gel, and the appropriate band was excised and purified for subsequent steps of cloning or sequence determination. RACE products were cloned into pCR2.1 vector (Invitrogen) and sequenced. In Silico Analysis—The cDNA sequences of the novel genes were subjected to BLAST search in the NCBI Mouse Genome Resources (available on the World Wide Web at www.ncbi.nlm.nih.gov/genome/seq/MmBlast.html) and in the Wellcome Trust Sanger Institute Mouse Genome Server (available on the World Wide Web at www.ensembl.org/Mus_musculus/) to investigate exon-intron structures, chromosomal locations, and human synteny locations. Amino acid sequences deduced from the cDNA sequences of the novel genes were analyzed using several computational bioinformatics tools. PROSITE (available on the World Wide Web at us.expasy.org/prosite/), PFAM (available on the World Wide Web at www.sanger.ac.uk/Software/Pfam/search.shtml), and SMART (available on the World Wide Web at smart.embl-heidelberg.de/) were used to predict the presence of various protein patterns and profiles. SignalP and TMHMM were used to analyze and predict the presence of putative signal peptides with their cleavage sites and the transmembrane helices, respectively (available on the World Wide Web at www.cbs.dtu.dk/services/). PSORT II (available on the World Wide Web at psort.nibb.ac.jp/form2.html) was used to predict protein sorting signals and intracellular localization. GOblet (available on the World Wide Web at goblet.molgen.mpg.de/) and AmiGO (available on the World Wide Web at www.godatabase.org/cgi-bin/go.cgi) were used for gene ontology with three main classes: molecular function, biological process, and cellular component (6Groth D. Lehrach H. Hennig S. Nucleic Acids Res. 2004; 32: W313-W317Crossref PubMed Scopus (75) Google Scholar). The Round Spermatid UniGene Library and In Silico Selection of Novel Gene Candidates—To discover and investigate unique testicular genes expressed in postmeiotic germ cells, we analyzed the McCarrey Eddy round spermatid library (Library 6786), one of the largest mouse spermatogenic cell libraries deposited in the UniGene data base at the NCBI (available on the World Wide Web at www.ncbi.nlm.nih.gov). As of September, 2004 (Mus musculis UniGene Build 141), the round spermatid library consists of 2124 UniGene entries. We classified genes in the library based on the following criteria. (i) Genes previously named or assigned with potential functions were counted as known genes, and unnamed genes with unknown or unassigned function were considered to indicate unknown or novel genes. (ii) If there is only a testicular EST(s) of a given gene or the number of testicular ESTs of a gene is much higher than that of nontesticular ESTs, the gene was classified as a testis-specific gene. This classification of the 2124 gene entries revealed that about half of the entries are known genes, and 121 of the known genes are testis-specific (Table II and Supplementary Table I). We further categorized the relatively well known genes with testis-specific expression (91 named genes assigned with gene ontology), based on gene ontology codes that provide information about cellular compartment, molecular function, and biological process (Fig. 1). The overall gene ontology feature of these genes was similar to that of genome-wide genes in mouse (7Consortium Mouse Genome Sequencing Nature. 2002; 420: 520-562Crossref PubMed Scopus (5420) Google Scholar), except for the prominent expansion of the testis-specific genes in the categories of development and cell organization/biogenesis. This reflects the implication of these genes in unique biological processes of spermatogenesis. On the other hand, the number of the testis-specific genes from the other half (unknown genes) of the entries in the round spermatid library was much larger (346 genes) than that of the known testis-specific genes (Table II and Supplementary Table II), indicating that the testis-specific genes in the library have been largely unexplored. Taken together, the combination of known and unknown testis-specific genes comprises over 20% of the current round spermatid library UniGene entries.Table IIClassification of genes in the round spermatid libraryGenesNumberTotal entries (as of September 2004)2124Known (named or assigned)1152Testis-specific121Named91Assigned30Unknown972Testis-specific346Total entries (as of November 2002)933Unknown, testis-specific157Analyzed in vitro73Authentic, testis-specific28 Open table in a new tab At the beginning of our study (November 2002), the total number of gene entries composing the earlier version of the round spermatid library was 933. A search of this library for testis-specific genes with unknown or unassigned function resulted in the selection of 157 such genes. We arbitrarily selected about half of them (73 genes; Supplementary Table III), and these candidates were analyzed in the present study (Table II). Authenticity of Novel Genes with Testis-specific Expression— To determine whether the candidates selected from the UniGene library are genuine novel genes with testis-specific expression, we performed various expression analyses. An RT-PCR assay showed that 42 of the 73 candidates are abundantly transcribed with expected sizes in mouse testis. By contrast, for the other 31 candidates, no (10 candidates), very low level (14 candidates), or incorrectly sized (7 candidates) PCR products were detected from the testis. Thus, these candidates were eliminated from further analysis. It should be noted that PCR was designed to be similar among the candidates in primer property and product size, and the reaction condition was the same for all of the candidates. Two of the 42 testicular genes were retired from the UniGene data base during the course of our study. Tissue distribution of the remaining 40 genes was investigated by PCR using mouse cDNAs from different tissues. Twenty-eight of the 40 genes were found to be testis-specific. Collectively, the analyses of the 73 potential genes resulted in the identification of the 28 authentic genes with evident expression specific to testis (Tables I and II, and Supplementary Data). Fig. 2 shows results from these analyses of the novel genes. All of the transcripts of the 28 genes were PCR-amplified with correct sizes (Fig. 2A and Table I) and specifically expressed in the testis (Fig. 2B). Further expression analysis of these genes revealed that none of the genes is transcribed in a Sertoli cell line, 15P-1 (4Vidal F. Lopez P. Lopez-Fernandez L.A Ranc F. Scimeca J.C. Cuzin F. Rassoulzadegan M. J. Cell Sci. 2001; 114: 435-443PubMed Google Scholar), and the germ cell-lacking testes of the W (c-kit) mutant mice (5Geissler E.N. Ryan M.A. Housman D.E. Cell. 1988; 55: 185-192Abstract Full Text PDF PubMed Scopus (1037) Google Scholar) (Fig. 2A). Thus, the result suggests germ cell-specific expression of the novel genes in the testis. Transcript Analysis and Genomic Characterization—To determine the expression levels and transcript sizes of the 28 genes, we performed Northern blot analysis (Fig. 3). All of the blots showed significant amounts of signals in the RNA samples from the testis, but not from the liver used as a negative control, suggesting abundant expression of the novel genes in the testis. The sizes of the testicular transcripts ranged from 0.5 (Mm.48791) to 5 kb (Mm.262714). For 23 genes, transcript sizes determined by the Northern blot analysis were comparable with those estimated from the UniGene data base. Significant differences in transcript size (>0.5 kb) between the Northern blots and the data base sequences were found in the other five genes (Mm.353417, Mm.72938, Mm.158134, Mm.262714, and Mm. 266854), suggesting the presence of additional transcript sequences in these genes (Fig. 3). To obtain the full-length transcript sequences of these genes, we performed RACE. This resulted in extension of Mm.353417 from 0.422 to 2.150 kb (GenBank™ accession number AY702103) and Mm.266854 from 0.332 to 1.201 kb (GenBank™ accession number AY702102). Thus, the transcript sequences for the 25 genes can be regarded with confidence as full-length cDNAs or sequences containing the majority of entire cDNA sequences (Figs. 3 and 4). From the Northern blot analysis, we also found that six genes (Mm.34841, Mm.148858, Mm.272846, Mm.338094, Mm.353417, and Mm.48791) produce transcripts with more than a single size (Fig. 3). This suggests the presence of multiple transcript isoforms in these genes by alternative splicing.Fig. 4Genomic and transcript characteristics of the novel genes. Gene structure and exon organization were determined by genome data base searches. In the gene structure, vertical bars and intervening horizontal lines represent the position of exons and introns, respectively. The orientation of each gene is indicated by an arrow. In the exon organization, diagonal lines depict additional unknown sequences. Coding regions were determined by selecting the longest open reading frames deduced from the cDNA sequences, and the predicted coding regions are shaded. The position of the poly(A) signal is marked by filled arrowheads, and the presence of poly(A) is indicated by A. Transcript sizes are summarized from the results shown in Fig. 3. The numbers of amino acids (No. aa) corresponding to the predicted coding regions are listed, and those of the genes, whose known transcript sequences are significantly smaller in size than the bands observed in the Northern blots (Fig. 3), are shown in parentheses. Chromosomal locations were determined by searches of the mouse and human genome data bases.View Large Image Figure ViewerDownload (PPT) To characterize the genomic nature of the novel genes, we performed genome data base searches with the transcript sequences. Fig. 4 shows genomic structures, exon organization, and chromosomal locations of the genes. The identity of the last exon was confirmed by 3′-RACE for most of the genes (data not shown). The sizes of the genes vary from 1 to 100 kb. The numbers of exons in the genes are also variable, ranging from single-exon genes to a 20-exon gene. For the three genes of which transcript sequences are not full-length (Mm.72938, Mm.158134, and Mm.262714), gene size and exon number could be larger than the present estimation. The novel genes were found to be widely distributed on mouse chromosomes (Fig. 4). To extend the findings on these mouse genes, we searched the human genome data base for human orthologues. All of the human orthologues for 18 mouse genes were found to be present in the genomic regions of conserved synteny between mice and humans. However, we found that the other 10 mouse genes do not have human orthologues, suggesting the differential expansion of these genes in the mouse genome (see “Discussion”). Developmental Stage-dependent Expression of Novel Genes— To investigate the developmental expression pattern of the novel testis-specific genes during spermatogenesis, we performed RT-PCR using mouse testis obtained at different days after birth. In the first round of spermatogenesis in prepubertal mouse, stem cells proliferate and differentiate gradually to yield the sequence of spermatogonia, spermatocytes, and spermatids (Fig. 5A) (8Bellve A.R. Cavicchia J.C. Millette C.F. O'Brien D.A. Bhatnagar Y.M. Dym M. J. Cell Biol. 1977; 74: 68-85Crossref PubMed Scopus (1127) Google Scholar). Meiosis begins in the mouse at about day 11. By day 15, pachytene spermatocytes account for about one-third of the total cell population in the seminiferous epithelium. Once the first round of meiosis is accomplished by day 21, round spermatids appear in the seminiferous tubules. If a particular gene is expressed in germ cells during spermatogenesis, a transcript for that gene will appear in the testis at a certain post-partum time point corresponding to a specific stage of spermatogenesis. The RT-PCR result showed that all of the novel genes are expressed at least after day 12, indicating that expression of these germ cell-specific genes is developmentally regulated during the meiotic and postmeiotic phases (Fig. 5, B and C). They could be divided into two groups based on the expression patterns. The first group includes 14 genes, of which expression starts during meiotic prophase, days 14–20 corresponding to pachytene spermatocytes (Fig. 5B). The 14 genes of the second group are expressed in germ cells (spermatids) after meiosis (Fig. 5C). A gene encoding ADAM2 (adisintegrin and metalloprotease 2) and the protamine-2 gene, known as germ cell-specific and developmentally regulated genes crucial for spermatogenesis or fertilization, were used for comparison of expression pattern with the novel genes (9Wolfsberg T.G. Primakoff P. Myles D.G. White J.M. J. Cell Biol. 1995; 131: 275-278Crossref PubMed Scopus (441) Google Scholar, 10Cho C. Bunch D.O. Faure J.E. Goulding E.H. Eddy E.M. Primakoff P. Myles D.G. Science. 1998; 281: 1857-1859Crossref PubMed Scopus (445) Google Scholar, 11Cho C. Willis W.D. Goulding E.H. Jung-Ha H. Choi Y.C. Hecht N.B. Eddy E.M. Nat. Genet. 2001; 28: 82-86Crossref PubMed Google Scholar). It is noteworthy that considerable numbers of the genes selected from the round spermatid library are expressed in pachytene spermatocytes. In Silico Analysis of Protein Characteristics—To gain an insight into the structures and functions of proteins expressed from the novel genes, a protein-coding region in each gene was determined by selecting the longest amino acid sequence terminated before (if there is one present) a polyadenylation signal (Fig. 4), and the deduced amino acid sequences were subjected to protein data base searches. The prediction of the coding regions for most of the genes is considered to be accurate, except for the three genes whose known transcript sequences are significantly smaller in size than the bands observed in the Northern blots (Figs. 3 and 4). Supplementary Table IV shows hydrophobicity, specific domain/motif/region, and gene ontology of the predicted proteins encoded by the novel genes. Nineteen gene products were predicted to have various domains, motifs, or regions. Exploration of gene ontology that predicts how gene products behave in a cellular context also revealed diverse protein properties in 20 genes. It should be noted that none of the novel genes has been annotated with gene ontology codes in the Mouse Genome Informatics data base, and thus the present information was obtained by our assignment of potential gene ontology codes to the genes through BLAST searches with sequences and relevant hits in Web-based gene ontology servers (6Groth D. Lehrach H. Hennig S. Nucleic Acids Res. 2004; 32: W313-W317Crossref PubMed Scopus (75) Google Scholar). We attempted to categorize these 20 genes based on gene ontology information and relate them to putative functions in reproduction (Table III). Five of the gene products seem to function as transcriptional regulators during spermatogenesis. Three and two of them are expressed during the meiotic and postmeiotic phases, respectively (Fig. 5). Another five gene products are potentially involved in cell-cell interaction or communication during spermatogenesis. Two of them, with the transmembrane region, also could function during fertilization. Four proteins belonging to a separate category appear to play structural roles. It is noteworthy that all of these gene products are expressed postmeiotically (Fig. 5), thus potentially functioning during spermiogenesis. Alternatively, three of them, with actin binding activity, could be involved in actin remodeling during sperm capacitation and acrosome reaction. Three of the novel genes seem to encode proteins localized to the nucleus and involved in nuclear activity or integrity. A group containing two genes expressed during the meiotic phase (Fig. 5) could function during meiotic division, since they are predicted to be invo" @default.
• W2102732162 created "2016-06-24" @default.
• W2102732162 creator A5007769559 @default.
• W2102732162 creator A5007966510 @default.
• W2102732162 creator A5014580851 @default.
• W2102732162 creator A5017188803 @default.
• W2102732162 creator A5018995786 @default.
• W2102732162 creator A5026360578 @default.
• W2102732162 creator A5039019390 @default.
• W2102732162 creator A5070127299 @default.
• W2102732162 creator A5075126907 @default.
• W2102732162 creator A5081178822 @default.
• W2102732162 creator A5081941499 @default.
• W2102732162 creator A5084417116 @default.
• W2102732162 date "2005-03-01" @default.
• W2102732162 modified "2023-10-06" @default.
• W2102732162 title "Identification and Integrative Analysis of 28 Novel Genes Specifically Expressed and Developmentally Regulated in Murine Spermatogenic Cells" @default.
• W2102732162 cites W1536090226 @default.
• W2102732162 cites W1963508989 @default.
• W2102732162 cites W1965053250 @default.
• W2102732162 cites W1968714983 @default.
• W2102732162 cites W1973302651 @default.
• W2102732162 cites W1978741751 @default.
• W2102732162 cites W1980733389 @default.
• W2102732162 cites W1981048926 @default.
• W2102732162 cites W1986800180 @default.
• W2102732162 cites W1989228411 @default.
• W2102732162 cites W1990409602 @default.
• W2102732162 cites W1998401946 @default.
• W2102732162 cites W2043855098 @default.
• W2102732162 cites W2057911994 @default.
• W2102732162 cites W2058033084 @default.
• W2102732162 cites W2061544228 @default.
• W2102732162 cites W2062919894 @default.
• W2102732162 cites W2063638091 @default.
• W2102732162 cites W2071709406 @default.
• W2102732162 cites W2076983324 @default.
• W2102732162 cites W2080309555 @default.
• W2102732162 cites W2085077505 @default.
• W2102732162 cites W2087898449 @default.
• W2102732162 cites W2091331192 @default.
• W2102732162 cites W2092450381 @default.
• W2102732162 cites W2094859450 @default.
• W2102732162 cites W2102663947 @default.
• W2102732162 cites W2104756642 @default.
• W2102732162 cites W2112363802 @default.
• W2102732162 cites W2112811492 @default.
• W2102732162 cites W2114835309 @default.
• W2102732162 cites W2116010836 @default.
• W2102732162 cites W2120695625 @default.
• W2102732162 cites W2121358026 @default.
• W2102732162 cites W2122755886 @default.
• W2102732162 cites W2137177802 @default.
• W2102732162 cites W2150143752 @default.
• W2102732162 cites W2151464048 @default.
• W2102732162 cites W2151499107 @default.
• W2102732162 cites W2159246237 @default.
• W2102732162 cites W2343227098 @default.
• W2102732162 doi "https://doi.org/10.1074/jbc.m412444200" @default.
• W2102732162 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/15613475" @default.
• W2102732162 hasPublicationYear "2005" @default.
• W2102732162 type Work @default.
• W2102732162 sameAs 2102732162 @default.
• W2102732162 citedByCount "50" @default.
• W2102732162 countsByYear W21027321622012 @default.
• W2102732162 countsByYear W21027321622013 @default.
• W2102732162 countsByYear W21027321622014 @default.
• W2102732162 countsByYear W21027321622015 @default.
• W2102732162 countsByYear W21027321622017 @default.
• W2102732162 countsByYear W21027321622018 @default.
• W2102732162 countsByYear W21027321622019 @default.
• W2102732162 countsByYear W21027321622020 @default.
• W2102732162 countsByYear W21027321622021 @default.
• W2102732162 countsByYear W21027321622022 @default.
• W2102732162 crossrefType "journal-article" @default.
• W2102732162 hasAuthorship W2102732162A5007769559 @default.
• W2102732162 hasAuthorship W2102732162A5007966510 @default.
• W2102732162 hasAuthorship W2102732162A5014580851 @default.
• W2102732162 hasAuthorship W2102732162A5017188803 @default.
• W2102732162 hasAuthorship W2102732162A5018995786 @default.
• W2102732162 hasAuthorship W2102732162A5026360578 @default.
• W2102732162 hasAuthorship W2102732162A5039019390 @default.
• W2102732162 hasAuthorship W2102732162A5070127299 @default.
• W2102732162 hasAuthorship W2102732162A5075126907 @default.
• W2102732162 hasAuthorship W2102732162A5081178822 @default.
• W2102732162 hasAuthorship W2102732162A5081941499 @default.
• W2102732162 hasAuthorship W2102732162A5084417116 @default.
• W2102732162 hasBestOaLocation W21027321621 @default.
• W2102732162 hasConcept C104317684 @default.
• W2102732162 hasConcept C116834253 @default.
• W2102732162 hasConcept C153911025 @default.
• W2102732162 hasConcept C54355233 @default.
• W2102732162 hasConcept C59822182 @default.
• W2102732162 hasConcept C70721500 @default.
• W2102732162 hasConcept C86803240 @default.
• W2102732162 hasConcept C95444343 @default.
• W2102732162 hasConceptScore W2102732162C104317684 @default.
• W2102732162 hasConceptScore W2102732162C116834253 @default.

• next