FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2103109966> ?p ?o ?g. }

• W2103109966 endingPage "118.e2" @default.
• W2103109966 startingPage "107" @default.
• W2103109966 abstract "Mantle cell lymphoma (MCL) is a subtype of B-cell Non-Hodgkin’s Lymphoma (NHL) and accounts for approximately 6% of all lymphomas. Unlike small lymphocytic lymphoma and chronic lymphocytic lymphoma, which are relatively sensitive to chemotherapy, MCL is highly refractory to most chemotherapy, and has the worst survival rate among NHL patients. Stem-like cells in MCL, which we have termed mantle cell lymphoma-initiating cells (MCL-ICs), enriched in the population that are lack of prototypic B-cell marker CD19. These cells were able to self-renew upon serial transplantation and are highly tumorigenic. Importantly, these stem-like cells confer chemotherapeutic resistance to MCL. In this report, we show that stem-like MCL-ICs are resistant to bortezomib, as well as chemotherapeutic regimens containing bortezomib, despite constitutive nuclear factor-κB (NF-κB) expression. Interestingly, bortezomib treatment induced MCL-IC differentiation in plasma-like cells with upregulated expression of CD38 and CD138. This process was accompanied by expression of plasma cell differentiation transcriptional factors, BLIMP-1 and IRF4. This article is the first to show that stem-like MCL cells utilize constitutive NF-κB expression for survival. Given that the NF-κB expression in MCL-ICs is resistant to bortezomib, it will be important to find alternative therapeutic strategies to inhibit NF-κB expression. Mantle cell lymphoma (MCL) is a subtype of B-cell Non-Hodgkin’s Lymphoma (NHL) and accounts for approximately 6% of all lymphomas. Unlike small lymphocytic lymphoma and chronic lymphocytic lymphoma, which are relatively sensitive to chemotherapy, MCL is highly refractory to most chemotherapy, and has the worst survival rate among NHL patients. Stem-like cells in MCL, which we have termed mantle cell lymphoma-initiating cells (MCL-ICs), enriched in the population that are lack of prototypic B-cell marker CD19. These cells were able to self-renew upon serial transplantation and are highly tumorigenic. Importantly, these stem-like cells confer chemotherapeutic resistance to MCL. In this report, we show that stem-like MCL-ICs are resistant to bortezomib, as well as chemotherapeutic regimens containing bortezomib, despite constitutive nuclear factor-κB (NF-κB) expression. Interestingly, bortezomib treatment induced MCL-IC differentiation in plasma-like cells with upregulated expression of CD38 and CD138. This process was accompanied by expression of plasma cell differentiation transcriptional factors, BLIMP-1 and IRF4. This article is the first to show that stem-like MCL cells utilize constitutive NF-κB expression for survival. Given that the NF-κB expression in MCL-ICs is resistant to bortezomib, it will be important to find alternative therapeutic strategies to inhibit NF-κB expression. Mantle cell lymphoma (MCL) is a subtype of Non-Hodgkin’s Lymphoma (NHL), the sixth most common type of human cancer in the United States [1Mounter P.J. Lennard A.L. Management of non-Hodgkin’s lymphomas.Postgrad Med J. 1999; 75: 2-6PubMed Google Scholar, 2Salaverria I. Perez-Galan P. Colomer D. Campo E. Mantle cell lymphoma: from pathology and molecular pathogenesis to new therapeutic perspectives.Haematologica. 2006; 91: 11-16PubMed Google Scholar]. MCLs display widespread cellular heterogeneity and are extremely resistant to standard radiation and chemotherapeutic interventions. As a result, the median survival time for patients with malignant MCL is less than 3 years, and these patients display the worst survival rate among NHLs [2Salaverria I. Perez-Galan P. Colomer D. Campo E. Mantle cell lymphoma: from pathology and molecular pathogenesis to new therapeutic perspectives.Haematologica. 2006; 91: 11-16PubMed Google Scholar, 3Pileri S.A. Falini B. Mantle cell lymphoma.Haematologica. 2009; 94: 1488-1492Crossref PubMed Scopus (64) Google Scholar].We have prospectively isolated stem-like cells in human MCL patients [4Chen Z. Ayala P. Wang M. et al.Prospective isolation of clonogenic mantle cell lymphoma-initiating cells.Stem Cell Res. 2010; 5: 212-225Crossref PubMed Scopus (24) Google Scholar]. We found that CD45+CD3−CD34−CD19− MCL cells, which we have termed MCL-initiating cells (MCL-ICs), are highly tumorigenic and display self-renewal capacities in vivo. In contrast, the majority of the tumor population, CD45+CD19+ MCL cells, demonstrate reduced tumorigenicity with no self-renewal activities in vivo [4Chen Z. Ayala P. Wang M. et al.Prospective isolation of clonogenic mantle cell lymphoma-initiating cells.Stem Cell Res. 2010; 5: 212-225Crossref PubMed Scopus (24) Google Scholar].Moreover, CD45+CD19− MCL-ICs confer drug-resistant properties to MCL; CD45+CD19− MCL-ICs were highly resistant in vitro to various chemotherapeutic agents that are currently used in the clinic [5Jung H.J. Chen Z. McCarty N. Stem-like tumor cells confer drug resistant properties to mantle cell lymphoma.Leuk Lymphoma. 2011; 52: 1066-1079Crossref PubMed Scopus (19) Google Scholar]. The IC50 of chemotherapeutic drugs that effectively suppresses the growth of CD45+CD19− MCL-ICs was 2 to 3.5 times higher than that of CD45+CD19+ MCL cells [5Jung H.J. Chen Z. McCarty N. Stem-like tumor cells confer drug resistant properties to mantle cell lymphoma.Leuk Lymphoma. 2011; 52: 1066-1079Crossref PubMed Scopus (19) Google Scholar].Nuclear factor κB (NF-κB) is a well-known transcriptional factor involved in various cellular responses, including immune and inflammatory reaction, apoptosis, cell cycle, and oncogenesis [6Baldwin A.S. Control of oncogenesis and cancer therapy resistance by the transcription factor NF-kappaB.J Clin Invest. 2001; 107: 241-246Crossref PubMed Scopus (1189) Google Scholar, 7Murray R.Z. Norbury C. Proteasome inhibitors as anti-cancer agents.Anticancer Drugs. 2000; 11: 407-417Crossref PubMed Scopus (45) Google Scholar, 8Packham G. The role of NF-kappaB in lymphoid malignancies.Br J Haematol. 2008; 143: 3-15Crossref PubMed Scopus (48) Google Scholar]. Various studies have identified a link between NF-κB and malignancies, and inhibition of NF-κB activation has been proposed as a potent therapeutic target [6Baldwin A.S. Control of oncogenesis and cancer therapy resistance by the transcription factor NF-kappaB.J Clin Invest. 2001; 107: 241-246Crossref PubMed Scopus (1189) Google Scholar, 9Pham L.V. Tamayo A.T. Yoshimura L.C. Lo P. Ford R.J. Inhibition of constitutive NF-kappa B activation in mantle cell lymphoma B cells leads to induction of cell cycle arrest and apoptosis.J Immunol. 2003; 171: 88-95PubMed Google Scholar, 10Naugler W.E. Karin M. NF-kappaB and cancer-identifying targets and mechanisms.Curr Opin Genet Dev. 2008; 18: 19-26Crossref PubMed Scopus (527) Google Scholar, 11Guzman M.L. Neering S.J. Upchurch D. et al.Nuclear factor-kappaB is constitutively activated in primitive human acute myelogenous leukemia cells.Blood. 2001; 98: 2301-2307Crossref PubMed Scopus (659) Google Scholar]. Expression of NF-κB components was reported in MCL cell lines and primary MCL cells; however, therapies targeting NF-κB, such as bortezomib, showed only minimal effects on refractory MCL [12Yang D.T. Young K.H. Kahl B.S. Markovina S. Miyamoto S. Prevalence of bortezomib-resistant constitutive NF-kappaB activity in mantle cell lymphoma.Mol Cancer. 2008; 7: 40Crossref PubMed Scopus (49) Google Scholar, 13O’Connor O.A. Wright J. Moskowitz C. et al.Phase II clinical experience with the novel proteasome inhibitor bortezomib in patients with indolent non-Hodgkin’s lymphoma and mantle cell lymphoma.J Clin Oncol. 2005; 23: 676-684Crossref PubMed Scopus (542) Google Scholar, 14Goy A. Younes A. McLaughlin P. et al.Phase II study of proteasome inhibitor bortezomib in relapsed or refractory B-cell non-Hodgkin’s lymphoma.J Clin Oncol. 2005; 23: 667-675Crossref PubMed Scopus (497) Google Scholar]. Bortezomib (Velcade; Millennium Pharmaceuticals Inc, Boston, MA, USA) is a drug that targets the 26S proteasome and supposedly inhibits proteasomal degradation of ubiquitinated NF-κB inhibitor. Given that CD45+CD19− MCL-ICs are highly resistant to several chemotherapeutic drugs, it is important to investigate the therapeutic effects of bortezomib in MCL-ICs.In the present study, we demonstrate that CD45+CD19− MCL-ICs are highly resistant to bortezomib, and bortezomib resistance in MCL is determined by MCL-ICs. CD45+CD19− MCL-ICs also express high levels of NF-κB, but this NF-κB expression was bortezomib-resistant. The combination of bortezomib and conventional combined chemotherapeutic regimens were less effective at targeting CD45+CD19− MCL-ICs, but were effective in suppressing the growth of CD45+CD19+ bulk MCL cells. When CD45+CD19− MCL-ICs were treated in vitro with bortezomib, cells started to differentiate to plasma-like cells with upregulated expression of CD138 and CD38. This process is accompanied by expression of BLIMP-1 and IRF4.Collectively, our study demonstrates that the degree of bortezomib resistance in MCL is determined by CD45+CD19− MCL-ICs, which are expressing bortezomib-resistant NF-κB. These stem-like MCL-ICs differentiate into plasma-like cells upon bortezomib treatment, indicating that these plasma-like cells can arise from stem-like cells. Understanding how these processes are molecularly coordinated will be the key to resolving the bortezomib resistance of MCL.Materials and methodsPatient samples and cell linesBlood specimens from MCL patients were obtained after informed consent, as approved by MD Anderson Cancer Center and the University of Texas-Health Science Center Institutional Review Boards. All primary patient peripheral blood mononuclear cells were isolated from apheresis blood by standard Ficoll gradient methods. All patient samples were diagnosed with MCL at the time of collection based on t(11;14) translocation, cyclin D1 reactivity, and were in the leukemic phase at the time of apheresis. The patients were previously treated, although the course of therapy differed somewhat between patients. Two well-characterized Epstein-Barr virus–negative human MCL cell lines, Jeko-1 and REC-1, were obtained from American Type Culture Collection (Manassas, VA, USA).Cell preparation and cultureCD34+ hematopoietic stem cells and CD3+ T cells were removed from peripheral blood mononuclear cell samples prior to all analyses using lineage-specific purified antibodies (CD3, 1:500 dilutions; and CD34, 1:1000 dilutions) and magnetic beads, according to manufacturer’s protocol (Dynal beads methods). These CD3- and CD34-depleted cells were separated using CD19 lineage-specific antibodies (Biolegend, San Diego, CA, USA) and Dynabeads (Invitrogen, Oslo, Norway). Purity of separated tumor cells (CD45+CD3−CD34−CD19+ and CD45+CD3−CD34−CD19− cells) was confirmed to be >95% by flow cytometric analysis. The primary MCL cells were cultured in complete RPMI 1640 (Cellgro, Manassas, VA, USA) media, which contained 10% heat-inactivated fetal bovine serum, 2 mM glutamine, 100 μg/mL streptomycin, and 100 μg/mL penicillin. Jeko-1 was cultured in the same RPMI 1640 medium as stated here, and RPMI 1640 (American Type Culture Collection) medium, which contained 10% heat-inactivated fetal bovine serum, 100 μg/mL streptomycin, and 100 μg/mL penicillin, was used for REC-1.ReagentsThe following commercially available antibodies were used: anti-CD45 (HI30, IgG1, κ), anti-CD19 (HIB19, IgG1, κ), anti-CD3 (HIT3a, IgG2a, κ), anti-CD34 (581, IgG1, κ), anti-CD138 (MI15, IgG1, κ), anti-CD38 (HIT2, IgG1, κ), anti-p50 (H-119), anti-p65 (C-20), etc. All antibodies were purified or conjugated with appropriate fluorochromes based on the combinations of antibodies used in each experiment. Antibodies were purchased from BD, BioLegend, or eBioscience (San Diego, CA, USA). All chemotherapeutic drugs were obtained from the pharmacy at MD Anderson Cancer Center. We used the drug concentrations that were determined in our previous article [5Jung H.J. Chen Z. McCarty N. Stem-like tumor cells confer drug resistant properties to mantle cell lymphoma.Leuk Lymphoma. 2011; 52: 1066-1079Crossref PubMed Scopus (19) Google Scholar], which was based on our preliminary data using MCL tumor samples as well as the concentrations reported in various studies on human hematological malignancies.Enzyme-linked immunosorbent assayTo prepare nuclear extracts, 1 × 106 cells were washed with cold phosphate-buffered saline/phosphatase inhibitors, and harvested with 100 μL 1× hypotonic buffer on ice. Nuclei were separated by centrifugation and resuspended in 10 μL Complete Lysis Buffer. After 30 minutes of incubation on ice, nuclear lysates were collected by high-speed centrifugation. The buffers were purchased from Active Motif (Carlsbad, CA, USA), and all steps were performed according to manufacturer’s instructions. Five micrograms of nuclear extracts were used to assay for the NF-κB p50, p65, p52, c-Rel, and RelB DNA-binding activity using enzyme-linked immunosorbent assay (ELISA), according to the protocol of Active Motif TransAM NFκB Family Kit. Briefly, NF-κB oligonucleotide (5′-GGGACTTTCC-3′)–coated 96-well plate was incubated with nuclear extracts as indicated here. Horseradish peroxidase–conjugated secondary antibodies provide a colorimetric readout that is quantified by spectrophotometry equipped with SoftMax Pro software (Molecular Devices, Sunnyvale, CA, USA).Immunoblot analysisNuclear extracts, which were obtained as described here, were solubilized with 25 mM Tris, 192 mM glycerine, and 0.1% sodium dodecyl sulfate buffer (Bio-Rad, Hercules, CA, USA) and electrophoresed on a 10% Tris-Glycine gel (NuSep, Bogart, GA, USA). Proteins were transferred onto nitrocellulose membrane and probed with various specific primary antibodies and then the appropriate enhanced chemiluminescence-labeled secondary antibodies. Proteins were visualized by enhanced chemiluminescence (Thermo, Rockford, IL, USA).Rhodamine 123 stainingCD3+ (T cells) and CD34+ (hematopoietic stem cells) were removed from primary patient samples. These cells were suspended at 106 cells/50 μL Hank’s balanced salt solution containing 5% fetal bovine serum. Rhodamine 123 dye (Invitrogen) was added to a final concentration of 0.1 μg/mL. Cells were incubated for 20 minutes at 37°C, followed by washing cells twice with Hank’s balanced salt solution. Cells were resuspended to allow efflux at 37°C for 2 hours. Cells were washed once with Hank’s balanced salt solution and stained with antibodies before fluorescence-activated cell sorting analyses.Fluorimetric cytotoxicity assayCytotoxicity was assessed with fluorimetric cell viability assay using CellTiter-Blue (Promega, Madison, WI, USA). Briefly, cells were incubated for the incubated times at 37°C with determined doses of drugs. After washing treated cells, CellTiter-Blue reagents (20 μL) were added to suspended cells with new complete RPMI 1640 media (80 μL) and these were incubated in 96-well plates for 4 hours at 37°C. The fluorescent signal was measured at 560Ex/590Em using a fluorescence plate reader equipped with SoftMax Pro software (Molecular Devices), and the level of fluorescent resorufin was calculated. Dose-response curves were calculated based on the cell viability assay of cells treated with each chemotherapeutic drug. Cell viability was assessed based on the value of the fluorescent signal of live cells with no drug treatments. Viabilities of drug-treated cells were calculated based on a ratio of the fluorescent signal using the following equation:CellViability(%)=Vmax×SαS0In this equation, Vmax is the full range of cell viability, i.e., 100%; Sα is the value of the fluorescent signal of live cells at α of drug concentration; and S0 represents the value of fluorescent signal of live cells with no treatments. All assays were performed in triplicate, and data are expressed as mean values ± standard deviation.IC50IC50 value (the concentration of a drug that is required for 50% inhibition in vitro) was used to indicate the quantitative measure of the different cell-killing effects of drugs. The Hill-Slope logistic model is used to calculate IC50 using CompuSyn software (ComboSyn, Paramus, NJ, USA).Drug combination assayThe synergic cytotoxic effects of bortezomib and conventional combination chemotherapeutic regimens were determined by combination index (CI) method based on Chou and Talalay equation [15Chou T.C. Talalay P. Quantitative analysis of dose-effect relationships: the combined effects of multiple drugs or enzyme inhibitors.Adv Enzyme Regul. 1984; 22: 27-55Crossref PubMed Scopus (5863) Google Scholar], and analyzed by the CompuSyn software (ComboSyn). Briefly, the CI equation is a quantitative measure of the degree of drug interaction in terms of synergism and antagonism of a given endpoint of the effect measurement [16Chou T.C. Talalay P. Generalized equations for the analysis of inhibitions of Michaelis-Menten and higher-order kinetic systems with two or more mutually exclusive and nonexclusive inhibitors.Eur J Biochem. 1981; 115: 207-216Crossref PubMed Scopus (359) Google Scholar], and the following median-effect equation [fa/fu = (D/Dm)m; a general equation for dose-effect relationship that takes into account both the potency (Dm) and shape (m) of dose-effect curve, where fa and fu are the fractions affected and unaffected, respectively [17Chou T.C. Derivation and properties of Michaelis-Menten type and Hill type equations for reference ligands.J Theor Biol. 1976; 59: 253-276Crossref PubMed Scopus (284) Google Scholar], is the basis of the following CI equation:∑i=0n(D)i(Dx)i=CIIn this equation, n is the number of combined drugs; (Dx)i is the dose of drug i alone that inhibits x%; and (D)i is the portion of drug i in drug combination that also inhibits x%. Synergy is present when the CI is <1.0, additive effect is when CI = 1.0, and antagonism is when CI >1.0.Flow cytometryCD3+, CD34+, and CD19+ cells were deleted using magnetic beads selection method as mentioned here. After culture with or without bortezomib, CD3−CD34−CD19− MCL-ICs were stained by fluorescein isothiocyanate–labeled anti-CD138 (BD Pharmingen, San Diego, CA, USA) and phycoerythrin-Cy7–labeled anti-CD38 (eBioscience), and then analyzed using fluorescence-activated cell sorting LSRII flow cytometer (BD Biosciences, NJ, USA). All assays were performed in duplicate.Quantitative reverse transcription polymerase chain reaction (RT-PCR)Messenger RNA samples were subjected to RNase-free DNase treatment performed according to RNeasy Mini Kit (QIAGEN, Germantown, MD, USA) and reverse-transcribed to complementary DNA using SuperScript III First-Strand Synthesis System (Invitrogen, Carlsbad, CA, USA), as per manufacturer’s instructions. The following primers were designed using PrimerExpress software (Applied Biosystems, Carlsbad, CA, USA): interleukin (IL)-6 sense 5′ CCCAGGGAGAAGGCAACT 3′, IL-6 antisense 5′ CCAGGAGCCCAGCTATGAAC 3′, IL-8 sense 5′ AGAGCCACGGCCAGCTT 3′, IL-8 antisense 5′ GGAAGAAACCACCGGAAGGA 3′, cellular inhibitor of apoptosis protein 2 (c-IAP2) sense 5′ GCTTCTGTTGTGGCCTG 3′, c-IAP2 antisense 5′ CACCTTGGAAACCAC 3′, BLIMP-1 sense 5′ GGCATTCATGTGGCTTTTCT 3′, BLIMP-1 antisense 5′ AGATGACCGGCTACAAGACC 3′, IRF4 sense 5′ GGGTCTGGAAACTCCTCTCC 3′, IRF4 antisense 5′ GCCAGAGCAGGATCTACTGG 3′. Quantitative RT-PCRs were performed using RT2 SYBR Green/ROX qPCR Master Mix (SABiosciences, Foster City, CA, USA) according to manufacturer’s instructions. Human β-actin or glyceraldehyde-3-phosphate dehydrogenase genes were used as internal controls. All samples were run in duplicate using ABI 7900HT Fast Real-Time PCR System equipped with SDS Software v2.3 software (Applied Biosystems), and data were analyzed using the comparative Ct method (ΔΔCt).Statistical analysisAll assays were performed in duplicate or triplicate, and data are expressed as mean values ± standard deviation. Statistical analyses were performed using IBM SPSS for Windows software, version 12.0 (IBM Corp., Armonk, NY, USA). Statistical significance of differences between the cell groups was evaluated by Student’s t-test. p Values <0.05 were considered statistically significant.ResultsNF-κB is constitutively expressed in MCL-ICsNF-κB is a family of transcription factors that plays a central role in activation and survival of normal immune cells [18Joyce D. Albanese C. Steer J. Fu M. Bouzahzah B. Pestell R.G. NF-kappaB and cell-cycle regulation: the cyclin connection.Cytokine Growth Factor Rev. 2001; 12: 73-90Abstract Full Text Full Text PDF PubMed Scopus (340) Google Scholar]. NF-κB also plays a role in malignant cell development and differentiation by regulating the cell cycle and protecting cells from apoptosis [6Baldwin A.S. Control of oncogenesis and cancer therapy resistance by the transcription factor NF-kappaB.J Clin Invest. 2001; 107: 241-246Crossref PubMed Scopus (1189) Google Scholar, 7Murray R.Z. Norbury C. Proteasome inhibitors as anti-cancer agents.Anticancer Drugs. 2000; 11: 407-417Crossref PubMed Scopus (45) Google Scholar, 8Packham G. The role of NF-kappaB in lymphoid malignancies.Br J Haematol. 2008; 143: 3-15Crossref PubMed Scopus (48) Google Scholar].Because MCL-ICs do not express CD19, which is a coreceptor for B-cell proliferation and differentiation, we hypothesized that MCL-ICs must have alternative survival mechanisms. Hodgkin’s Lymphoma cells, which do not express the B-cell receptor, use constitutive NF-κB activation for maintenance of survival [19Bargou R.C. Emmerich F. Krappmann D. et al.Constitutive nuclear factor-kappaB-RelA activation is required for proliferation and survival of Hodgkin’s disease tumor cells.J Clin Invest. 1997; 100: 2961-2969Crossref PubMed Scopus (695) Google Scholar]. Therefore, we investigated whether NF-κB components are present in MCL-ICs. We first isolated CD45+CD19− MCL-ICs from several MCL patient samples after depletion of hematopoietic stem cells and T cells as described previously [4Chen Z. Ayala P. Wang M. et al.Prospective isolation of clonogenic mantle cell lymphoma-initiating cells.Stem Cell Res. 2010; 5: 212-225Crossref PubMed Scopus (24) Google Scholar].CD45+CD19− MCL-ICs showed high expression of two NF-κB components, p50 and p65, which were detected by immunoblot analyses (Fig. 1A). We further analyzed the DNA-binding activities of NF-κB transcription factors using nuclear extracts of each cell type by an ELISA-based assay. This ELISA-based assay is an alternative way to measure NF-κB binding instead of a radioactivity-based assay, such as electrophoretic mobility shift assay [20Renard P. Ernest I. Houbion A. et al.Development of a sensitive multi-well colorimetric assay for active NFkappaB.Nucleic Acids Res. 2001; 29: E21Crossref PubMed Scopus (343) Google Scholar]. In CD45+CD19− MCL-ICs, NF-κB p50 and p65 DNA-binding activities were consistently higher compared to the normal B cells, and the activity levels also are comparable to positive control (Fig. 1B). However, the other components of NF-κB, p52, c-Rel, and RelB were not readily detected by Western blots or ELISA assays (data not shown). Together these results demonstrate that NF-κB activity is constitutively upregulated in CD45+CD19− MCL-ICs.CD45+CD19− MCL-ICs are resistant to bortezomib compared to CD45+CD19+ bulk MCL cellsBecause CD45+CD19− MCL-ICs express NF-κB, we treated CD45+CD19− MCL-ICs with bortezomib and investigated whether bortezomib can be used as an effective therapy that can target MCL-ICs in vitro. CD45+CD19− MCL-ICs that express NF-κB showed much higher IC50 than that of bortezomib-resistant cell line, REC-1 [21Rizzatti E.G. Mora-Jensen H. Weniger M.A. et al.Noxa mediates bortezomib induced apoptosis in both sensitive and intrinsically resistant mantle cell lymphoma cells and this effect is independent of constitutive activity of the AKT and NF-kappaB pathways.Leuk Lymphoma. 2008; 49: 798-808Crossref PubMed Scopus (49) Google Scholar]; however, most CD45+CD19+ bulk MCL cells showed lower IC50 than that of bortezomib-sensitive cell line, Jeko-1 [21Rizzatti E.G. Mora-Jensen H. Weniger M.A. et al.Noxa mediates bortezomib induced apoptosis in both sensitive and intrinsically resistant mantle cell lymphoma cells and this effect is independent of constitutive activity of the AKT and NF-kappaB pathways.Leuk Lymphoma. 2008; 49: 798-808Crossref PubMed Scopus (49) Google Scholar] (Fig. 2A). In addition, the IC50 of bortezomib that effectively suppresses the growth of CD45+CD19− MCL-ICs was ∼10 times higher than doses that kill CD45+CD19+ MCL cells, and the differences between two cell types were statistically significant (Fig. 2B, Table 1).Figure 2CD45+CD19− MCL-ICs isolated from patient samples are bortezomib-resistant. (A) The bortezomib sensitivities of CD45+CD19− MCL-ICs and CD45+CD19+ MCL cells isolated from different six MCL patients were compared with those of REC-1 and Jeko-1 cells. Cells (1.5–2.5 × 105 cells per well) were cultured in 24-well plates for 16 hours after the addition of bortezomib. Cell viability was determined by CellTiter-Blue fluorometric assay (Promega) and was indicated as a ratio compared to cell viability without treatment. Drugs were serially diluted as indicated from maximum drug doses of 100 nM. Results show the mean ± standard deviation of triplicate. CD45+CD19− MCL-ICs showed more survival rates on all tested drug concentrations compared to CD45+CD19+ MCL cells. CD19(−), CD45+CD19− cells; CD19(+), CD45+CD19+ cells. (B) The mean IC50 value of bortezomib for CD45+CD19− MCL-ICs was much higher than those of the CD45+CD19+ MCL cells, Jeko-1, or even REC-1, which was reported as a bortezomib-resistant cell line. CD19(−) = CD45+CD19− cells; CD19(+) = CD45+CD19+ cells. Bars represent averages; ∗p < 0.05 by unpaired t-test.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Table 1IC50 values of bortezomib between MCL-ICs and other MCL bulk cellsnMPt1Pt2Pt3Pt4Pt5Pt6AverageCD19(+)2.4110.223.14.867.611.174.895CD19(−)61.2799.79415.5838.5850.089.1145.73567CD19(+), CD45+CD19+ MCL cells; CD19(−), CD45+CD19− MCL-ICs.Separated MCL cells were incubated for 15 hours after adding bortezomib. CD45+CD19− MCL-ICs require much higher doses of bortezomib to suppress cell growth compared to CD45+CD19+ MCL cells. Open table in a new tab We then tested bortezomib resistance using xenograft tumors from nonobese diabetic/severe combined immune-deficient mice (Supplementary Figure E1A; online only, available at www.exphem.org). Tumors were isolated after injecting bulk MCL cells as shown previously [4Chen Z. Ayala P. Wang M. et al.Prospective isolation of clonogenic mantle cell lymphoma-initiating cells.Stem Cell Res. 2010; 5: 212-225Crossref PubMed Scopus (24) Google Scholar]. CD45+CD19− MCL-ICs and CD45+CD19+ cells were isolated and the same concentration of bortezomib was used as shown in Figure 2. Similar to patient samples, CD19− cells from xenograft tumors were bortezomib-resistant compared to CD19+ xenograft tumors. IC50 values of xenograft tumors were also much higher than CD19+ xenograft cells (Supplementary Figure E1B; online only, available at www.exphem.org). Because MCL-ICs were maintained in a quiescent status measured by drug efflux activities using Rhodamine 123 [4Chen Z. Ayala P. Wang M. et al.Prospective isolation of clonogenic mantle cell lymphoma-initiating cells.Stem Cell Res. 2010; 5: 212-225Crossref PubMed Scopus (24) Google Scholar], we further tested whether bortezomib treatment affects Rhodamine staining profiles in MCL. CD34+ hematopoietic stem cells and CD3+ T cells were removed from patient samples before Rhodamine 123 staining. After bortezomib treatments, Rhodamine 123 low cells were increased, which indicate that quiescent populations are resistant to bortezomib (Supplementary Figure E2; online only, available at www.exphem.org). As reported for stem-like cells in other cancers, the quiescent properties of MCL-ICs may render them difficult to kill with conventional therapies that target cells with increased mitotic properties. The quiescent cellular properties may also be due to elevated expression of different multidrug-resistant gene products, which likely contribute to the drug-resistant features of stem-like cancer cells [22Dean M. Rzhetsky A. Allikmets R. The human ATP-binding cassette (ABC) transporter superfamily.Genome Res. 2001; 11: 1156-1166Crossref PubMed Scopus (1475) Google Scholar]. Therefore, this result could also indicate that the population (Rhodamine 123 low) that is enriched for drug transporters is more resistant to bortezomib treatment. Previously, we reported that CD45+CD19+ MCL cells do not have self-renewal properties with decreased tumor-forming activities [4Chen Z. Ayala P. Wang M. et al.Prospective isolation of clonogenic mantle cell lymphoma-initiating cells.Stem Cell Res. 2010; 5: 212-225Crossref PubMed Scopus (24) Google Scholar]. Moreover, CD45+CD19+ MCL cells were susceptible to various chemotherapeutic agents compared to CD45+CD19− MCL-ICs [5Jung H.J. Chen Z. McCarty N. Stem-like tumor cells confer drug resistant properties to mantle cell lymphoma.Leuk Lymphoma. 2011; 52: 1066-1079Crossref PubMed Scopus (19) Google Scholar]. Together, our data demonstrate that CD45+CD19− MCL-ICs are resistant not only to R-CHOP, R-CVAD, R-DHAP, and fludarabine-based regimens, as shown in our previous report, but also to bortezomib.Levels of NF-κB and its downstream gene expression are unchangeable upon bortezomib treatmentBecause CD45+CD19− MCL-ICs are resistant to bortezomib, we investigated NF-κB signaling upon bortezomib treatment. For the ELISA assay, CD45+CD19− MCL-ICs isolated from patient samples were treated with 100 nM bortezomib for 16 hours. Non-treated Raji cells were used as a" @default.
• W2103109966 created "2016-06-24" @default.
• W2103109966 creator A5028677309 @default.
• W2103109966 creator A5032769690 @default.
• W2103109966 creator A5074654320 @default.
• W2103109966 creator A5074743570 @default.
• W2103109966 creator A5076324075 @default.
• W2103109966 creator A5079320939 @default.
• W2103109966 creator A5089736242 @default.
• W2103109966 date "2012-02-01" @default.
• W2103109966 modified "2023-10-12" @default.
• W2103109966 title "Bortezomib-resistant nuclear factor κB expression in stem-like cells in mantle cell lymphoma" @default.
• W2103109966 cites W1842788023 @default.
• W2103109966 cites W1970599858 @default.
• W2103109966 cites W1973562447 @default.
• W2103109966 cites W1978428538 @default.
• W2103109966 cites W1978591997 @default.
• W2103109966 cites W1979289112 @default.
• W2103109966 cites W1979569154 @default.
• W2103109966 cites W1983398917 @default.
• W2103109966 cites W1988356885 @default.
• W2103109966 cites W1993220175 @default.
• W2103109966 cites W1995594307 @default.
• W2103109966 cites W2008464733 @default.
• W2103109966 cites W2015303096 @default.
• W2103109966 cites W2016797632 @default.
• W2103109966 cites W2018279800 @default.
• W2103109966 cites W2023427658 @default.
• W2103109966 cites W2023949108 @default.
• W2103109966 cites W2039817035 @default.
• W2103109966 cites W2050433177 @default.
• W2103109966 cites W2050767064 @default.
• W2103109966 cites W2051055358 @default.
• W2103109966 cites W2051994734 @default.
• W2103109966 cites W2058399266 @default.
• W2103109966 cites W2062069198 @default.
• W2103109966 cites W2077945404 @default.
• W2103109966 cites W2086941505 @default.
• W2103109966 cites W2090982381 @default.
• W2103109966 cites W2100608938 @default.
• W2103109966 cites W2116090592 @default.
• W2103109966 cites W2119680582 @default.
• W2103109966 cites W2139337843 @default.
• W2103109966 cites W2154423235 @default.
• W2103109966 cites W2164743283 @default.
• W2103109966 cites W2332905423 @default.
• W2103109966 doi "https://doi.org/10.1016/j.exphem.2011.10.004" @default.
• W2103109966 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/3398482" @default.
• W2103109966 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/22024108" @default.
• W2103109966 hasPublicationYear "2012" @default.
• W2103109966 type Work @default.
• W2103109966 sameAs 2103109966 @default.
• W2103109966 citedByCount "15" @default.
• W2103109966 countsByYear W21031099662012 @default.
• W2103109966 countsByYear W21031099662013 @default.
• W2103109966 countsByYear W21031099662014 @default.
• W2103109966 countsByYear W21031099662015 @default.
• W2103109966 countsByYear W21031099662016 @default.
• W2103109966 countsByYear W21031099662017 @default.
• W2103109966 countsByYear W21031099662020 @default.
• W2103109966 crossrefType "journal-article" @default.
• W2103109966 hasAuthorship W2103109966A5028677309 @default.
• W2103109966 hasAuthorship W2103109966A5032769690 @default.
• W2103109966 hasAuthorship W2103109966A5074654320 @default.
• W2103109966 hasAuthorship W2103109966A5074743570 @default.
• W2103109966 hasAuthorship W2103109966A5076324075 @default.
• W2103109966 hasAuthorship W2103109966A5079320939 @default.
• W2103109966 hasAuthorship W2103109966A5089736242 @default.
• W2103109966 hasBestOaLocation W21031099661 @default.
• W2103109966 hasConcept C126322002 @default.
• W2103109966 hasConcept C2776364478 @default.
• W2103109966 hasConcept C2777478702 @default.
• W2103109966 hasConcept C2777525834 @default.
• W2103109966 hasConcept C2779338263 @default.
• W2103109966 hasConcept C502942594 @default.
• W2103109966 hasConcept C71924100 @default.
• W2103109966 hasConcept C86803240 @default.
• W2103109966 hasConceptScore W2103109966C126322002 @default.
• W2103109966 hasConceptScore W2103109966C2776364478 @default.
• W2103109966 hasConceptScore W2103109966C2777478702 @default.
• W2103109966 hasConceptScore W2103109966C2777525834 @default.
• W2103109966 hasConceptScore W2103109966C2779338263 @default.
• W2103109966 hasConceptScore W2103109966C502942594 @default.
• W2103109966 hasConceptScore W2103109966C71924100 @default.
• W2103109966 hasConceptScore W2103109966C86803240 @default.
• W2103109966 hasIssue "2" @default.
• W2103109966 hasLocation W21031099661 @default.
• W2103109966 hasLocation W21031099662 @default.
• W2103109966 hasLocation W21031099663 @default.
• W2103109966 hasLocation W21031099664 @default.
• W2103109966 hasOpenAccess W2103109966 @default.
• W2103109966 hasPrimaryLocation W21031099661 @default.
• W2103109966 hasRelatedWork W1902184340 @default.
• W2103109966 hasRelatedWork W2039859878 @default.
• W2103109966 hasRelatedWork W2042396314 @default.
• W2103109966 hasRelatedWork W2073999670 @default.
• W2103109966 hasRelatedWork W2089513781 @default.
• W2103109966 hasRelatedWork W2119976123 @default.

• next