FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2103246476> ?p ?o ?g. }

• W2103246476 endingPage "2523" @default.
• W2103246476 startingPage "2514" @default.
• W2103246476 abstract "Excess dietary vitamin A is esterified with fatty acids and stored in the form of retinyl ester (RE) predominantly in the liver. According to the requirements of the body, liver RE stores are hydrolyzed and retinol is delivered to peripheral tissues. The controlled mobilization of retinol ensures a constant supply of the body with the vitamin. Currently, the enzymes catalyzing liver RE hydrolysis are unknown. In this study, we identified mouse esterase 22 (Es22) as potent RE hydrolase highly expressed in the liver, particularly in hepatocytes. The enzyme is located exclusively at the endoplasmic reticulum (ER), implying that it is not involved in the mobilization of RE present in cytosolic lipid droplets. Nevertheless, cell culture experiments revealed that overexpression of Es22 attenuated the formation of cellular RE stores, presumably by counteracting retinol esterification at the ER. Es22 was previously shown to form a complex with β-glucuronidase (Gus). Our studies revealed that Gus colocalizes with Es22 at the ER but does not affect its RE hydrolase activity. Interestingly, however, Gus was capable of hydrolyzing the naturally occurring vitamin A metabolite retinoyl β-glucuronide. In conclusion, our observations implicate that both Es22 and Gus play a role in liver retinoid metabolism. Excess dietary vitamin A is esterified with fatty acids and stored in the form of retinyl ester (RE) predominantly in the liver. According to the requirements of the body, liver RE stores are hydrolyzed and retinol is delivered to peripheral tissues. The controlled mobilization of retinol ensures a constant supply of the body with the vitamin. Currently, the enzymes catalyzing liver RE hydrolysis are unknown. In this study, we identified mouse esterase 22 (Es22) as potent RE hydrolase highly expressed in the liver, particularly in hepatocytes. The enzyme is located exclusively at the endoplasmic reticulum (ER), implying that it is not involved in the mobilization of RE present in cytosolic lipid droplets. Nevertheless, cell culture experiments revealed that overexpression of Es22 attenuated the formation of cellular RE stores, presumably by counteracting retinol esterification at the ER. Es22 was previously shown to form a complex with β-glucuronidase (Gus). Our studies revealed that Gus colocalizes with Es22 at the ER but does not affect its RE hydrolase activity. Interestingly, however, Gus was capable of hydrolyzing the naturally occurring vitamin A metabolite retinoyl β-glucuronide. In conclusion, our observations implicate that both Es22 and Gus play a role in liver retinoid metabolism. Retinoids (vitamin A and metabolites) are essential micronutrients in mammals (1Blomhoff R. Green M.H. Green J.B. Berg T. Norum K.R. Vitamin A metabolism: new perspectives on absorption, transport, and storage.Physiol. Rev. 1991; 71: 951-990Crossref PubMed Scopus (344) Google Scholar). Dietary retinoids are readily absorbed by the intestine. In the intestinal lumen, retinyl esters (REs) are hydrolyzed to retinol by the action of pancreatic triglyceride lipase (2van Bennekum A.M. Fisher E.A. Blaner W.S. Harrison E.H. Hydrolysis of retinyl esters by pancreatic triglyceride lipase.Biochemistry. 2000; 39: 4900-4906Crossref PubMed Scopus (48) Google Scholar, 3Ruiz A. Winston A. Lim Y.H. Gilbert B.A. Rando R.R. Bok D. Molecular and biochemical characterization of lecithin retinol acyltransferase.J. Biol. Chem. 1999; 274: 3834-3841Abstract Full Text Full Text PDF PubMed Scopus (212) Google Scholar). Within the enterocytes, retinol is reesterified (3Ruiz A. Winston A. Lim Y.H. Gilbert B.A. Rando R.R. Bok D. Molecular and biochemical characterization of lecithin retinol acyltransferase.J. Biol. Chem. 1999; 274: 3834-3841Abstract Full Text Full Text PDF PubMed Scopus (212) Google Scholar, 4MacDonald P.N. Ong D.E. A lecithin:retinol acyltransferase activity in human and rat liver.Biochem. Biophys. Res. Commun. 1988; 156: 157-163Crossref PubMed Scopus (91) Google Scholar, 5MacDonald P.N. Ong D.E. Evidence for a lecithin-retinol acyltransferase activity in the rat small intestine.J. Biol. Chem. 1988; 263: 12478-12482Abstract Full Text PDF PubMed Google Scholar) for the incorporation into chylomicrons and secreted (6Vogel S. Gamble M.V. Blaner W.S. Biosynthesis, absorption and transport of retinoids.in: Nau H. Blaner W.S. Handbook of Experimental Pharmacology. Springer Verlag Publishing, Heidelberg1999: 31-95Google Scholar). In the circulation, chylomicrons are depleted from triglycerides by lipoprotein lipase and are thereby transformed to chylomicron remnants (7Goldberg I.J. Lipoprotein lipase and lipolysis: central roles in lipoprotein metabolism and atherogenesis.J. Lipid Res. 1996; 37: 693-707Abstract Full Text PDF PubMed Google Scholar). These remnants acquire apolipoprotein E and are then cleared mostly by parenchymal cells of the liver (i.e., hepatocytes) (8Blaner W.S. Olson J.A. Retinol and retinoic acid metabolism.in: Sporn M.B. Roberts A.B. Goodman D.S. The Retinoids, Biology, Chemistry and Medicine. Raven Press, New York, NY1999: 229-256Google Scholar, 9Cooper A.D. Hepatic uptake of chylomicron remnants.J. Lipid Res. 1997; 38: 2173-2192Abstract Full Text PDF PubMed Google Scholar, 10Blomhoff R. Helgerud P. Rasmussen M. Berg T. Norum K.R. In vivo uptake of chylomicron.Proc. Natl. Acad. Sci. USA. 1982; 79: 7326-7330Crossref PubMed Google Scholar). In hepatocytes, REs are hydrolyzed, and unesterified retinol is associated with retinol-binding protein 4 (RBP4) for secretion (11Newcomer M.E. Ong D.E. Plasma retinol binding protein: structure and function of the prototypic lipocalin.Biochim. Biophys. Acta. 2000; 1482: 57-64Crossref PubMed Scopus (140) Google Scholar, 12Ronne H. Ocklind C. Wiman K. Rask L. Obrink B. Peterson P.A. Ligand-dependent regulation of intracellular protein transport: effect of vitamin a on the secretion of the retinol-binding protein.J. Cell Biol. 1983; 96: 907-910Crossref PubMed Scopus (84) Google Scholar) or transferred to hepatic stellate cells for storage (10Blomhoff R. Helgerud P. Rasmussen M. Berg T. Norum K.R. In vivo uptake of chylomicron.Proc. Natl. Acad. Sci. USA. 1982; 79: 7326-7330Crossref PubMed Google Scholar, 13Blomhoff R. Holte K. Naess L. Berg T. Newly administered [3H]retinol is transferred from hepatocytes to stellate cells in liver for storage.Exp. Cell Res. 1984; 150: 186-193Crossref PubMed Scopus (92) Google Scholar, 14Senoo H. Structure and function of hepatic stellate cells.Med. Electron Microsc. 2004; 37: 3-15Crossref PubMed Scopus (187) Google Scholar). These stellate cells store most of the total body vitamin A reserves (∼80%) in the form of retinyl palmitate in cytosolic lipid droplets (14Senoo H. Structure and function of hepatic stellate cells.Med. Electron Microsc. 2004; 37: 3-15Crossref PubMed Scopus (187) Google Scholar). According to the body's demand, stored retinoids are released from the liver to facilitate a constant supply. In the circulation, the biologically inactive retinol is transported bound to RPB4 and delivered to target tissues. There, retinol is converted into its biologically active metabolites 11-cis retinaldehyde and retinoic acids, which act as hν acceptor in the visual cycle and as ligand of nuclear receptors, respectively. The dynamic balance between synthesis and hydrolysis of RE determines the concentration of retinol in the circulation and also the availability of retinol for conversion in active metabolites in various cell types. Retinol is esterified by the action of acyl-CoA:retinol acyltransferase (ARAT) or lecithin:retinol acyltransferase (LRAT) for storage in lipid droplets. Much work has focused on the understanding of how REs are released from lipid droplets and which retinyl ester hydrolases (REHs) are involved in this process. A number of potential candidates for the hydrolysis of REs in the liver has been studied so far in more detail. For instance, bile salt-activated carboxyl ester lipase (CEL) (15Fredrikzon B. Hernell O. Blackberg L. Olivecrona T. Bile salt-stimulated lipase in human milk: evidence of activity in vivo and of a role in the digestion of milk retinol esters.Pediatr. Res. 1978; 12: 1048-1052Crossref PubMed Scopus (112) Google Scholar, 16Lombardo D. Guy O. Studies on the substrate specificity of a carboxyl ester hydrolase from human pancreatic juice. II. Action on cholesterol esters and lipid-soluble vitamin esters.Biochim. Biophys. Acta. 1980; 611: 147-155Crossref PubMed Scopus (167) Google Scholar) has been demonstrated to hydrolyze RE. However, CEL-deficient mice generated by targeted disruption of the CEL gene failed to show any effect on RE metabolism in the liver, on serum levels of retinol and RBP4, or on levels of retinoids in various tissues (17van Bennekum A.M. Li L. Piantedosi R. Shamir R. Vogel S. Fisher E.A. Blaner W.S. Harrison E.H. Carboxyl ester lipase overexpression in rat hepatoma cells and CEL deficiency in mice have no impact on hepatic uptake or metabolism of chylomicron-retinyl ester.Biochemistry. 1999; 38: 4150-4156Crossref PubMed Scopus (42) Google Scholar). Two distinct bile salt-independent REHs, one active at neutral (18Harrison E.H. Gad M.Z. Hydrolysis of retinyl palmitate by enzymes of rat pancreas and liver. Differentiation of bile salt-dependent and bile salt-independent, neutral retinyl ester hydrolases in rat liver.J. Biol. Chem. 1989; 264: 17142-17147Abstract Full Text PDF PubMed Google Scholar), the other at acid pH (19Gad M.Z. Harrison E.H. Neutral and acid retinyl ester hydrolases associated with rat liver microsomes: relationships to microsomal cholesteryl ester hydrolases.J. Lipid Res. 1991; 32: 685-693Abstract Full Text PDF PubMed Google Scholar), have been characterized in rat liver; in addition, three rat liver carboxyl esterases [Es2 (20Schindler R. Mentlein R. Feldheim W. Purification and characterization of retinyl ester hydrolase as a member of the non-specific carboxylesterase supergene family.Eur. J. Biochem. 1998; 251: 863-873Crossref PubMed Scopus (24) Google Scholar), Es4, and Es10 (21Mentlein R. Heymann E. Hydrolysis of retinyl esters by non-specific carboxylesterases from rat liver endoplasmic reticulum.Biochem. J. 1987; 245: 863-867Crossref PubMed Scopus (38) Google Scholar, 22Linke T. Dawson H. Harrison E.H. Isolation and characterization of a microsomal acid retinyl ester hydrolase.J. Biol. Chem. 2005; 280: 23287-23294Abstract Full Text Full Text PDF PubMed Scopus (27) Google Scholar)] exhibit REH activity in vitro. Beside their expression in liver, no convincing evidence has been reported that any of these enzymes may play a key role in the mobilization of REs. In this study, we compared the potency of several members of the mouse carboxyl esterase superfamily to hydrolyze REs. Among other enzymes, we identified esterase 22 (Es22) as a potent REH. Notably, expression of Es22 attenuated cellular RE accumulation, indicating that this enzyme affects retinol metabolism in living cells. The enzyme is highly expressed in liver cells and localizes to the endoplasmic reticulum (ER), suggesting that it counteracts the formation of RE by LRAT and ARAT. Es22 has been shown to interact with β-glucuronidase (Gus) at the ER (23Medda S. Swank R.T. Egasyn, a protein which determines the subcellular distribution of beta-glucuronidase, has esterase activity.J. Biol. Chem. 1985; 260: 15802-15808Abstract Full Text PDF PubMed Google Scholar). We found that Gus colocalizes with Es22 at the ER and is capable of hydrolyzing retinoyl β-glucuronide, a naturally occurring retinoid. In conclusion, our data indicate that both Es22 and Gus play a role in liver retinoid metabolism. All-trans-retinol, all-trans-retinyl-palmitate, and palmitic acid were from Sigma-Aldrich Chemie GmbH (Taufkirchen, Germany). All-trans-retinoyl β-glucuronide (RAG) was kindly provided by Prof. Arun B. Barua, Iowa State University, Ames, IA. pCRCU, a self-made yeast expression-vector containing a monomeric RFP sequence, was a kind gift from Julia Petschnigg, Kohlwein Laboratory, University of Graz, Graz, Austria. Retinyl [9,10(n)-3H] palmitate was prepared according to Boechzelt et al. (24Boechzelt H. Karten B. Abuja P.M. Sattler W. Mittelbach M. Synthesis of 9-oxononanoyl cholesterol by ozonization.J. Lipid Res. 1998; 39: 1503-1507Abstract Full Text Full Text PDF PubMed Google Scholar) using palmitic acid (2 mCi, 0.033 µmol, GE Healthcare, Piscataway, NJ) as radiolabel. All reagents were of per analysis grade. Adult male C57BL/6 mice between 12 and 16 weeks of age were used in this study. Mice were maintained on a regular light-dark cycle (14 h light, 10 h dark) and fed a standard laboratory chow diet (4.5% wt/wt fat). Total RNA was isolated from mouse tissue using the Trizol® Reagent procedure according to the manufacturer's instruction (Invitrogen™, Carlsbad, CA). Poly A+ RNA was isolated from liver total RNA using the Oligotex® mRNA Mini Kit from Qiagen GmbH (Hilden, Germany). Liver mRNA was transcribed into first-strand cDNA using SuperScript™ Reverse Transcriptase protocol from Invitrogen™. Second-strand cDNA was obtained from first-strand cDNA by addition of Escherichia coli DNA ligase buffer, E. coli DNA polymerase, E. coli DNA ligase (all chemicals from New England Biolabs, Inc., Beverly, MA), and deoxyribonucleotide triphosphates (Carl Roth GmbH and Co. KG, Karlsruhe, Germany) to the mixture and subsequent incubation at 16°C for 3 h. Thereafter, T4 DNA polymerase (New England Biolabs) was added and further incubated for 20 min to give blunt end cDNA. The coding sequences of various genes (see Table 1) were amplified by PCR from liver cDNA using Advantage® cDNA Polymerase Mix (BD Biosciences Clontech, Palo Alto, CA). Respective primers were designed to create 5′ and 3′ restriction endonuclease cleavage sites for in-frame ligation into expression vector pcDNA4/HisMax (Invitrogen™). A control pcDNA4/HisMax vector expressing β-galactosidase (LacZ) was provided by the manufacturer (Invitrogen™).TABLE 1List of cloned genesGI NumberAccession NumberIdentifierDescriptionPrimer Forward/Reverse117553603NM_053200Ces3Carboxylesterase 35′-GGAATTCCGCCTCTACCCTCTGATATGGC-3′5′-CCTCGAGTCAGAGCTCAACATGTTCCCTG-3′141802881NM_172759Ces5Carboxylesterase 55′-GGAATTCCCACTATACAAACTTCTTGGATGG-3′5′-CCTCGAGCTACAACTCTTTGTGCCTCTCCTG-3′10946841NM_021456Ces1Carboxylesterase 15′-GGAATTCTGGCTCTGTGCTTTGAGTCTGA-3′5′-CCTCGAGTCACAGTTCAACATGTTCCCTATG-3′21362300NM_144511EG13predicted gene, EG139095′-GGGTACCAGGACAATGATACCAGCTGGGT-3′5′-CCTCGAGTCAGAGCTCCTCTGGAACTTTCC-3′28279460BC046327ACEAcetylcholinesterase5′-GGAATTCAGGCCTCCCTGGTATCCCCT-3′5′-CTCTAGATCACAGGTCTGAGCAGCGCT-3′22122766NM_146213BC026cDNA seq. BC0263745′-GGAATTCAAGTGGATTCTGGGCTTGAGC-3′5′-CTCTAGACTAAGGTTTCTGAGATTGGCGA-3′20886282XM_146488sim Ces2similar to Ces 25′-GGAATTCAGACTGGAACAAATTCATGCTCG-3′5′-CCTCGAGCTACAACTCTTTATGTCTGTCCTCAAT-3′124487349NM_009738BcheButyrylcholinesterase5′-GGAATTCCAGACTCAGCATACCAAGGTAACA-3′5′-CCTCGAGTTAGAGAGCTGTACAGCTCTCTTTCTT-3′145301632NM_133660Es22Es22 (sim rat Es3)5′-GGAATTCTGCCTCTCTGCTCTGATCCTG-3′5′-CCTCGAGTCACAGCTCAGTGTGTTCTGTCG-3′21450338NM_144930TGH2TGH2 (sim rat Es4)5′-GAATTCTGGCTCTTTGCTCTGGC-3′5′-CTCGAGTCTCTGAGTGTCTCCCTTGGT-3′142348402NM_007954Es1Es1 (sim rat Es2)5′-GAATTCTGGCTCCATGCTCTGGTCT-3′5′-CTCGAGTTTGTGTTCTCTGTGCTCAGTAGG-3′146134463NM_016903Es10Esterase 105′-GGAATTCGCGCTCAAACAGATTTCCAGCAC-3′5′-CCTCGAGTCATGCATTCAGGTACTTAGCA-3′6754097NM_010368Gusβ-Glucuronidase5′-GGAATTCTCCCTAAAATGGAGTGCGTGT-3′5′-CTCGAGTTAGAACGTGAACGGTCTGCTT-3′ Open table in a new tab For generation of Es22-green fluorescent protein (GFP) and Gus-red fluorescent protein (RFP) fusion constructs full-length Es22 and Gus coding sequences were amplified using liver cDNA as template and respective primers: Es22_forward, 5′- ATCTCGAGCCACCATGTGCCTCTCTGCTCTGATCC-3′; Es22_reverse, 5′- TCGAATTCGCAGC-TCAGTGTGTTCTGTCGG-3′; Gus_forward, 5′-TCTCGAGCC-ACCATGTCCCTAAAATGGAGTGCGT-3′; Gus_reverse, 5′-CGAATTCGAACGTGAACG-GTCTGCTTCC-3′. RFP coding sequence was amplified from the pCRCU vector with the following primers: RFP_forward, CGAATTCGCCTCCTCCGAGGATGTCAT; RFP_reverse, GGATCCTTAGGCGCCGGTGGAGTG. The PCR mixture contained 1 µl cDNA or pTR-CU vector (10 ng/µl), 10 pmol primers, 10 nmol dNTPs, 1 U PhusionTM High-Fidelity DNA Polymerase (Finnzymes Oy, Espoo, Finland), and 6 µl PhusionTM high fidelity buffer in a total volume of 30 µl. The amplified Es22 and Gus coding sequences were digested with XhoI/EcoRI and ligated into respective sites of the pEGFP-N1 vector (Takara Bio Inc., Otsu, Japan). The amplified RFP coding sequence was digested with EcoR1/BamH1 and ligated into respective sites of the pEGFP-N1 vector already containing the Gus coding sequence. The resulting fusion constructs encoded GFP and RFP at the C terminus of Es22 (Es22-GFP) and Gus (Gus-RFP), respectively. Monkey embryonic kidney cells (COS-7, ATCC CRL-1651) were maintained in DMEM (Gibco® from Invitrogen™) containing 10% fetal calf serum (FCS) (Sigma-Aldrich Chemie GmbH) and antibiotics at 37°C in humidified air (89–91% saturation) and 5% CO2. The day before transfection, COS-7 cells were collected in logarithmic phase, seeded in 6-wells dishes at a density of 150,000 cells/well, and cultured overnight. Transient transfection of COS-7 cells with pcDNA4/HisMax encoding respective His-tagged recombinant proteins or as a control LacZ was performed with Metafectene™ (Biontex GmbH, Munich, Germany). One µg purified DNA (NucleoBond® AX, Macherey-Nagel GmbH and Co. KG, Düren, Germany) was mixed with 5 µl Metafectene™ in a total volume of 100 µl serum- and antibiotics-free DMEM and incubated for 20 min at room temperature to allow formation of the DNA/Metafectene™ complex. Then, 100 µl/well of the DNA/Metafectene™ mix was added to COS-7 cells and incubated for 4 h in serum and antibiotics-free DMEM. Thereafter, the medium was removed and cells were cultured in DMEM containing 10% FCS and antibiotics. Cells were analyzed two days after transfection. Cells were collected by trypsination and washed three times with PBS. Then, cells were disrupted on ice in buffer A (0.25 M sucrose, 1 mM EDTA, 1 mM dithiothreitol, 20 µg/ml leupeptine, 2 µg/ml antipain, 1 µg/ml pepstatin, pH 7.0) by sonication (Virsonic 475, Virtis, Gardiner, NJ). Nuclei and unbroken cells were removed by centrifugation at 1,000 g at 4°C for 5 min. For determination of REH activity of recombinant proteins, 100 µl of COS-7 cell lysates (=100 µg cell protein) containing recombinant proteins and 100 µl substrate was incubated in a water bath at 37°C for 60 min. The reaction was terminated by addition of 3.25 ml of methanol-chloroform-heptane (10/9/7, v/v/v) and 1 ml of 0.1 M potassium carbonate, 0.1 M boric acid, pH 10.5. After vigorous vortexing and centrifugation (800 g, 10 min), 1 ml of the upper aqueous phase was aspirated and radioactivity was determined by liquid scintillation counting (Tri-Carb 2100TR, Packard Instrument Co., Downers Grove, IL). Blank incubation was performed with 100 µl buffer A under identical conditions as for cell lysates. Counts obtained for blank incubation were used for background corrections. Substrate for REH assay contained 10 nmol retinyl palmitate/assay and retinyl [9,10(n)-3H]palmitate, 50,000 cpm/nmol as tracer) and was either emulsified in 100 mM potassium phosphate buffer pH 7.4, containing 90 µM phosphatidyl-choline/-inositole (PC:PI; 3:1) or 100 mM Tris/Maleate buffer pH 8.0, containing 40 mM cholate. Other lipid substrates were prepared in 100 mM Tris/Maleate buffer pH 8.0, containing 40 mM cholate and either 33 nmol triglyceride/assay (TG; glycerol tri[9,10(n)-3H]oleate, 40,000 cpm/nmol) or 20 nmol/assay of cholesteryl oleate (CE; cholesteryl [9,10(n)-3H]oleate, 50,000 cpm/nmol). All lipid substrates were prepared by sonication on ice (Virsonic 475, Virtis). In some cases, substrate was prepared using buffer systems and detergents as indicated in respective figure. Cell lysates containing recombinant Gus, Es22, or LacZ were incubated in 50 mM Tris/Maleate buffer pH 8.0, containing 25 µM RAG for 30 min at 37°C. Then, reaction was stopped by addition of methanol and RAGs were extracted using three different organic solvents (n-hexane, ethyl acetate, and chloroform). Extracts were combined and RAG content was determined by HPLC as described below. COS-7 cells were plated in 6-well plates and transfected with Es22 or LacZ as described above. After 48 h of incubation, the media was replaced with DMEM containing 10% FCS, antibiotics, 500 µM palmitic acid (10 mM, solubilized in sterile PBS, containing 50 mg defatted BSA/ml), and 100 µM all-trans-retinol (350 mM in ethanol). At various time points, cells were harvested by trypsination, washed three times with PBS, and subjected to determination of retinyl palmitate content by HPLC. All operations were carried out with precooled solvents; whenever possible, samples were placed on ice and protected from light. For the extraction of retinyl palmitate, 400 µl of COS-7 cells (2 mg cell protein/ml) suspended in buffer A were treated with 400 µl 100% methanol containing 0.1% butylated hydroxytoluene (BHT), 1 mM EDTA, and 800 µl water-washed n-hexane. Thereafter, the mixture was vortexed (15 s) and centrifuged at 2,000 g for 3 min. An aliquot of the supernatant (600 µl) was removed, dried down using a speedvac (Heto-Holten, Allered, Denmark), and resuspended in 100 µl of methanol. An aliquot of 20 µl was analyzed by HPLC. Extraction of RAG was performed according to the procedure as outlined by Barua et al. (25Barua A.B. Batres R.O. Olson J.A. Synthesis and metabolism of all-trans-[11–3H]retinyl beta-glucuronide in rats in vivo.Biochem. J. 1988; 252: 415-420Crossref PubMed Scopus (12) Google Scholar). Briefly, 200 µl of lysates were treated with 200 µl ethanol containing 0.1% BHT and 400 µl ethyl acetate. After vortexing (15 s) and centrifugation (2,000 g for 2 min), 200 µl of water was added and extraction was performed by vortexing and centrifugation as described. Then, the upper organic phase was saved and the aqueous phase was acidified with 5 µl of 10% glacial acetic acid in water. The aqueous phase was subsequently extracted with 200 µl ethyl acetate and then extracted with 200 µl n-hexane by vortexing and centrifugation as described above. All organic solvents were pooled and brought to dryness using a speedvac (Heto-Holten). The residue was dissolved in 100 µl methanol and 40 µl were analyzed by HPLC. Retinoids were separated on a reverse-phase Lichrospher® 125-4 5 µm C18 column (125 × 4 mm) preceded by a Superspher® RP-18 guard column (Merck, Darmstadt, Germany). For the separation of retinyl palmitate 100% methanol and for RAG methanol-water (7.5:2.5, v/v) containing 10 mM ammonium acetate was used isocratically as the eluant at a flow rate of 1.5 and 1 ml/min, respectively. The HPLC system used was System Gold® from Beckmann Coulter Inc. (Fullerton, CA), consisting of a 125 solvent module, a 508 autosampler, and a 168 diode-array detector. Detections of retinyl palmitate and RAG were performed at 325 nm and 350 nm, respectively. The areas under peaks were standardized against known amounts of reference compounds. For the determination of molar concentrations of reference compounds, the following molar extinction coefficients were used: all-trans-retinyl palmitate (ε325nm = 52,275 M−1cm−1) (26Ross A.C. Separation of long-chain fatty acid esters of retinol by high-performance liquid chromatography.Anal. Biochem. 1981; 115: 324-330Crossref PubMed Scopus (75) Google Scholar); RAG (E1cm, 1% = 1065 at 360 nm) (27Barua A.B. Batres R.O. Olson J.A. Characterization of retinyl beta-glucuronide in human blood.Am. J. Clin. Nutr. 1989; 50: 370-374Crossref PubMed Scopus (29) Google Scholar). Mice were anesthetized and the abdomen was surgically opened by a vertical incision. Then, the liver was perfused via the portal vein with Krebs-Henseleit buffer (without Ca2+ and SO42−) for 10 min followed by a perfusion with Krebs-Henseleit buffer containing 30 mg collagenase type II (0.2 mg/ml, Worthington Biochemical Corporation, Lakewood, NJ), 2% BSA, and 0.1 mM CaCl2 for 10–15 min. Thereafter, the liver was excised, disrupted, and the cell suspension passed through gauze, followed by filtration through a 70 µm cell strainer. Parenchymal cells were separated from nonparenchymal cells by centrifugation at 50 g for 3 min at 4°C. The remaining supernatant was used for the isolation of various nonparenchymal cell-types using OptiPrep™ self-forming density gradient solutions (Axis-Shield PoC AS, Rodeløkka, Norway) according to manufacturer's instructions. Briefly, nonparenchymal cell suspension was adjusted to a density of 24% iodixanol, overlaid with 17%, 11.5%, 8.4%, and 0% iodixanol in Krebs-Henseleit buffer containing 1.25 mM CaCl2 and 1.2 mM NaSO4. After centrifugation at 1,400 g for 20 min at 4°C, Kupffer and stellate cells were isolated at 11.5/8.4% and 8.4/0% iodixanol interphases, respectively. RNA of hepatocytes and Kupffer cells was isolated immediately or after cultivation of the cells overnight. RNA of stellate cells was obtained from freshly prepared cells or after cultivation for 7 days [selective detachment according to Trøen et al. (28Troen G. Nilsson A. Norum K.R. Blomhoff R. Characterization of liver stellate cell retinyl ester storage.Biochem. J. 1994; 300: 793-798Crossref PubMed Scopus (39) Google Scholar)]. Cell lysates for Western blotting analysis of different liver cells were washed twice with PBS after respective cultivation, scraped off, and disrupted as described for COS-7 cells. Total RNA was extracted from various mouse tissues or liver cell types using Trizol® Reagent (Invitrogen™), separated by formaldehyde/agarose gel electrophoresis and blotted onto a Hybond-N+ membrane (GE Healthcare) by vacuum blotting (Bio-Rad 785, BioRad Laboratories, Hercules, CA). The membrane was probed with [α-32P]dCTP-labeled cDNA specific for mouse Es22, Gus, or α-smooth muscle actin (α-SMA). The following probes were used: for Es22, the first 416 bp and for Gus, the first 606 bp of the coding region were obtained by restriction digestion using BamHI and HindIII, respectively; for α-SMA, the fragment between 66 and 638 bp of the coding sequence was amplified using following primers: forward, 5′-CTTCGCTGGTGATGATGCTC-3′; reverse, 5′-TCACGGACAATCTCACGCTC-3′), ligated into pCR2.1 vector (Invitrogen™) and isolated from the multiple cloning site of the vector. After hybridization and washing, signals were visualized by exposure to a PhosphorImager Screen (ApBiotech, Freiburg, Germany) and analyzed using ImageQuant Software (Molecular Dynamics). As a loading control, RNA separated by the formaldehyde/agarose gel was visualized with ethidium bromide staining. Cell lysates were solubilized in SDS-PAGE sample buffer and proteins separated on a 10% SDS-PAGE gel using the Laemmli discontinuous buffer system (29Laemmli U.K. Cleavage of structural proteins during the assembly of the head of bacteriophage T4.Nature. 1970; 227: 680-685Crossref PubMed Scopus (207002) Google Scholar). Then, proteins were transferred onto a polyvinylidene fluoride transfer membrane (Pall Life Sciences, Pensacola, FL). The membrane was blocked with 10% blotting grade milk powder (Carl Roth GmbH and Co. KG) in Tris/NaCl/Tween-20 (TBST) and incubated with mouse anti-keratin-18 monoclonal antibody (Progen, Heidelberg, Germany) at a dilution of 1:1,000 or rat anti-mouse MOMA-2 antibody (Acris antibodies, Hiddenhausen, Germany) at a dilution of 1:5,000. After washing with TBST, the membrane was incubated with horseradish peroxidase-conjugated sheep anti-mouse (GE Healthcare) antibody at a dilution of 1:10,000 and with horseradish peroxidase-conjugated rabbit anti-rat (Dako, Glostrup, Denmark) antibody at a dilution of 1:1,000. After washing with TBST, the membrane was developed with enhanced chemiluminescence (ECL plus, GE Healthcare) and exposed to X-ray film (Hyperfilm™ ECL, GE Healthcare). COS-7 cells were cultivated on 24 × 24 mm coverslips and transiently transfected with GFP-tagged Es22, RFP-tagged Gus, or both (for transfection see above). ER was stained with 4 µM ER Tracker RedTM for 15 min at 37°C. Lipid droplets were stained with 2 µM Bodipy® 558/568 C12 for 30 min at 37°C. After staining, cells were washed twice with PBS. For microscopy, coverslips with attached cells were mounted on standard microscope slides. Microscopy was performed using a Leica SP2 confocal microscope (Leica Microsystems, Mannheim, Germany) with spectral detection and a Leica 63× water immersion objective (HCX PL APO W Corr CS, 1.2 NA). GFP or RFP fluorescence was excited at 488 or 555 nm and detected in the range between 500 and 535 or 580 and 620, respectively. ER-Tracker RedTM fluorescence was excited at 543 nm and detected in the range from 600 to 650 nm. Bodipy® 558/568 C12 fluorescence was excited at 543 nm and detected in the range between 550 and 650 nm. Fluorescence emissions of GFP and RFP or ER Tracker RedTM or Bodipy® 558/568 C12 were detected simultaneously as indicated in the legend to Fig. 7. Protein concentrations of cell lysates were determined with Bio-Rad protein assay according to manufacturer's instructions (Bio-Rad Laboratories) using BSA as standard. All data are expressed as means ± SD. Statistical significance was determined by the Student's unpaired t-test (two-tailed). Group differences were considered significant for P < 0.05 (*), P < 0.01 (**), and P < 0.001 (***). Some of the most promising enzymes thought to be involved in the hydrolysis of RE in the liver belong to the group of the carboxyl esterase super family (30Harrison E.H. Lipases and carboxylesterases: possible roles in the hepatic utilization of vitamin A.J. Nutr. 2000; 130: 340S-344SCrossref PubMed Google Scholar). To compare REH activities" @default.
• W2103246476 created "2016-06-24" @default.
• W2103246476 creator A5004082611 @default.
• W2103246476 creator A5019089024 @default.
• W2103246476 creator A5022724621 @default.
• W2103246476 creator A5023780626 @default.
• W2103246476 creator A5024468952 @default.
• W2103246476 creator A5043939479 @default.
• W2103246476 creator A5048457362 @default.
• W2103246476 creator A5051973789 @default.
• W2103246476 creator A5059628600 @default.
• W2103246476 creator A5060008904 @default.
• W2103246476 creator A5069470083 @default.
• W2103246476 date "2009-12-01" @default.
• W2103246476 modified "2023-09-23" @default.
• W2103246476 title "Esterase 22 and beta-glucuronidase hydrolyze retinoids in mouse liver" @default.
• W2103246476 cites W1481693599 @default.
• W2103246476 cites W1496181311 @default.
• W2103246476 cites W1498916993 @default.
• W2103246476 cites W1516813434 @default.
• W2103246476 cites W1523566174 @default.
• W2103246476 cites W1538999917 @default.
• W2103246476 cites W1554299549 @default.
• W2103246476 cites W1582548942 @default.
• W2103246476 cites W1607460173 @default.
• W2103246476 cites W1816195753 @default.
• W2103246476 cites W1838818166 @default.
• W2103246476 cites W1879810571 @default.
• W2103246476 cites W1964079339 @default.
• W2103246476 cites W1970045941 @default.
• W2103246476 cites W1976823132 @default.
• W2103246476 cites W1986881140 @default.
• W2103246476 cites W1996152936 @default.
• W2103246476 cites W1996304093 @default.
• W2103246476 cites W2000863347 @default.
• W2103246476 cites W2008012593 @default.
• W2103246476 cites W2011500602 @default.
• W2103246476 cites W2017829159 @default.
• W2103246476 cites W2029264122 @default.
• W2103246476 cites W2033823655 @default.
• W2103246476 cites W2040497188 @default.
• W2103246476 cites W2073304593 @default.
• W2103246476 cites W2076045216 @default.
• W2103246476 cites W2076633759 @default.
• W2103246476 cites W2079437558 @default.
• W2103246476 cites W2085284028 @default.
• W2103246476 cites W2100837269 @default.
• W2103246476 cites W2108593963 @default.
• W2103246476 cites W2117219849 @default.
• W2103246476 cites W2145951364 @default.
• W2103246476 cites W2159156987 @default.
• W2103246476 cites W2166574921 @default.
• W2103246476 cites W2185209908 @default.
• W2103246476 cites W2254919660 @default.
• W2103246476 cites W2281582363 @default.
• W2103246476 cites W2337872855 @default.
• W2103246476 cites W4250574476 @default.
• W2103246476 cites W86567406 @default.
• W2103246476 cites W995886229 @default.
• W2103246476 doi "https://doi.org/10.1194/jlr.m000950" @default.
• W2103246476 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/2781322" @default.
• W2103246476 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/19723663" @default.
• W2103246476 hasPublicationYear "2009" @default.
• W2103246476 type Work @default.
• W2103246476 sameAs 2103246476 @default.
• W2103246476 citedByCount "27" @default.
• W2103246476 countsByYear W21032464762012 @default.
• W2103246476 countsByYear W21032464762013 @default.
• W2103246476 countsByYear W21032464762015 @default.
• W2103246476 countsByYear W21032464762016 @default.
• W2103246476 countsByYear W21032464762017 @default.
• W2103246476 countsByYear W21032464762019 @default.
• W2103246476 countsByYear W21032464762020 @default.
• W2103246476 countsByYear W21032464762021 @default.
• W2103246476 countsByYear W21032464762022 @default.
• W2103246476 countsByYear W21032464762023 @default.
• W2103246476 crossrefType "journal-article" @default.
• W2103246476 hasAuthorship W2103246476A5004082611 @default.
• W2103246476 hasAuthorship W2103246476A5019089024 @default.
• W2103246476 hasAuthorship W2103246476A5022724621 @default.
• W2103246476 hasAuthorship W2103246476A5023780626 @default.
• W2103246476 hasAuthorship W2103246476A5024468952 @default.
• W2103246476 hasAuthorship W2103246476A5043939479 @default.
• W2103246476 hasAuthorship W2103246476A5048457362 @default.
• W2103246476 hasAuthorship W2103246476A5051973789 @default.
• W2103246476 hasAuthorship W2103246476A5059628600 @default.
• W2103246476 hasAuthorship W2103246476A5060008904 @default.
• W2103246476 hasAuthorship W2103246476A5069470083 @default.
• W2103246476 hasBestOaLocation W21032464761 @default.
• W2103246476 hasConcept C104317684 @default.
• W2103246476 hasConcept C150194340 @default.
• W2103246476 hasConcept C181199279 @default.
• W2103246476 hasConcept C185592680 @default.
• W2103246476 hasConcept C2777261171 @default.
• W2103246476 hasConcept C2777322866 @default.
• W2103246476 hasConcept C2779181561 @default.
• W2103246476 hasConcept C55493867 @default.
• W2103246476 hasConcept C94412978 @default.

• next