FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2106216001> ?p ?o ?g. }

• W2106216001 endingPage "34516" @default.
• W2106216001 startingPage "34505" @default.
• W2106216001 abstract "Cloned soybean sterol methyltransferase was purified from Escherichia coli to gel electrophoretic homogeneity. From initial velocity experiments, catalytic constants for substrates best suited for the first and second C1 transfer activities, cycloartenol and 24(28)-methylenelophenol, were 0.01 and 0.001 s–1, respectively. Two-substrate kinetic analysis using cycloartenol and S-adenosyl-l-methionine (AdoMet) generated an intersecting line pattern characteristic of a ternary complex kinetic mechanism. The high energy intermediate analog 25-azacycloartanol was a noncompetitive inhibitor versus cycloartenol and an uncompetitive inhibitor versus AdoMet. The dead end inhibitor analog cyclolaudenol was competitive versus cycloartenol and uncompetitive versus AdoMet. 24(28)-Methylenecycloartanol and AdoHcy generated competitive and noncompetitive kinetic patterns, respectively, with respect to AdoMet. Therefore, 24(28)-methylenecycloartanol combines with the same enzyme form as does cycloartenol and must be released from the enzyme before AdoHcy. 25-Azacycloartanol inhibited the first and second C1 transfer activities with about equal efficacy (Ki = 45 nm), suggesting that the successive C-methylation of the Δ24 bond occurs at the same active center. Comparison of the initial velocity data using AdoMet versus [2H3-methyl]AdoMet as substrates tested against saturating amounts of cycloartenol indicated an isotope effect on V CH3/V CD3 close to unity. [25-2H]24(28)-Methylenecycloartanol, [28E-2H]24 (28)-methylenelanosterol, and [28Z-2H]24(28)-methylene lanosterol were prepared and paired with AdoMet or [methyl-3H3]AdoMet to examine the kinetic isotope effects attending the C-28 deprotonation in the enzymatic synthesis of 24-ethyl(idene) sterols. The stereochemical features as well as the observation of isotopically sensitive branching during the second C-methylation suggests that the two methylation steps can proceed by a change in chemical mechanism resulting from differences in sterol structure, concerted versus carbocation; the kinetic mechanism remains the same during the consecutive methylation of the Δ24 bond. Cloned soybean sterol methyltransferase was purified from Escherichia coli to gel electrophoretic homogeneity. From initial velocity experiments, catalytic constants for substrates best suited for the first and second C1 transfer activities, cycloartenol and 24(28)-methylenelophenol, were 0.01 and 0.001 s–1, respectively. Two-substrate kinetic analysis using cycloartenol and S-adenosyl-l-methionine (AdoMet) generated an intersecting line pattern characteristic of a ternary complex kinetic mechanism. The high energy intermediate analog 25-azacycloartanol was a noncompetitive inhibitor versus cycloartenol and an uncompetitive inhibitor versus AdoMet. The dead end inhibitor analog cyclolaudenol was competitive versus cycloartenol and uncompetitive versus AdoMet. 24(28)-Methylenecycloartanol and AdoHcy generated competitive and noncompetitive kinetic patterns, respectively, with respect to AdoMet. Therefore, 24(28)-methylenecycloartanol combines with the same enzyme form as does cycloartenol and must be released from the enzyme before AdoHcy. 25-Azacycloartanol inhibited the first and second C1 transfer activities with about equal efficacy (Ki = 45 nm), suggesting that the successive C-methylation of the Δ24 bond occurs at the same active center. Comparison of the initial velocity data using AdoMet versus [2H3-methyl]AdoMet as substrates tested against saturating amounts of cycloartenol indicated an isotope effect on V CH3/V CD3 close to unity. [25-2H]24(28)-Methylenecycloartanol, [28E-2H]24 (28)-methylenelanosterol, and [28Z-2H]24(28)-methylene lanosterol were prepared and paired with AdoMet or [methyl-3H3]AdoMet to examine the kinetic isotope effects attending the C-28 deprotonation in the enzymatic synthesis of 24-ethyl(idene) sterols. The stereochemical features as well as the observation of isotopically sensitive branching during the second C-methylation suggests that the two methylation steps can proceed by a change in chemical mechanism resulting from differences in sterol structure, concerted versus carbocation; the kinetic mechanism remains the same during the consecutive methylation of the Δ24 bond. Sterol methyltransferases (SMTs) 1The abbreviations used are: SMT, sterol methyltransferase (EC 2.1.1.41); AdoMet, S-adenosyl-l-methionine; AdoHcy, S-adenosylhomocysteine; phytosterol, 24-alkyl(idene) sterol; HEI, high energy intermediate; GC, gas chromatography; MS, mass spectrometry; MALDI-TOF, matrix-assisted laser desorption ionization time-of-flight; FPLC, fast protein liquid chromatography; HPLC, high pressure liquid chromatography; KIE, kinetic isotope effect. are ubiquitously represented in plants and fungi (1Nes W.D. Biochim. Biophys. Acta. 2000; 1529: 63-88Crossref PubMed Scopus (112) Google Scholar). Together, these enzymes generate 24-alkyl sterol diversity, which includes formation of singly and doubly C-24-alkylated sterol side chains and olefin variants possessing Δ24(28), Δ23(24), and Δ25(27) side chains (2Goad L.J. Lenton J.R. Knapp F.F. Goodwin T.W. Lipids. 1974; 9: 582-594Crossref PubMed Scopus (87) Google Scholar). In most organisms, SMTs catalyze the first committed step in the biosynthesis of phytosterols (3Nes W.D. Venkatramesh M. Crit. Rev. Biochem. Mol. Biol. 1999; 3: 81-93Crossref Scopus (26) Google Scholar, 4Chappell J. Wolf F. Proulx J. Cuellar R. Saunders C. Plant Physiol. 1995; 109: 1337-1343Crossref PubMed Scopus (244) Google Scholar) (Fig. 1). The crucial role of these enzymes to generate an essential physiological group in sterol structure has stimulated considerable interest in the stereochemistry and mechanism of the C-methylation reaction (5Nes W.R. Sekula B.C. Nes W.D. Adler J.H. J. Biol. Chem. 1978; 253: 6218-6225Abstract Full Text PDF PubMed Google Scholar, 6Bloch K.E. CRC Crit. Rev. Biochem. 1983; 14: 47-92Crossref PubMed Scopus (528) Google Scholar). Several SMTs have been characterized at the molecular level, and their amino acid compositions reveal a highly conserved signature motif that represents the sterol-binding site (7Nes W.D. Marshall J.A. Jia Z. Jaradat T.T Song Z. Jayasimha P. J. Biol. Chem. 2002; 277: 42549-42556Abstract Full Text Full Text PDF PubMed Scopus (38) Google Scholar, 8Nes, W. D. (2003) Phytochemistry, in pressGoogle Scholar). A number of these enzymes have been characterized, and they share similar native molecular masses in the range of 160–175 kDa and similar properties (1Nes W.D. Biochim. Biophys. Acta. 2000; 1529: 63-88Crossref PubMed Scopus (112) Google Scholar). The methyl transfer reaction catalyzed by SMT is proposed to proceed through a nucleophilic attack by the π electrons of the Δ24 double bond on the S-methyl group of AdoMet (9Moore J.T. Gaylor J.L. J. Biol. Chem. 1970; 245: 4684-4688Abstract Full Text PDF PubMed Google Scholar, 10Venkatramesh M. Guo D. Jia Z. Nes W.D. Biochim. Biophys. Acta. 1996; 1299: 313-324Crossref PubMed Scopus (58) Google Scholar, 11Arigoni D. Ciba Found. Symp. 1978; 60: 243-258Google Scholar). The reaction can lead to the formation of a high energy intermediate (HEI) possessing a methyl at C-24 and a carbonium ion at C-25. After a hydride transfer from C-24 to C-25, an elimination of a proton at C-28 occurs, giving a 24(28)-methylene sterol. The steric course of the reaction has been hypothesized to proceed by an “X-group” (covalent), carbocation, or concerted mechanism (Scheme 1) (8Nes, W. D. (2003) Phytochemistry, in pressGoogle Scholar). As recognized in the steric-electric plug model and X-group mechanism, the conformation of the bound sterol side chain can influence the configuration of the enzyme-generated product at C-24 and C-25 (Scheme 1A) (8Nes, W. D. (2003) Phytochemistry, in pressGoogle Scholar).Scheme 1Hypothetical C-methylation pathway. A, steric-electric plug model; B, X-group mechanism, where X is proposed to be an acidic amino acid; C, carbonium ion mechanism. Nu, cycloartenol nucleus. In each case, the isotopically labeled substrate contains a 13C-26 atom.View Large Image Figure ViewerDownload Hi-res image Download (PPT) Recent work on the stereochemistry of phytosterol (24-alkyl sterols) side chain carbon atoms harboring chemically or biosynthetically introduced 13C label showed that the natural configuration for C-26 and C-27 of ergosterol and sitosterol (C-25 S; 2) is opposite to that considered in the X-group and carbonium ion mechanisms (C-25 R; 2a) (11Arigoni D. Ciba Found. Symp. 1978; 60: 243-258Google Scholar, 12Guo D. Jia Z. Nes W.D. J. Amer. Chem. Soc. 1996; 118: 8507-8508Crossref Scopus (25) Google Scholar, 13Zhou W. Guo D. Nes W.D. Tetrahedron Lett. 1996; 37: 1339-1442Crossref Scopus (24) Google Scholar) and therefore suggested a general catalytic mechanism for sterol C-methylation. Early kinetic studies carried out with microsomal preparations or detergent-solubilized enzyme preparations ruled out a Ping Pong (covalent) mechanism and supported either a concerted or carbocation mechanism for catalysis (9Moore J.T. Gaylor J.L. J. Biol. Chem. 1970; 245: 4684-4688Abstract Full Text PDF PubMed Google Scholar, 10Venkatramesh M. Guo D. Jia Z. Nes W.D. Biochim. Biophys. Acta. 1996; 1299: 313-324Crossref PubMed Scopus (58) Google Scholar). Support for the carbocation mechanism was considered to result from the intermediacy of HEIs in sterol C-methylation catalysis, whereby mimics of the transition state species were effective inhibitors of plant and fungal SMT activity (1Nes W.D. Biochim. Biophys. Acta. 2000; 1529: 63-88Crossref PubMed Scopus (112) Google Scholar). However, the carbocation mechanism was recently eliminated as a possible route in ergosterol synthesis (operating the first C1 transfer reaction) by work on the stereochemistry of the fungal enzyme-mediated CH3 to CH2 reaction and the stereochemistry at C-25 resulting from the 1,2-hydride shift reaction (11Arigoni D. Ciba Found. Symp. 1978; 60: 243-258Google Scholar, 12Guo D. Jia Z. Nes W.D. J. Amer. Chem. Soc. 1996; 118: 8507-8508Crossref Scopus (25) Google Scholar, 13Zhou W. Guo D. Nes W.D. Tetrahedron Lett. 1996; 37: 1339-1442Crossref Scopus (24) Google Scholar). According to these stereochemical experiments, C-methylation of zymosterol (cholesta-8,24-dienol; native substrate) by yeast SMT is to occur via a noncovalent pathway whereby methyl addition to Δ24 and deprotonation of C-28 give rise to a nucleophilic rearrangement in which H-24 migrates to C-25 on the re-face of the substrate double bond in concert with the initial ionization. Previous investigators attempted to characterize the chemical and kinetic mechanism of the first and second C1 transfer reactions catalyzed by plant SMTs by studying each individually (14Rahier A. Taton M. Bouvier-Nave P. Schmitt P. Benveniste P. Schuber F. Narula A.S. Cattel L. Anding C. Place P. Lipids. 1986; 21: 51-62Crossref Scopus (67) Google Scholar) (Scheme 1). Thus, differences in pathway sequencing, substrate specificity, inhibitor recognition, and primary structures of the enzyme from different organisms have been interpreted as indicating that two classes of SMTs, SMT1 and SMT2, are responsible for the creation of two types of methylated species (14Rahier A. Taton M. Bouvier-Nave P. Schmitt P. Benveniste P. Schuber F. Narula A.S. Cattel L. Anding C. Place P. Lipids. 1986; 21: 51-62Crossref Scopus (67) Google Scholar, 15Shi J. Gonzales R.A. Bhattacharyya M.K. J. Biol. Chem. 1996; 271: 9384-9389Abstract Full Text Full Text PDF PubMed Scopus (61) Google Scholar, 16Bouvier-Nave P. Husselstein T. Desprez T. Benveniste P. Eur. J. Biochem. 1997; 246: 518-529Crossref PubMed Scopus (56) Google Scholar, 17Bouvier-Nave P. Husselstein T. Benveniste P. Eur. J. Biochem. 1998; 256: 88-96Crossref PubMed Scopus (75) Google Scholar, 18Grebenok R.J. Gailbraith D.W. Penna D.D. Plant Mol. Biol. 1997; 34: 891-896Crossref PubMed Scopus (32) Google Scholar). One enzyme activity, SMT1, exhibits a marked preference for position-specific Δ24(25)-olefins monomethylating to form Δ24(28)-sterols in plants and fungi. The second activity, SMT2, was initially described as a 24(28)-methylenelophenol methyltransferase from plants (14Rahier A. Taton M. Bouvier-Nave P. Schmitt P. Benveniste P. Schuber F. Narula A.S. Cattel L. Anding C. Place P. Lipids. 1986; 21: 51-62Crossref Scopus (67) Google Scholar), although it is now known to exist in fungi, where it is much more efficient for substrates such as 24(28)-methylenelanosterol (19Kaneshiro E.S. Rosenfeld J.A. Basselin-Eiweda M. Stringer J.R. Keely S.C. Smulian A.G. Giner J-L. Mol. Microbiol. 2002; 44: 989-999Crossref PubMed Scopus (32) Google Scholar). SMT2 is considered to monomethylate the product of the first C1 transfer reaction, forming Δ24(28) Z-ethylidene sterols exclusively. Nes et al. (20Nes W.D. McCourt B.S. Zhou W. Ma J. Marshall J.A. Peek L-A. Brennan M. Arch. Biochem. Biophys. 1998; 353: 297-311Crossref PubMed Scopus (45) Google Scholar) purified the yeast SMT to homogeneity in 1998 and generated a mutant by site-directed mutagenesis, making it clear that both methyl transfer reactions involving Δ24(25)- and Δ24(28)-sterols can be catalyzed by a single enzyme and that the second C1 transfer activity can result from the same active site as the first C1 transfer activity to give multiple products. However, as of yet, the overall catalytic action of a plant SMT has not been established. The recent cloning of a fusion SMT from soybean (15Shi J. Gonzales R.A. Bhattacharyya M.K. J. Biol. Chem. 1996; 271: 9384-9389Abstract Full Text Full Text PDF PubMed Scopus (61) Google Scholar) and our efforts to prepare a range of sterol substrates from natural sources or through synthesis has made it possible to generate large amounts of native protein for purification and detailed kinetic analysis. We now describe a systematic approach to determine the overall mechanism of SMT catalysis for a plant SMT, which necessitated experiments to establish a stereochemical correlation between the products of the first and second C1 transfer activities and the predicted high energy intermediate of the reaction. In addition, the steady-state kinetic parameters derived for substrates and inhibitors have been compared in order to reveal topological relations as directed in the steric-electric plug model for SMT action (Scheme 1). Material—The sources of reagents, authentic substrates, and sterol analogs isolated from nature or prepared synthetically, [24-2H]cycloartenol (94% atom enrichment), [3-3H]cycloartenol (116 μCi/μmol), [methyl-3H3]AdoMet (20 μCi/μmol in the activity assay), [methyl-2H3]AdoMet (99% atom enrichment), and chromatographic materials were as described in our preceding papers (10Venkatramesh M. Guo D. Jia Z. Nes W.D. Biochim. Biophys. Acta. 1996; 1299: 313-324Crossref PubMed Scopus (58) Google Scholar, 13Zhou W. Guo D. Nes W.D. Tetrahedron Lett. 1996; 37: 1339-1442Crossref Scopus (24) Google Scholar, 21Guo D. Jia Z. Nes W.D. Tetrahedron Lett. 1996; 37: 6823-6826Crossref Scopus (15) Google Scholar). [3-3H]24(28)Methylenecycloartanol (89 μCi/μmol) was prepared from [3-3H]cycloartenol, and [25-2H]24 (28)-methylenecycloartanol was prepared from [24-2H]cycloartenol using the soybean SMT assay system. [28E-2H]24(28)-methylenecycloartanol and [28Z-2H]24(28)-methylenecycloartanol (95% atom enrichment) was prepared according to Arigoni with modifications as specified (11Arigoni D. Ciba Found. Symp. 1978; 60: 243-258Google Scholar, 22Okuzumi T. Kaji Y. Hamada H. Fujomoto Y. Tetrahedron Lett. 2000; 41: 3623-3626Crossref Scopus (8) Google Scholar). Purity and identification of all sterol compounds assayed with the soybean SMT (>99%) were established after HPLC and/or analysis by GC/MS and 1H NMR (500 MHz) as described (23Guo D. Venkatramesh V. Nes W.D. Lipids. 1995; 30: 203-219Crossref PubMed Scopus (114) Google Scholar). Construction of Native SMT—The cDNA encoding soybean SMT (provided by the Noble Foundation) (15Shi J. Gonzales R.A. Bhattacharyya M.K. J. Biol. Chem. 1996; 271: 9384-9389Abstract Full Text Full Text PDF PubMed Scopus (61) Google Scholar) was contained in the plasmid pSERT carrying a FLAG epitope-tagged SMT1 cDNA that generates a fusion protein. The entire open reading frame of the DNA encoding soybean SMT was transferred to a T7-based high level expression system, pET23a, and the resulting construct was transformed into BL21 cells for protein expression. The original cDNA was used for PCR amplification using Taq DNA polymerase (Stratagene) with the forward primer GGAATTCCATATGCAAAAAAAAAAAAAAAATCGAAAC, which substituted the 5′ terminus of pSERT and installed an NdeI restriction site at the starting methionine, in conjunction with the reverse primer, CGCGGATCCTTAGTTCCTGTCTAAATCAGGC, which introduced a BamHI restriction site following the stop codon to give the native form of the protein. The resulting amplicons were modified to include NdeI and BamHI (sticky ends) overhangs and ligated into TA cloning vector PCR2.1 (Invitrogen) to yield the corresponding vector, SMT/PCR2.1. This construct together with pET23a was doubly digested with NdeI and BamHI. The liberated SMT gene was then ligated into pET23a using the NdeI and BamHI overhangs generated during digestion. The resulting ligation mixture was transformed into BL21(DE3)-competent E. coli cells by heat shock (20Nes W.D. McCourt B.S. Zhou W. Ma J. Marshall J.A. Peek L-A. Brennan M. Arch. Biochem. Biophys. 1998; 353: 297-311Crossref PubMed Scopus (45) Google Scholar). Sequencing confirmed that no errors had been introduced by the polymerase reactions (dideoxy terminator sequencing ABI 373 sequencer). cDNA Expression and Enzyme Purification—A frozen stock of the BL21(DE3) strain harboring the soybean SMT cDNA provided single colonies to inoculate 250 ml of Luria-Bertani medium containing ampicillin (50 μg/ml) and grown for 10 h at 30 °C in a floor shaker. The culture was used to inoculate 4 liters of Luria Broth divided into four Erlenmeyer flasks containing the same antibiotic. When A 600 of the suspended culture reached ∼0.5, isopropyl-1-thio-β-d-galactopyranoside was added to a final concentration of 0.4 ml, and the culture was incubated further at 30 °C for 2 h with moderate shaking (200 rpm) to induce SMT expression. The cells were pelleted by centrifugation (4 °C, 10,000 x g, 10 min), and the cell paste was snap frozen with liquid nitrogen and stored at –80 °C or used directly. A portion of the cell paste (5 g) was resuspended in 30 ml of buffer A (50 ml Tris-HCl, 2 ml MgCl2, 2 ml β-mercaptoethanol, 1 ml EDTA, and 5% glycerol (v/v) at pH 8.5), and the suspension was lysed by passage through a French pressure cell at 20,000 p.s.i. Insoluble protein and cell debris were removed by centrifugation (4 °C, 100,000 × g, 1 h), and the supernatant (25 ml) was used for enzyme assay or as a source of SMT for further purification. All procedures were carried out at 4 °C. In order to reduce contaminants, the 100,000 × g supernatant was applied to a column of Q-Sepharose (∼20 nmol of SMT to a 20-ml column volume) pre-equilibrated with buffer A. To the first 25 ml of eluant was added 0.4% emulphogen, and the sample was stirred on ice for 30 min. The material was loaded onto a Q-Sepharose column containing buffer A and emulphogen detergent (to a final concentration of 0.4%). The column was developed with a stepwise gradient from 100 to 300 ml NaCl in buffer A and detergent (0.4%). Each of five fractions (30 ml/15 min) was monitored for SMT activity and by SDS-PAGE gel electrophoresis as described by Laemmli in a 12% polyacrylamide vertical slab preceded by 4% polyacrylamide stacking gel. Gels were stained with 2% (w/v) Coomassie Brilliant Blue 250R in methanol/acetic acid/water (45:10: 45). Protein content during the purification was estimated by the method of Bradford (24Bradford M.M. Anal. Biochem. 1976; 72: 248-254Crossref PubMed Scopus (217544) Google Scholar) referenced to bovine serum albumin. Fractions corresponding to 150 ml salt containing SMT activity were combined, desalted by washing with fresh buffer A (15 × 5 ml), and concentrated (Amicon ultrafiltration YM-10 membrane) to a final volume of 10 ml. The average yield to this point was about 16 mg of total protein. The solution from Q-Sepharose was loaded onto an Amersham Biosciences Mono Q™ HR 10/10 column that was previously equilibrated with buffer A containing 0.4% emulphogen. The column was eluted with a 150-ml stepwise gradient from 50 to 300 ml NaCl in the same buffer while monitoring the effluent as before. A set of fractions (2 ml each) in the 150 ml NaCl possessed a homogenous protein by SDS-PAGE (single ∼41-kDa band). The concentration of SMT at the 90% or greater purity level was 0.3 mg/ml. In some preparations, a doublet was found to chromatograph in SDS-PAGE at the 36–41-kDa range. The two species were electroeluted from the gel and Edman-sequenced. The lower band was found to possess a sequence identical to the top band except lacking in the first 56 amino acids, suggesting it to be a translational truncation product or partially proteolyzed form resulting from expression in the E. coli host. To generate a pure SMT species, the set of fractions corresponding to SMT activity eluting between fractions 16 and 30 were combined and loaded onto the FPLC again. Fractions (numbers 18–22) corresponding to the center of the activity/mass peak were found to be pure by SDS-PAGE. These fractions were then used for k cat, molecular weight, and amino acid composition determinations. A second determination of the molecular mass of the pure protein was determined commercially by MALDI-TOF (Scripps Research Institute), giving a mass for the monomer of 41,597 Da. For a precise determination of protein concentration to establish the k cat value, the A 280 was measured using an extinction coefficient of 50,010 m–1 cm–1. Native molecular weight of pure protein from FPLC was determined by gel permeation chromatography. A 0.5-ml sample of the 100,000 × g supernatant in 0.4% emulphogen was loaded onto a calibrated (Bio-Rad reference standards from 1.67 to 670 kDa) Sephacryl S-300 gel filtration column coupled to an FPLC system eluted at a flow rate of 0.5 ml/min. Activity assays were performed on each fraction during the run from 10 to 300 min. A single peak of activity was observed between fractions 135 to 140, which corresponded to a molecular mass of ∼161 kDa. SMT Assays and Product Detection—The standard assay for recombinant SMT activity was performed in 600 μl of total volume, 5–15 μg of pure SMT, or 1–2 mg of total protein in buffer B (50 ml Tris buffer, 2 ml MgCl2, 2 ml 2-mercaptoethanol, and 20% (v/v) glycerol, pH 7.5), 50 μl sterol substrate, 50 μl [methyl-3H3]AdoMet at 0.6 μCi, and Tween 80 (1%, v/v) to produce 104 to 106 dpm of product in 45 min at 35 °C. The incubation mixture was terminated with 500 μl of a solution of 10% methanolic KOH. The methylated sterol product was extracted three times with 2.5 ml each in hexane (Fisher) and mixed on a vortex mixer for 30 s. The resulting organic layer was then transferred to a 7-ml scintillation vial, and the sample was taken for liquid scintillation counting to determine conversion rate (20Nes W.D. McCourt B.S. Zhou W. Ma J. Marshall J.A. Peek L-A. Brennan M. Arch. Biochem. Biophys. 1998; 353: 297-311Crossref PubMed Scopus (45) Google Scholar). For kinetic analysis, standard assays were performed at 10 substrate concentrations from 5 to 200 μl sterol with the AdoMet concentration held at saturation of 50 μl. The Km and V max for AdoMet were determined from 5 to 200 μl with sterol concentration held at 50 μl. From the variation of reaction velocity with substrate concentration according to Michaelis-Menten kinetics, an apparent saturation of either substrate approached 50 μl (data not shown). Random variations in measured velocities did not exceed ±10%. Reactions up to 3 h were linear with protein concentration up to 2 mg/ml and were carried out such that there was about 70% conversion of substrate using the standard assay at saturating concentrations of cycloartenol and AdoMet. The enzyme preparations were free of contaminating sterol, which can be a problem when 100,000 × g preparations are developed from plant tissues. The initial velocity data were determined using the computer program Sigmaplot 2001 plus the enzyme kinetics module software package. Data were fitted to the equation, ν=Vmax*S/(Km+S)(Eq. 1) using a nonlinear least-squares approach, and the kinetic constants ± S.E. were never greater than 5% of the experimental measurement, and R 2 values were between 0.95 and 0.97. The product distribution generated by the SMT was determined at saturating levels of substrate and with sufficiently large preparations (5 mg/ml of protein) to ensure accuracy by GC/MS peak integration by the total ion current chromatogram (25Nes W.D. McCourt B.S. Marshall J.A. Dennis A.L. Lopez M. Le H. J. Org. Chem. 1999; 64: 1535-1542Crossref PubMed Scopus (37) Google Scholar). An estimate of the conversion of stable isotope-labeled substrates was obtained by summing the relevant ion intensities, followed by background correction, relative to those of the corresponding nonisotopically labeled enzyme-generated product in parallel experiments; isotopic abundance was calculated from the molecular ion(s) following background correction. The back reaction to establish the equilibrium for the C-methylation reaction was performed with 5 mg/ml protein of partially pure SMT derived from the Q-Sepharose column fractions. The analysis was performed by standard assay, except saturating concentrations of [3-3H]24(28)-methylenecyloartanol and AdoHcy were added to the reaction mixture for overnight incubation. The resulting tritiated sample was isotopically diluted with 25 μg of cycloartenol, and the sterol composition was examined by HPLC-radiocounting (26Nes W.D. Janssen G.G. Bergenstrahle A. J. Biol. Chem. 1991; 266: 15202-15212Abstract Full Text PDF PubMed Google Scholar). Binding constants for the SMT were determined using equilibrium dialysis and the filter-binding method. Tritiated ligand, sterol or AdoMet, was assayed with pure soybean SMT by a standard protocol (7Nes W.D. Marshall J.A. Jia Z. Jaradat T.T Song Z. Jayasimha P. J. Biol. Chem. 2002; 277: 42549-42556Abstract Full Text Full Text PDF PubMed Scopus (38) Google Scholar). Two-substrate Kinetic Measurements—The two-substrate kinetic analysis was performed at cycloartenol concentrations spanning 10–50 μl and AdoMet concentrations spanning 20 to 100 μl, and the data were fitted to the sequential (ternary complex) mechanism equation (Equation 2) using the same software package based on the algorithms of Cleland as discussed by Copeland (27Copeland R.A. Enzymes: A Practical Introduction to Structure, Mechanism, and Data Analysis. 2nd ed. John Wiley & Sons, Inc., New York2000Crossref Google Scholar), ν=Vm*A*B/(Kia*Kb+Kma*B+Kmb*A+A*B)(Eq. 2) using a nonlinear least squares approach. Related formulations as discussed by Cleland to establish a Ping Pong (covalent intermediate) mechanism and the equilibrium-ordered mechanism were also examined (data not shown). Kma = Km of AdoMet, Kia = kd for AdoMet (dissociation constant to free enzyme where AdoMet binds prior to sterol), and Kmb = Km of sterol. Steady-state Inhibition—Kinetic data from standard activity assays of product inhibition and dead end inhibition experiments were analyzed with the software package in analogous fashion to the initial velocity data analysis. The constant substrate in these experiments was held at subsaturating concentrations, and the varied substrate was added to the activity assays at several fixed concentrations ranging from 10 to 100 μl AdoHcy, from 50 to 150 μl 24(28)-methylenecycloartenol, from 5 to 50 μl AdoMet, and from 5 to 50 μl cycloartenol. Cyclolaudenol and 25-azacycloartanol were used in the dead end inhibition studies assayed in the individual experiments against sterol substrate at several fixed concentrations ranging from 10 to 100 μl and from 10 to 100 nl, respectively. To investigate whether competitive (Equation 3), noncompetitive (Equation 4), or uncompetitive (Equation 5) inhibition was observed, the data were fitted to the respective equations based on the algorithms defined by Cleland (27Copeland R.A. Enzymes: A Practical Introduction to Structure, Mechanism, and Data Analysis. 2nd ed. John Wiley & Sons, Inc., New York2000Crossref Google Scholar) using nonlinear least squares analysis. ν=Vm/[1+(Km/S)*(1+I/Ki)](Eq. 3) ν=Vm/[(1+I/Ki)*(1+Km/S)](Eq. 4) ν=Vm/(1+I/Ki+Km/S)(Eq. 5) The data for individual experiments with each inhibitor versus varied substrate were fit to all three inhibitor models. Kinetic constants ± S.E. are shown as relevant. V max is the maximum velocity, Km is the Michaelis constant for the varied substrate, S is the concentration of sterol or AdoMet substrate, I is the concentration of the inhibitor, and Ki is the dissociation constant (assuming dissociation to free enzyme where AdoMet binds prior to sterol). Choice of kinetic fit was based on a combination of visual inspection and comparison of S.E. values and residual for all three inhibition types applied to the data sets. Kinetic Isotope Effects—The KIE on overall rate (V) is determined from the ratios of the intercepts (VH /VD) and the KIE on V/K is determined from the ratio of the slopes ((V/K) H /(V/K) D)). The V and V/K values and KIE are determined by fitting the steady-state data using the computer programs developed by Cleland as described by Cook (28Cook P.F. Enzyme Mechanisms from Isotope Effects. CRC Press, Boca Raton," @default.
• W2106216001 created "2016-06-24" @default.
• W2106216001 creator A5002688503 @default.
• W2106216001 creator A5043370027 @default.
• W2106216001 creator A5064294448 @default.
• W2106216001 creator A5067533284 @default.
• W2106216001 creator A5079354727 @default.
• W2106216001 creator A5087415644 @default.
• W2106216001 date "2003-09-01" @default.
• W2106216001 modified "2023-10-15" @default.
• W2106216001 title "Biosynthesis of Phytosterols" @default.
• W2106216001 cites W1525232568 @default.
• W2106216001 cites W1527150217 @default.
• W2106216001 cites W1565240603 @default.
• W2106216001 cites W1576525527 @default.
• W2106216001 cites W1586573238 @default.
• W2106216001 cites W1933775832 @default.
• W2106216001 cites W1967711052 @default.
• W2106216001 cites W1974764099 @default.
• W2106216001 cites W1975312126 @default.
• W2106216001 cites W2005483556 @default.
• W2106216001 cites W2008185888 @default.
• W2106216001 cites W2012486473 @default.
• W2106216001 cites W2014495063 @default.
• W2106216001 cites W2024890702 @default.
• W2106216001 cites W2026552674 @default.
• W2106216001 cites W2032159769 @default.
• W2106216001 cites W2035132561 @default.
• W2106216001 cites W2046956375 @default.
• W2106216001 cites W2058804032 @default.
• W2106216001 cites W2061626941 @default.
• W2106216001 cites W2064979599 @default.
• W2106216001 cites W2068991842 @default.
• W2106216001 cites W2069932011 @default.
• W2106216001 cites W2070216979 @default.
• W2106216001 cites W2072039209 @default.
• W2106216001 cites W2073585086 @default.
• W2106216001 cites W2086626300 @default.
• W2106216001 cites W2087602176 @default.
• W2106216001 cites W2102925860 @default.
• W2106216001 cites W2104688428 @default.
• W2106216001 cites W2106004163 @default.
• W2106216001 cites W2168310063 @default.
• W2106216001 cites W242666643 @default.
• W2106216001 cites W2949884555 @default.
• W2106216001 cites W2953237976 @default.
• W2106216001 cites W4293247451 @default.
• W2106216001 doi "https://doi.org/10.1074/jbc.m303359200" @default.
• W2106216001 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/12807886" @default.
• W2106216001 hasPublicationYear "2003" @default.
• W2106216001 type Work @default.
• W2106216001 sameAs 2106216001 @default.
• W2106216001 citedByCount "61" @default.
• W2106216001 countsByYear W21062160012012 @default.
• W2106216001 countsByYear W21062160012013 @default.
• W2106216001 countsByYear W21062160012014 @default.
• W2106216001 countsByYear W21062160012015 @default.
• W2106216001 countsByYear W21062160012016 @default.
• W2106216001 countsByYear W21062160012017 @default.
• W2106216001 countsByYear W21062160012018 @default.
• W2106216001 countsByYear W21062160012019 @default.
• W2106216001 countsByYear W21062160012020 @default.
• W2106216001 countsByYear W21062160012021 @default.
• W2106216001 countsByYear W21062160012022 @default.
• W2106216001 countsByYear W21062160012023 @default.
• W2106216001 crossrefType "journal-article" @default.
• W2106216001 hasAuthorship W2106216001A5002688503 @default.
• W2106216001 hasAuthorship W2106216001A5043370027 @default.
• W2106216001 hasAuthorship W2106216001A5064294448 @default.
• W2106216001 hasAuthorship W2106216001A5067533284 @default.
• W2106216001 hasAuthorship W2106216001A5079354727 @default.
• W2106216001 hasAuthorship W2106216001A5087415644 @default.
• W2106216001 hasBestOaLocation W21062160011 @default.
• W2106216001 hasConcept C104317684 @default.
• W2106216001 hasConcept C185592680 @default.
• W2106216001 hasConcept C31903555 @default.
• W2106216001 hasConcept C553450214 @default.
• W2106216001 hasConcept C55493867 @default.
• W2106216001 hasConceptScore W2106216001C104317684 @default.
• W2106216001 hasConceptScore W2106216001C185592680 @default.
• W2106216001 hasConceptScore W2106216001C31903555 @default.
• W2106216001 hasConceptScore W2106216001C553450214 @default.
• W2106216001 hasConceptScore W2106216001C55493867 @default.
• W2106216001 hasIssue "36" @default.
• W2106216001 hasLocation W21062160011 @default.
• W2106216001 hasOpenAccess W2106216001 @default.
• W2106216001 hasPrimaryLocation W21062160011 @default.
• W2106216001 hasRelatedWork W1531601525 @default.
• W2106216001 hasRelatedWork W2319480705 @default.
• W2106216001 hasRelatedWork W2384464875 @default.
• W2106216001 hasRelatedWork W2606230654 @default.
• W2106216001 hasRelatedWork W2607424097 @default.
• W2106216001 hasRelatedWork W2748952813 @default.
• W2106216001 hasRelatedWork W2899084033 @default.
• W2106216001 hasRelatedWork W2948807893 @default.
• W2106216001 hasRelatedWork W4387497383 @default.
• W2106216001 hasRelatedWork W2778153218 @default.
• W2106216001 hasVolume "278" @default.

• next