FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2107571408> ?p ?o ?g. }

• W2107571408 endingPage "17730" @default.
• W2107571408 startingPage "17723" @default.
• W2107571408 abstract "Lipid peroxidation generates aldehydes, which react with DNA bases, forming genotoxic exocyclic etheno(ϵ)-adducts. E-bases have been implicated in vinyl chloride-induced carcinogenesis, and increased levels of these DNA lesions formed by endogenous processes are found in human degenerative disorders. E-adducts are repaired by the base excision repair pathway. Here, we report the efficient biological hijacking of the human alkyl-N-purine-DNA glycosylase (ANPG) by 3,N4-ethenocytosine (ϵC) when present in DNA. Unlike the ethenopurines, ANPG does not excise, but binds to ϵC when present in either double-stranded or single-stranded DNA. We developed a direct assay, based on the fluorescence quenching mechanism of molecular beacons, to measure a DNA glycosylase activity. Molecular beacons containing modified residues have been used to demonstrate that the ϵC·ANPG interaction inhibits excision repair both in reconstituted systems and in cultured human cells. Furthermore, we show that the ϵC·ANPG complex blocks primer extension by the Klenow fragment of DNA polymerase I. These results suggest that ϵC could be more genotoxic than 1,N6-ethenoadenine (ϵA) residues in vivo. The proposed model of ANPG-mediated genotoxicity of ϵC provides a new insight in the molecular basis of lipid peroxidation-induced cell death and genome instability in cancer. Lipid peroxidation generates aldehydes, which react with DNA bases, forming genotoxic exocyclic etheno(ϵ)-adducts. E-bases have been implicated in vinyl chloride-induced carcinogenesis, and increased levels of these DNA lesions formed by endogenous processes are found in human degenerative disorders. E-adducts are repaired by the base excision repair pathway. Here, we report the efficient biological hijacking of the human alkyl-N-purine-DNA glycosylase (ANPG) by 3,N4-ethenocytosine (ϵC) when present in DNA. Unlike the ethenopurines, ANPG does not excise, but binds to ϵC when present in either double-stranded or single-stranded DNA. We developed a direct assay, based on the fluorescence quenching mechanism of molecular beacons, to measure a DNA glycosylase activity. Molecular beacons containing modified residues have been used to demonstrate that the ϵC·ANPG interaction inhibits excision repair both in reconstituted systems and in cultured human cells. Furthermore, we show that the ϵC·ANPG complex blocks primer extension by the Klenow fragment of DNA polymerase I. These results suggest that ϵC could be more genotoxic than 1,N6-ethenoadenine (ϵA) residues in vivo. The proposed model of ANPG-mediated genotoxicity of ϵC provides a new insight in the molecular basis of lipid peroxidation-induced cell death and genome instability in cancer. Oxidative stress generates reactive aldehydes, as a by-product of lipid peroxidation (LPO) 1The abbreviations used are: LPO, lipid peroxidation; ϵ, etheno; ϵA, 1,N6-ethenoadenine; ϵC, 3,N4-ethenocytosine; 1,N2-ϵG, 1,N2-ethenoguanine; Hx, hypoxanthine; I, inosine; THF, tetrahydrofuran; 8-oxoG, 7,8-dihydro-8-oxoguanine; DHU, 5,6-dihydrouracil; DHT, 5,6-dihydrothymine; 5ohU, 5-hydroxyuracil; AP, apurinic/apyrimidinic; BER, base excision repair; TagI, E. coli 3-methyladenine-DNA-glycosylase I; AlkA, E. coli 3-methyladenine-DNA-glycosylase II; UDG, E. coli uracil-DNA-glycosylase; Fpg, E. coli formamidopyrimidine-DNA glycosylase; Nth, E. coli endonuclease III; Nfo, E. coli endonuclease IV; MUG, mismatch-specific uracil-DNA glycosylase; ANPG, human alkylpurine-DNA N-glycosylase; APDG, rat ANPG; hOGG1, human 7,8-dihydro-8-oxoguanine-DNA glycosylase; hNth1, human endonuclease III; Ape1, human AP-endonuclease; hTDG, human thymine-DNA glycosylase; BSA, bovine serum albumin; FITC, fluorescein isothiocyanate; EMSA, electrophoretic mobility shift assay; SPR, surface plasmon resonance; dabcyl, 4-(4-dimethylaminophenyl-azo)benzoic acid; XPA and XPC, Xeroderma pigmentosum complementation group A and C. and nitric oxide overproduction, which target DNA bases forming genotoxic exocyclic adducts such as 1,N6-ethenoadenine (ϵA) and 3,N4-ethenocytosine (ϵC) (1Nair J. Barbin A. Guichard Y. Bartsch H. Carcinogenesis. 1995; 16: 613-617Crossref PubMed Scopus (228) Google Scholar, 2Chung F.L. Chen H.J. Nath R.G. Carcinogenesis. 1996; 17: 2105-2111Crossref PubMed Scopus (328) Google Scholar, 3Pollack M. Oe T. Lee S.H. Silva Elipe M.V. Arison B.H. Blair I.A. Chem. Res. Toxicol. 2003; 16: 893-900Crossref PubMed Scopus (79) Google Scholar). Etheno(ϵ)-adducts are also formed by reaction with epoxides that result from the metabolism of various industrial pollutants such as vinyl chloride and vinyl carbamate (4Barbin A. Mutat. Res. 2000; 462: 55-69Crossref PubMed Scopus (134) Google Scholar). E-adducts are ubiquitous, and highly variable background levels of ϵA and ϵC were found in asymptomatic tissue DNA under normal physiological conditions. It was shown that the level of ϵC present in 10 different human liver DNA samples averaged 28 ± 9 ϵC/108 bases (5Marnett L.J. Burcham P.C. Chem. Res. Toxicol. 1993; 6: 771-785Crossref PubMed Scopus (275) Google Scholar), whereas in leukocytes, pancreas, and colon DNA samples isolated from healthy volunteers, it ranged from 0.1 to 11 ϵC/108 parent bases (6Nair J. IARC Sci. Publ. 1999; 150: 55-61Google Scholar). Based on these numbers, we estimate that the molar concentration of ϵC within the nucleus in human cells ranges from 0.2 to 40 nm. The low density lipids that transport cholesterol in the bloodstream are extremely susceptible to oxidation (7Mertens A. Verhamme P. Bielicki J.K. Phillips M.C. Quarck R. Verreth W. Stengel D. Ninio E. Navab M. Mackness B. Mackness M. Holvoet P. Circulation. 2003; 107: 1640-1646Crossref PubMed Scopus (166) Google Scholar), and it was speculated that this may account for the highly variable background levels of ϵ-adducts found in the DNA from normal human tissues (1Nair J. Barbin A. Guichard Y. Bartsch H. Carcinogenesis. 1995; 16: 613-617Crossref PubMed Scopus (228) Google Scholar). The increasing interest in exocyclic DNA adducts has been triggered by the observation that they are highly mutagenic. During DNA replication in Escherichia coli and simian kidney cells, ϵC mostly produces ϵC·G to A·T transversions and ϵC·G to T·A transitions (8Basu A.K. Wood M.L. Niedernhofer L.J. Ramos L.A. Essigmann J.M. Biochemistry. 1993; 32: 12793-12801Crossref PubMed Scopus (204) Google Scholar, 9Moriya M. Zhang W. Johnson F. Grollman A.P. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 11899-11903Crossref PubMed Scopus (233) Google Scholar). In a single-stranded shuttle vector containing a single ϵC residue, the targeted mutation frequency yield was 81% in simian kidney cells (9Moriya M. Zhang W. Johnson F. Grollman A.P. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 11899-11903Crossref PubMed Scopus (233) Google Scholar). The ϵA residues are also highly mutagenic in mammalian cells, where they lead mainly to ϵA·T to T·A transversions (10Pandya G.A. Moriya M. Biochemistry. 1996; 35: 11487-11492Crossref PubMed Scopus (180) Google Scholar, 11Levine R.L. Yang I.Y. Hossain M. Pandya G.A. Grollman A.P. Moriya M. Cancer Res. 2000; 60: 4098-4104PubMed Google Scholar) but are weak mutagens in E. coli. Therefore, the processes preventing mutations caused by ϵ-adducts in the genome upon cell division should play a crucial role in maintaining the stability of the genetic information. When present in DNA, ϵC residues are eliminated by the base excision repair (BER) pathway initiated in human cells by mismatch-specific thymine-DNA glycosylase (hTDG) (12Saparbaev M. Laval J. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 8508-8513Crossref PubMed Scopus (164) Google Scholar, 13Hang B. Medina M. Fraenkel-Conrat H. Singer B. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 13561-13566Crossref PubMed Scopus (82) Google Scholar). However, excision efficiency of ϵC by hTDG is rather poor (12Saparbaev M. Laval J. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 8508-8513Crossref PubMed Scopus (164) Google Scholar). Recently, two additional enzymes that excise ϵC, have been identified in human cells: the methyl-CpG binding domain protein (MBD4/MED1) (14Petronzelli F. Riccio A. Markham G.D. Seeholzer S.H. Genuardi M. Karbowski M. Yeung A.T. Matsumoto Y. Bellacosa A. J. Cell. Physiol. 2000; 185: 473-480Crossref PubMed Scopus (89) Google Scholar) and single-strand monofunctional uracil-DNA glycosylase (SMUG1) (15Kavli B. Sundheim O. Akbari M. Otterlei M. Nilsen H. Skorpen F. Aas P.A. Hagen L. Krokan H.E. Slupphaug G. J. Biol. Chem. 2002; 277: 39926-39936Abstract Full Text Full Text PDF PubMed Scopus (280) Google Scholar). The human alkyl-N-purine-DNA glycosylase (ANPG) excises ϵA and a variety of damaged bases including alkylated purines, hypoxanthine (Hx) and 1,N2-ethenoguanine (1,N2-ϵG), but it does not excise ϵC (reviewed in Ref. 16Gros L. Saparbaev M.K. Laval J. Oncogene. 2002; 21: 8905-8925Crossref PubMed Scopus (166) Google Scholar). Rat and murine homologs of ANPG have also been characterized (17O'Connor T.R. Laval F. EMBO J. 1990; 9: 3337-3342Crossref PubMed Scopus (100) Google Scholar, 18Engelward B.P. Boosalis M.S. Chen B.J. Deng Z. Siciliano M.J. Samson L.D. Carcinogenesis. 1993; 14: 175-181Crossref PubMed Scopus (77) Google Scholar). Studies using ANPG-deficient mice (Aag) suggest that ANPG could be an important determinant of cellular sensitivity to alkylating agents. Aag-/- mouse embryonic stem cells and fibroblasts show an increased sensitivity to methyl methanesulfonate and antitumor agents such as mitomycin C and N-methylnitrosourea (19Engelward B.P. Dreslin A. Christensen J. Huszar D. Kurahara C. Samson L. EMBO J. 1996; 15: 945-952Crossref PubMed Scopus (184) Google Scholar, 20Engelward B.P. Weeda G. Wyatt M.D. Broekhof J.L. de Wit J. Donker I. Allan J.M. Gold B. Hoeijmakers J.H. Samson L.D. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 13087-13092Crossref PubMed Scopus (206) Google Scholar). Moreover, Aag-/- splenic T lymphocytes show a significant increase in methyl methanesulfonate-induced mutations when compared with the wild type (21Elder R.H. Jansen J.G. Weeks R.J. Willington M.A. Deans B. Watson A.J. Mynett K.J. Bailey J.A. Cooper D.P. Rafferty J.A. Heeran M.C. Wijnhoven S.W. van Zeeland A.A. Margison G.P. Mol. Cell. Biol. 1998; 18: 5828-5837Crossref PubMed Scopus (112) Google Scholar). However, surprisingly, Aag-/- myeloid progenitor bone marrow cells show an unexpected resistance to alkylation damage (22Roth R.B. Samson L.D. Cancer Res. 2002; 62: 656-660PubMed Google Scholar), and pancreatic β cells of Aag null mice exhibit a markedly decreased susceptibility to necrosis induced by streptozotocin (23Cardinal J.W. Margison G.P. Mynett K.J. Yates A.P. Cameron D.P. Elder R.H. Mol. Cell. Biol. 2001; 21: 5605-5613Crossref PubMed Scopus (58) Google Scholar). Thus, in particular cell types, sensitivity to alkylating agents could be related to ANPG status. The ANPG protein in normal human breast cells is localized in the nucleus as shown by immunofluorescent staining (24Cerda S.R. Turk P.W. Thor A.D. Weitzman S.A. FEBS Lett. 1998; 431: 12-18Crossref PubMed Scopus (38) Google Scholar). In human cells, ANPG could be present as several alternatively spliced forms, including a truncated version (25Vickers M.A. Vyas P. Harris P.C. Simmons D.L. Higgs D.R. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 3437-3441Crossref PubMed Scopus (59) Google Scholar, 26Pendlebury A. Frayling I.M. Santibanez Koref M.F. Margison G.P. Rafferty J.A. Carcinogenesis. 1994; 15: 2957-2960Crossref PubMed Scopus (21) Google Scholar, 27O'Connor T.R. Laval J. Biochem. Biophys. Res. Commun. 1991; 176: 1170-1177Crossref PubMed Scopus (101) Google Scholar); consequently, it has been concluded that the non-conserved, N-terminal region apparently contributes little to the damage recognition and N-glycosylase activity (28O'Connor T.R. Nucleic Acids Res. 1993; 21: 5561-5569Crossref PubMed Scopus (135) Google Scholar). However, we have recently demonstrated that the first N-terminal 80 amino acids of ANPG are essential for 1,N2-ϵG-DNA glycosylase activity (29Saparbaev M. Langouet S. Privezentzev C.V. Guengerich F.P. Cai H. Elder R.H. Laval J. J. Biol. Chem. 2002; 277: 26987-26993Abstract Full Text Full Text PDF PubMed Scopus (96) Google Scholar). Previous reports have indicated that ANPG can recognize some modified bases without excising them. Based on gel retardation assays, ANPG was found to interact with a pyrrolidine abasic site analog (30Scharer O.D. Nash H.M. Jiricny J. Laval J. Verdine G.L. J. Biol. Chem. 1998; 273: 8592-8597Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar), and a phenotypic complementation study suggested that it could interact with 7,8-dihydro-8-oxoguanine (8-oxoG) (31Bessho T. Roy R. Yamamoto K. Kasai H. Nishimura S. Tano K. Mitra S. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 8901-8904Crossref PubMed Scopus (142) Google Scholar), although the pure protein does not excise 8-oxoG. Moreover, it has been shown that ANPG recognizes cisplatin-DNA adducts in a reconstituted system with mild affinity (KD 71-144 nm) and may shield these adducts from repair by blocking the access to other proteins (32Kartalou M. Samson L.D. Essigmann J.M. Biochemistry. 2000; 39: 8032-8038Crossref PubMed Scopus (37) Google Scholar). Current methods to measure the DNA glycosylase activities are indirect and time-consuming. To overcome these limits, we developed a method based on molecular beacons containing modified bases that allows direct and high throughput DNA glycosylase assay in reconstituted systems and in cultured cells. The molecular beacon is a single-stranded oligonucleotide probe containing a sequence complementary to the target that is flanked by self-complementary termini, and it carries a fluorophore and a quencher at the 5′-and 3′-ends (33Tyagi S. Kramer F.R. Nat. Biotechnol. 1996; 14: 303-308Crossref PubMed Scopus (3644) Google Scholar). In the absence of the DNA target, these molecules form a stem-loop structure in which the 5′-fluorophore and 3′-quencher are in close proximity to each other, causing the fluorescence of the fluorophore to be quenched by fluorescence resonance energy transfer (34Stryer L. Annu. Rev. Biochem. 1978; 47: 819-846Crossref PubMed Scopus (1966) Google Scholar). Here, we report that excision of modified bases present in molecular beacon by a DNA glycosylase can be detected by increase in fluorescence. In the present work, a search for specific inhibitors of ANPG revealed that the human and rat proteins bind specifically to ϵC residues present in either duplex or single-stranded oligonucleotides. This abortive interaction between ANPG and ϵC residues strongly inhibits Hx and ϵA-DNA glycosylase activity in the reconstituted systems. Furthermore, using a modified molecular beacon, we demonstrated that short oligonucleotide duplex containing a single ϵC residue inhibits ANPG activity in cultured human and mouse cells. In addition, the ϵC·ANPG complex strongly inhibits both ϵC excision by hTDG and DNA synthesis by Klenow fragment in primer extension assays. Taken together, these results suggest that hijacking of ANPG in the ϵC·ANPG complex may lead to the persistence of ϵC in vivo and could result in replication fork arrest. The importance of the present observation is underlined by the fact that hijacking of cellular proteins by DNA damage has been implicated in the action of cisplatin drugs (35Kartalou M. Essigmann J.M. Mutat. Res. 2001; 478: 1-21Crossref PubMed Scopus (333) Google Scholar) and the expansion of trinucleotide repeats in Huntington disease (36Kovtun I.V. Goellner G. McMurray C.T. Biochem. Cell Biol. 2001; 79: 325-336Crossref PubMed Scopus (41) Google Scholar). Here, we propose a model of enhanced genotoxicity of the ϵC adduct. The possible implications of the ϵC·ANPG interaction for LPO-induced cytoxicity and genome instability are discussed. Oligonucleotides—All oligodeoxyribonucleotides were purchased from Eurogentec (Seraing, Belgium) and Genset (Evry, France) including the following oligonucleotides: modified, ϵA, d(AATTGCTATCTAGCTCCGC-ϵA-CGCTGGTACCCATCTCATGA)-biotin; ϵA2, d(AATTACATCGTCACCTGGG-ϵA-CATGTTGCAGATCCATGCAC); ϵC40, d(AATTGCTATCTAGCTCCGC-ϵC/C-CGCTGGTACCCATCTCATGA)-biotin; M13-ϵC or M13-C, d(CTATTAACGCCAGCTGG-ϵC/C-AAATGGGGGATGTGCTGCAAGGCG); ϵC- or C-hairpin d(TGGG-ϵC/C-CATGCATGGCCCA); X, d(AAATACATCGTCACCTGGG-X-CATGTTGCAGATCC), where X is cytosine (C), mismatched thymine (T), uracil (U), ϵA, ϵC, tetrahydrofuran, an abasic site analog (THF), 8-oxoG, 5,6-dihydrouracil (DHU), 5,6-dihydrothymine (DHT), inosine (I), or 5-hydroxyuracil (5ohU); molecular beacons, 35F-control, FITC-d(GCACTTAAGAATTCACGCCATGTCGAAATTCTTAAGTGC); 35FD-control, FITC-d(GCACTTAAGAATTCACGCCATGTCGAAATTCTTAAGTGC)-dabcyl, where FITC is fluorescein isothiocyanate and dabcyl is 4-(4′-dimethylaminophenylazo)benzoic acid; non-modified, PR-13, d(CGCCTTGCAGCAC); FLAP 7.6, d(TAGAGGCCATTTGCCAGCTGGCGTAATAG); complementary oligonucleotides, containing dA, dG, dC, or T opposite to modified base. Molecular beacon oligonucleotide, inosine-FD, FITC-d(CGCITCIACICIT-(CH2)18-ACICITCIACICG)-dabcyl, was a gift from Dr Y. Alekseev. To obtain duplex DNA, a modified oligonucleotide was hybridized to its complement, and the resulting oligonucleotide duplexes are referred to as X·C(G,A,T), respectively, where X is a modified base. The sequence contexts were used previously to study the repair of ϵ-adducts and hypoxanthine (29Saparbaev M. Langouet S. Privezentzev C.V. Guengerich F.P. Cai H. Elder R.H. Laval J. J. Biol. Chem. 2002; 277: 26987-26993Abstract Full Text Full Text PDF PubMed Scopus (96) Google Scholar, 37Saparbaev M. Laval J. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 5873-5877Crossref PubMed Scopus (233) Google Scholar). Oligonucleotides were 5′-end labeled by T4 polynucleotide kinase (New England Biolabs, OZYME, Saint Quentin Yvelines, France) in the presence of [γ-32P]ATP (4500 Ci/mmol, ICN Biomedicals, S.A.R.L., Orsay, France). Cell Lines and Culture—Lich cells are derived from a human hepatoma (38Lefebvre P. Zak P. Laval F. DNA Cell Biol. 1993; 12: 233-241Crossref PubMed Scopus (44) Google Scholar). Lich, HeLa, and NIH3T3 cells were respectively grown in minimum essential medium and in Dulbecco's modified Eagle's medium (Invitrogen) at 37 °C in a humidified atmosphere with 5% CO2. Culture media were supplemented with 10% heat-inactivated fetal calf serum (Invitrogen), 100 μg/ml streptomycin, and 100 units/ml penicillin. Cell-free extracts were prepared as described (38Lefebvre P. Zak P. Laval F. DNA Cell Biol. 1993; 12: 233-241Crossref PubMed Scopus (44) Google Scholar). Enzymes—Purification of the E. coli UDG (uracil-DNA glycosylase), TagI (3-methyladenine-DNA glycosylase I), AlkA (3-methyladenine-DNA glycosylase II), MUG (mismatch-specific uracil-DNA glycosylase), Fpg (formamidopyrimidine-DNA glycosylase), Nth (endonuclease III), Nfo (endonuclease IV), hTDG (human mismatch-specific thymine-DNA glycosylase), hOGG1 (human 8-oxoG-DNA glycosylase), ANPG70, ANPG60, ANPG40, and ANPG80 proteins was performed as described (29Saparbaev M. Langouet S. Privezentzev C.V. Guengerich F.P. Cai H. Elder R.H. Laval J. J. Biol. Chem. 2002; 277: 26987-26993Abstract Full Text Full Text PDF PubMed Scopus (96) Google Scholar). Purification of Saccharomyces cerevisiae Apn1 (apurinic/apyrimidinic (AP) endonuclease 1) and human AP endonuclease 1 (Ape1) proteins was performed as described (39Ishchenko A.A. Sanz G. Privezentzev C.V. Maksimenko A.V. Saparbaev M. Nucleic Acids Res. 2003; 31: 6344-6353Crossref PubMed Scopus (63) Google Scholar). Human Nth1 (human endonuclease III) protein was generously provided by Dr. R. Roy (American Health Foundation, Valhalla, NY). The activity of the various proteins was tested using their principal substrates and was checked just prior to use. Enzyme Assays—The release of ϵA, ϵC, and thymine residues was measured by the cleavage of an oligonucleotide containing a single lesion at a defined position. The standard assay for ϵC and thymine excision activity (20 μl) contained 0.2 pmol of the 5′-32P-end labeled oligonucleotide duplex, 70 mm Hepes-KOH, pH 7.8, 1 mm EDTA, 5 mm 2-mercaptoethanol, 100 μg/ml BSA, and limiting amounts of enzyme, unless otherwise stated. The reaction mix for ϵA excision activity was supplemented with 100 mm KCl. Incubations were carried out at 37 °C except for hTDG, which was at 30 °C. The abasic sites were revealed by light piperidine treatment (10% piperidine at 37 °C for 15 min) (40Ye N. Holmquist G.P. O'Connor T.R. J. Mol. Biol. 1998; 284: 269-285Crossref PubMed Scopus (66) Google Scholar), and reaction products were analyzed as described (39Ishchenko A.A. Sanz G. Privezentzev C.V. Maksimenko A.V. Saparbaev M. Nucleic Acids Res. 2003; 31: 6344-6353Crossref PubMed Scopus (63) Google Scholar). The gels were exposed to a Storm 840 Phosphor Screen, and the amounts of radioactivity in the bands were quantified using ImageQuaNT™ software. The standard enzyme assay with molecular beacon was performed at 37 °C with 5-35 nm oligonucleotides and a limited amount of protein, in the respective reaction buffer. Reactions were performed in a quartz cuvette (final volume, 0.4 ml), and fluorescence was measured using an SFM 25 Kontron fluorimeter and real-time computed with the attached software WIND25 1.50. Excitation was at 488 nm, and emission was at 515 nm. Fluorescence was expressed as response units. At the end of the reaction, to compare the fluorescence of the reaction product with that of the reaction mixture without enzyme, emission spectra of the reaction product and the reaction mixture without enzyme were obtained between 500 and 550 nm and with an excitation at 488 nm. Electrophoretic Mobility Shift Assay (EMSA)—The standard binding reaction mixture (20 μl) contained 70 mm Hepes-KOH, pH 7.8, 1 mm EDTA, 100 mm KCl, 5 mm 2-mercaptoethanol, 20-200 fmol of 5′-32P-labeled oligonucleotide duplex, limiting amounts of protein, and non-labeled competitor oligonucleotide, unless otherwise stated. The mixture was incubated for 20 min on ice, after which an aliquot was analyzed by electrophoresis on a 10% non-denaturing polyacrylamide gel (37.5:1 acrylamide/bisacrylamide) using 0.5× Tris-borate-EDTA buffer (45 mm Tris borate, pH 8, 1 mm EDTA) at 4 mA/100 V for 14 h at +4 °C. The gels were analyzed as described above. Surface Plasmon Resonance Techniques—Kinetics of interaction were determined using a BIAcore 1000 instrument (Biacore AB, Uppsala, Sweden). Pre-annealed, biotinylated oligonucleotide duplex ϵC40·G (0.1 ng/μl in Hepes buffered saline-EDTA polysorbate buffer containing: 10 mm Hepes-KOH, pH 7.4, 500 mm NaCl, 3.4 mm EDTA, 0.005% (v/v) polysorbate 20) was injected at flow rate of 2 μl/min onto a streptavidin-coated sensor chip (SA sensor chip, BIAcore). To remove non-specifically bound material, 30 μl of 0.05% SDS was pulsed. The amount of immobilized ligand was found to be about 600-900 response units. To determine dissociation equilibrium constants (KD) using surface plasmon resonance (SPR), the 40-mer duplex containing ϵC was immobilized onto the sensor chip surface as described, and then different concentrations of ANPG40 were injected in low salt Hepes buffered saline-EDTA polysorbate buffer containing only 150 mm NaCl at a flow rate 30 μl/min. At the end of the association time, dissociation was achieved by injecting the same buffer. Analysis of the sensorgrams and KD values were performed using BIAevaluation software. DNA Repair Assay in Cultured Cells—HeLa and NIH3T3 cells were grown in 6-well plates. Cells were washed two times with phosphate-buffered saline, and culture medium was replaced by 1 ml of OptiMEM medium (Invitrogen) before transfection. 200 pmols of each oligonucleotide and 2 μg of Cytofectin GSV (Glen Research, Sterling, VA) were diluted separately in 50 μl of solution A (100 mm NaCl, 10 mm Hepes, pH 7.4) and then mixed together. After 15 min of incubation at room temperature, cytofectine·DNA complexes were added drop by drop to the cells, which were grown for 5 h and then fixed with a 4% formal-dehyde solution for 20 min at 4 °C before examination in a fluorescence microscope. Primer Extension Assay—To generate a double-stranded matrix for DNA synthesis, a 41-mer oligonucleotide template containing either ϵC (M13-ϵC) or C (M13-CC) at position 17 was annealed to a 5′-32P-labeled 13-mer primer (PR13) and a partially complementary 29-mer (Flap 7.6) oligonucleotide at a 1:1.2 molar ratio by heating to 95 °C for 5 min and slow cooling. The standard reaction mixture (20 μl) contained 10 nm 5′-32P primer/template, 10 mm Tris-HCl, pH 7.5, 1 mm dithiothreitiol, 5 mm MgCl2, 100 μm each of dNTP and 1 unit of Klenow fragment. Where stated, 20-500 nm ANPG80 and/or ANPG70 were added. Reactions were performed at 37 °C for 5 min, and products were analyzed as described above. Effect of Duplex Oligonucleotides Containing Single Modified Base upon ϵA-DNA Glycosylase Activity of ANPG—In a search for specific inhibitors of ANPG, we measured the ϵA-DNA glycosylase activity of ANPG in the presence of a competitor duplex oligonucleotide containing specific base modifications. The 5′-32P-labeled ϵA·T was incubated with purified ANPG70 protein in the absence or presence of a molar excess of the following non-labeled duplex oligonucleotides: C·G, G·T, G·U, ϵA·T, ϵC·G, THF·G, 8-oxoG·C (Fig. 1A) and 8-oxoG·A, DHU·G, DHT·A, I·T 5ohU·G (data not shown) at 37 °C for 20 min. As shown in Fig. 1A, when ϵA·T is treated with ANPG70 followed by light piperidine, in order to reveal abasic sites generated by ANPG, about 70% of the oligonucleotide was incised (lane 2). Equimolar amount of non-labeled (cold) ϵA·T and I·T oligonucleotides had a very slight, if any, inhibition effect (lane 9 and data not shown). However, an 8-fold molar excess of ϵA·T lead to a 4-fold reduction of ϵA excision (lane 10). The weak inhibition by ϵA·T and I·T might be due to the high Km value of ANPG for these substrates (24 and 69 nm, respectively) (41Saparbaev M. Kleibl K. Laval J. Nucleic Acids Res. 1995; 23: 3750-3755Crossref PubMed Scopus (214) Google Scholar, 42Asaeda A. Ide H. Asagoshi K. Matsuyama S. Tano K. Murakami A. Takamori Y. Kubo K. Biochemistry. 2000; 39: 1959-1965Crossref PubMed Scopus (50) Google Scholar). No significant effect on ϵA-DNA glycosylase activity of ANPG was detected in the presence of C·G, G·T, G·U, THF·G, 8-oxoG·C, 8-oxoG·A, 5ohU·G, DHU·G, DHT·A, and I·T oligonucleotides, even at 8-fold molar excess (lanes 3-8, lanes 13-16, and data not shown). 2- and 20-fold reductions of the incision were observed in the presence of 1- and 8-fold molar excess of ϵC·G, respectively (lanes 11-12), indicating that ϵC is a more efficient inhibitor than ϵA (or Hx) (lanes 10 and 12). Similar results were obtained when the truncated ANPG40 and rat APDG60 were used, indicating that the non-conserved N-terminal region does not contribute to the substrate specificity (not shown) and that both the human and the rat ANPG proteins can form a specific interaction with ϵC. Identical patterns of inhibition were obtained with ϵA2·T oligonucleotide duplex, which has different sequence context than ϵA·T, indicating that the ϵC·G effect is not sequence-specific. Furthermore, the Hx- and 3-methyladenine-DNA glycosylase activities of ANPG were also strongly inhibited in the presence of a 3- and 6-fold molar excess of ϵC·G (see Supplemental data, Fig. 1, and data not shown). Altogether, the data suggest that human and rat ANPG interact specifically with ϵC residues among all other DNA modifications tested. Because ANPG is the only known DNA glycosylase that removes ϵA residues in mammalian cells, we investigated whether ϵC·G could inhibit ANPG in human cell-free extracts. Indeed, as shown in Fig. 1B, the addition of non-labeled ϵC·Gto Lich cells extract completely inhibits ϵA excision (lanes 9 and 10), and again, it was more efficient than ϵA·T (lanes 3-4). A 25-fold molar excess of non-labeled A·T or 8-oxoG·C had no effect on ϵA excision (lanes 6 and 8). This result suggests that ϵC residues, when present in DNA, inhibit ϵA-DNA glycosylase activity in the cell. Binding of Various DNA Repair Proteins to ϵC·G Oligonucleotide—We proposed that the observed inhibition of ANPG-dependent DNA glycosylase activities in the presence of ϵC·G could result from tight and specific binding of ANPG to ϵC. Therefore, the interaction of 5′-32P-labeled ϵC34·G with various BER proteins was examined using an EMSA. To avoid non-specific interactions, the standard binding mixture contained a 17-fold excess of BSA and a 10-fold excess of cold, non-modified 34-mer C34·G duplex oligonucleotide over labeled ϵC34·G. The E. coli MUG and human TDG proteins are ϵC-specific DNA glycosylases (12Saparbaev M. Laval J. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 8508-8513Crossref PubMed Scopus (164) Google Scholar) and, as shown in Fig. 2A, MUG interacts in a highly specific manner with ϵC34·G, with more than 90% of the labeled DNA present in bound form (lane 4). In contrast, under the conditions used, GST-hTDG did not interact with ϵC34·G (lane 8). However, in agreement with our initial observations, the truncated human ANPG40 and rat APDG60 form a specific complex with ϵC34·G (lanes 9-10). Of the other enzymes tested, UDG, Nth, hNTH1, Ape1, and TagI proteins did not form any complex with ϵC34·G (Fig. 2A, lanes 2, 5, 11, 13, and 15). However, although AlkA, Fpg, Nfo, hOGG1, and Apn1 do not excise ϵC, they were found to bind weakly to ϵC34·G (Fig. 2A, lanes 3, 6, 7, 12, and 14). Using cold competitor binding reactions, in contrast to MUG, ANPG, and APDG60, the interaction observed for AlkA, Fpg, Nfo, hOGG1, and Apn1 was found to be rather non-specific (data not shown). In conclusion, the results show that among the DNA repair proteins tested, MUG, ANPG40, and APDG60 bind to ϵC in a specific manner. Affinity of ANPG Isoform" @default.
• W2107571408 created "2016-06-24" @default.
• W2107571408 creator A5048156654 @default.
• W2107571408 creator A5048406939 @default.
• W2107571408 creator A5060741033 @default.
• W2107571408 creator A5064506934 @default.
• W2107571408 creator A5067760784 @default.
• W2107571408 date "2004-04-01" @default.
• W2107571408 modified "2023-10-18" @default.
• W2107571408 title "Hijacking of the Human Alkyl-N-purine-DNA Glycosylase by 3,N4-Ethenocytosine, a Lipid Peroxidation-induced DNA Adduct" @default.
• W2107571408 cites W138005989 @default.
• W2107571408 cites W1522901791 @default.
• W2107571408 cites W1561540396 @default.
• W2107571408 cites W1966182868 @default.
• W2107571408 cites W1966701436 @default.
• W2107571408 cites W1972713551 @default.
• W2107571408 cites W1973010332 @default.
• W2107571408 cites W1973136693 @default.
• W2107571408 cites W1973189244 @default.
• W2107571408 cites W1973310028 @default.
• W2107571408 cites W1973493626 @default.
• W2107571408 cites W1980630902 @default.
• W2107571408 cites W1981168640 @default.
• W2107571408 cites W1984558131 @default.
• W2107571408 cites W1984926115 @default.
• W2107571408 cites W2001151395 @default.
• W2107571408 cites W2012707998 @default.
• W2107571408 cites W2014966556 @default.
• W2107571408 cites W2017776786 @default.
• W2107571408 cites W2017852617 @default.
• W2107571408 cites W2018460947 @default.
• W2107571408 cites W2026710381 @default.
• W2107571408 cites W2027304194 @default.
• W2107571408 cites W2033136228 @default.
• W2107571408 cites W2042551931 @default.
• W2107571408 cites W2045944051 @default.
• W2107571408 cites W2047479283 @default.
• W2107571408 cites W2047552824 @default.
• W2107571408 cites W2050662558 @default.
• W2107571408 cites W2057740091 @default.
• W2107571408 cites W2058699484 @default.
• W2107571408 cites W2062253025 @default.
• W2107571408 cites W2063719626 @default.
• W2107571408 cites W2067829112 @default.
• W2107571408 cites W2072548372 @default.
• W2107571408 cites W2075465787 @default.
• W2107571408 cites W2077594563 @default.
• W2107571408 cites W2081236041 @default.
• W2107571408 cites W2083984648 @default.
• W2107571408 cites W2089293184 @default.
• W2107571408 cites W2092425969 @default.
• W2107571408 cites W2094550156 @default.
• W2107571408 cites W2095103640 @default.
• W2107571408 cites W2095965962 @default.
• W2107571408 cites W2110695197 @default.
• W2107571408 cites W2111868018 @default.
• W2107571408 cites W2113847441 @default.
• W2107571408 cites W2115296686 @default.
• W2107571408 cites W2120464591 @default.
• W2107571408 cites W2128471216 @default.
• W2107571408 cites W2131970139 @default.
• W2107571408 cites W2132152382 @default.
• W2107571408 cites W2133302043 @default.
• W2107571408 cites W2133502939 @default.
• W2107571408 cites W2140187466 @default.
• W2107571408 cites W2152026716 @default.
• W2107571408 cites W2160419835 @default.
• W2107571408 cites W2166936616 @default.
• W2107571408 cites W2323274627 @default.
• W2107571408 cites W236769407 @default.
• W2107571408 cites W4249747365 @default.
• W2107571408 doi "https://doi.org/10.1074/jbc.m314010200" @default.
• W2107571408 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/14761949" @default.
• W2107571408 hasPublicationYear "2004" @default.
• W2107571408 type Work @default.
• W2107571408 sameAs 2107571408 @default.
• W2107571408 citedByCount "38" @default.
• W2107571408 countsByYear W21075714082012 @default.
• W2107571408 countsByYear W21075714082013 @default.
• W2107571408 countsByYear W21075714082014 @default.
• W2107571408 countsByYear W21075714082016 @default.
• W2107571408 countsByYear W21075714082017 @default.
• W2107571408 countsByYear W21075714082018 @default.
• W2107571408 countsByYear W21075714082019 @default.
• W2107571408 countsByYear W21075714082020 @default.
• W2107571408 countsByYear W21075714082021 @default.
• W2107571408 countsByYear W21075714082023 @default.
• W2107571408 crossrefType "journal-article" @default.
• W2107571408 hasAuthorship W2107571408A5048156654 @default.
• W2107571408 hasAuthorship W2107571408A5048406939 @default.
• W2107571408 hasAuthorship W2107571408A5060741033 @default.
• W2107571408 hasAuthorship W2107571408A5064506934 @default.
• W2107571408 hasAuthorship W2107571408A5067760784 @default.
• W2107571408 hasBestOaLocation W21075714081 @default.
• W2107571408 hasConcept C104317684 @default.
• W2107571408 hasConcept C108204754 @default.
• W2107571408 hasConcept C143425029 @default.
• W2107571408 hasConcept C178790620 @default.

• next