FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2108124310> ?p ?o ?g. }

• W2108124310 endingPage "14075" @default.
• W2108124310 startingPage "14066" @default.
• W2108124310 abstract "Signal transduction within the canonical Wnt/β-catenin pathway drives development and carcinogenesis through programmed or unprogrammed changes in gene transcription. Although the upstream events linked to signal-induced activation of β-catenin in the cytoplasm have been deciphered in considerable detail, much less is known regarding the mechanism by which β-catenin stimulates target gene transcription in the nucleus. Here, we show that β-catenin physically and functionally targets the MED12 subunit in Mediator to activate transcription. The β-catenin transactivation domain bound directly to isolated MED12 and intact Mediator both in vitro and in vivo, and Mediator was recruited to Wnt-responsive genes in a β-catenin-dependent manner. Disruption of the β-catenin/MED12 interaction through dominant-negative interference- or RNA interference-mediated MED12 suppression inhibited β-catenin transactivation in response to Wnt signaling. This study thus identifies the MED12 interface within Mediator as a new component and a potential therapeutic target in the Wnt/β-catenin pathway. Signal transduction within the canonical Wnt/β-catenin pathway drives development and carcinogenesis through programmed or unprogrammed changes in gene transcription. Although the upstream events linked to signal-induced activation of β-catenin in the cytoplasm have been deciphered in considerable detail, much less is known regarding the mechanism by which β-catenin stimulates target gene transcription in the nucleus. Here, we show that β-catenin physically and functionally targets the MED12 subunit in Mediator to activate transcription. The β-catenin transactivation domain bound directly to isolated MED12 and intact Mediator both in vitro and in vivo, and Mediator was recruited to Wnt-responsive genes in a β-catenin-dependent manner. Disruption of the β-catenin/MED12 interaction through dominant-negative interference- or RNA interference-mediated MED12 suppression inhibited β-catenin transactivation in response to Wnt signaling. This study thus identifies the MED12 interface within Mediator as a new component and a potential therapeutic target in the Wnt/β-catenin pathway. Members of the Wnt family of secreted glycoproteins regulate a plethora of mammalian cell fate and behavioral decisions during embryogenesis and stem cell homeostasis (1Wodarz A. Nusse R. Annu. Rev. Cell Dev. Biol. 1998; 14: 59-88Crossref PubMed Scopus (1728) Google Scholar, 2Reya T. Clevers H. Nature. 2005; 434: 843-850Crossref PubMed Scopus (2989) Google Scholar). These pleiotropic effects derive from distinct signal transduction pathways, each initiated by engagement of Wnt ligands with members of the seven-pass transmembrane receptors of the Frizzled family. The first and best characterized of these pathways, the canonical Wnt pathway, culminates in programmed changes in target gene transcription through the action of a key nuclear effector called β-catenin (3Molenaar M. van de Wetering M. Oosterwegel M. Peterson-Maduro J. Godsave S. Korinek V. Roose J. Destree O. Clevers H. Cell. 1996; 86: 391-399Abstract Full Text Full Text PDF PubMed Scopus (1602) Google Scholar, 4Behrens J. von Kries J.P. Kuhl M. Bruhn L. Wedlich D. Grosschedl R. Birchmeier W. Nature. 1996; 382: 638-642Crossref PubMed Scopus (2579) Google Scholar, 5Aoki M. Hecht A. Kruse U. Kemler R. Vogt P.K. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 139-144Crossref PubMed Scopus (149) Google Scholar). In the absence of Wnt signaling, the steady-state level of cytoplasmic β-catenin is suppressed by a protein complex composed of Axin, the APC (adenomatous polyposis coli) tumor suppressor protein, and glycogen synthase kinase-3β, the latter of which phosphorylates β-catenin, marking it for destruction by the ubiquitin/proteasome pathway (6Hart M. Concordet J.P. Lassot I. Albert I. del los Santos R. Durand H. Perret C. Rubinfeld B. Margottin F. Benarous R. Polakis P. Curr. Biol. 1999; 9: 207-210Abstract Full Text Full Text PDF PubMed Scopus (578) Google Scholar, 7Hart M.J. de los Santos R. Albert I.N. Rubinfeld B. Polakis P. Curr. Biol. 1998; 8: 573-581Abstract Full Text Full Text PDF PubMed Google Scholar, 8Aberle H. Bauer A. Stappert J. Kispert A. Kemler R. EMBO J. 1997; 16: 3797-3804Crossref PubMed Scopus (2135) Google Scholar, 9Zeng L. Fagotto F. Zhang T. Hsu W. Vasicek T.J. Perry W.L. II I Lee J.J. Tilghman S.M. Gumbiner B.M. Costantini F. Cell. 1997; 90: 181-192Abstract Full Text Full Text PDF PubMed Scopus (783) Google Scholar, 10Kishida S. Yamamoto H. Hino S. Ikeda S. Kishida M. Kikuchi A. Mol. Cell. Biol. 1999; 19: 4414-4422Crossref PubMed Google Scholar). Binding of Wnt ligand to Frizzled and its coreceptor LRP5/6 leads to inactivation of the Axin complex and stabilization of β-catenin. Stabilized β-catenin then translocates into the nucleus, whereupon its interaction with members of the T cell factor (TCF) 2The abbreviations used are: TCF, T cell factor; LEF, lymphoid enhancer factor; CBP, cAMP-responsive element-binding protein-binding protein; ChIP, chromatin immunoprecipitation; OPA, opposite paired; RNAi, RNA interference; siRNA, small interfering RNA; GST, glutathione S-transferase; DSP, dithiobis(succinimidyl propionate); RT, reverse transcription; TBEs, TCF-binding elements. 2The abbreviations used are: TCF, T cell factor; LEF, lymphoid enhancer factor; CBP, cAMP-responsive element-binding protein-binding protein; ChIP, chromatin immunoprecipitation; OPA, opposite paired; RNAi, RNA interference; siRNA, small interfering RNA; GST, glutathione S-transferase; DSP, dithiobis(succinimidyl propionate); RT, reverse transcription; TBEs, TCF-binding elements./lymphoid enhancer factor (LEF) family of DNA-binding proteins positions β-catenin to activate transcription from the promoters of Wnt target genes that function in developmental regulation, cell proliferation, and cell/cell as well as cell/matrix interactions (11Shtutman M. Zhurinsky J. Simcha I. Albanese C. D'Amico M. Pestell R. Ben-Ze'ev A. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 5522-5527Crossref PubMed Scopus (1906) Google Scholar, 12Marchenko G.N. Marchenko N.D. Leng J. Strongin A.Y. Biochem. J. 2002; 363: 253-262Crossref PubMed Scopus (88) Google Scholar, 13Blache P. van de Wetering M. Duluc I. Domon C. Berta P. Freund J.N. Clevers H. Jay P. J. Cell Biol. 2004; 166: 37-47Crossref PubMed Scopus (370) Google Scholar, 14Chamorro M.N. Schwartz D.R. Vonica A. Brivanlou A.H. Cho K.R. Varmus H.E. EMBO J. 2005; 24: 73-84Crossref PubMed Scopus (266) Google Scholar, 15Crawford H.C. Fingleton B.M. Rudolph-Owen L.A. Goss K.J. Rubinfeld B. Polakis P. Matrisian L.M. Oncogene. 1999; 18: 2883-2891Crossref PubMed Scopus (610) Google Scholar, 16Brabletz T. Jung A. Dag S. Hlubek F. Kirchner T. Am. J. Pathol. 1999; 155: 1033-1038Abstract Full Text Full Text PDF PubMed Scopus (571) Google Scholar, 17He T.C. Sparks A.B. Rago C. Hermeking H. Zawel L. da Costa L.T. Morin P.J. Vogelstein B. Kinzler K.W. Science. 1998; 281: 1509-1512Crossref PubMed Scopus (4048) Google Scholar, 18Tetsu O. McCormick F. Nature. 1999; 398: 422-426Crossref PubMed Scopus (3238) Google Scholar). Dysregulation of Wnt/β-catenin signaling leading to unprogrammed transcription of Wnt target genes has been proposed to be a driving force in the development of many cancers, including colorectal cancers (19Korinek V. Barker N. Morin P.J. van Wichen D. de Weger R. Kinzler K.W. Vogelstein B. Clevers H. Science. 1997; 275: 1784-1787Crossref PubMed Scopus (2912) Google Scholar, 20Morin P.J. Sparks A.B. Korinek V. Barker N. Clevers H. Vogelstein B. Kinzler K.W. Science. 1997; 275: 1787-1790Crossref PubMed Scopus (3481) Google Scholar, 21Polakis P. Genes Dev. 2000; 14: 1837-1851Crossref PubMed Google Scholar).Although the upstream events linked to signal-induced accumulation of β-catenin in the cytoplasm have been deciphered in considerable detail, the underlying mechanism(s) by which β-catenin activates transcription in the nucleus remains comparatively poorly understood. Thus, although β-catenin has been proposed to overcome nucleosome-mediated promoter repression and/or to promote transcription preinitiation complex assembly through functional interactions with the catalytic subunit (BRG1) of the SNF/SWI chromatin remodeling complex, the histone acetyltransferases p300/CBP, and the TATA box-binding protein (22Sun Y. Kolligs F.T. Hottiger M.O. Mosavin R. Fearon E.R. Nabel G.J. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 12613-12618Crossref PubMed Scopus (103) Google Scholar, 23Takemaru K.I. Moon R.T. J. Cell Biol. 2000; 149: 249-254Crossref PubMed Scopus (401) Google Scholar, 24Hecht A. Litterst C.M. Huber O. Kemler R. J. Biol. Chem. 1999; 274: 18017-18025Abstract Full Text Full Text PDF PubMed Scopus (157) Google Scholar, 25Barker N. Hurlstone A. Musisi H. Miles A. Bienz M. Clevers H. EMBO J. 2001; 20: 4935-4943Crossref PubMed Scopus (357) Google Scholar, 26Hecht A. Vleminckx K. Stemmler M.P. van Roy F. Kemler R. EMBO J. 2000; 19: 1839-1850Crossref PubMed Google Scholar), these interactions are unlikely to wholly account for the unique regulatory specificity inherent to β-catenin-directed transcription. In this regard, recent genetic studies in Caenorhabditis elegans and Drosophila melanogaster have revealed that mutations in Mediator subunits MED1 (SOP-3, TRAP220), MED6, MED12 (DPY-22/SOP-1, KTO), MED13 (LET-19, SKD), and MED23 (SUR2) variously affect developmental processes regulated by Wnt signaling (27Zhang H. Emmons S.W. Genes Dev. 2000; 14: 2161-2172Crossref PubMed Scopus (75) Google Scholar, 28Treisman J. Development (Camb.). 2001; 128: 603-615Crossref PubMed Google Scholar, 29Zhang H. Emmons S.W. Development (Camb.). 2001; 128: 767-777Crossref PubMed Google Scholar, 30Janody F. Martirosyan Z. Benlali A. Treisman J.E. Development (Camb.). 2003; 130: 3691-3701Crossref PubMed Scopus (83) Google Scholar, 31Yoda A. Kouike H. Okano H. Sawa H. Development (Camb.). 2005; 132: 1885-1893Crossref PubMed Scopus (69) Google Scholar). However, whether these observations reflect a direct or indirect requirement for Mediator in Wnt signaling has heretofore remained unknown.Mediator is an evolutionarily conserved multiprotein interface between gene-specific transcription factors and the RNA polymerase II general transcription machinery (32Kornberg R.D. Trends Biochem. Sci. 2005; 30: 235-239Abstract Full Text Full Text PDF PubMed Scopus (424) Google Scholar, 33Malik S. Roeder R.G. Trends Biochem. Sci. 2005; 30: 256-263Abstract Full Text Full Text PDF PubMed Scopus (311) Google Scholar, 34Kim Y.J. Bjorklund S. Li Y. Sayre M.H. Kornberg R.D. Cell. 1994; 77: 599-608Abstract Full Text PDF PubMed Scopus (883) Google Scholar, 35Sun X. Zhang Y. Cho H. Rickert P. Lees E. Lane W. Reinberg D. Mol. Cell. 1998; 2: 213-222Abstract Full Text Full Text PDF PubMed Scopus (199) Google Scholar, 36Boyer T.G. Martin M.E. Lees E. Ricciardi R.P. Berk A.J. Nature. 1999; 399: 276-279Crossref PubMed Scopus (252) Google Scholar, 37Gu W. Malik S. Ito M. Yuan C.X. Fondell J.D. Zhang X. Martinez E. Qin J. Roeder R.G. Mol. Cell. 1999; 3: 97-108Abstract Full Text Full Text PDF PubMed Scopus (240) Google Scholar, 38Naar A.M. Beaurang P.A. Zhou S. Abraham S. Solomon W. Tjian R. Nature. 1999; 398: 828-832Crossref PubMed Scopus (371) Google Scholar, 39Rachez C. Lemon B.D. Suldan Z. Bromleigh V. Gamble M. Naar A.M. Erdjument-Bromage H. Tempst P. Freedman L.P. Nature. 1999; 398: 824-828Crossref PubMed Scopus (629) Google Scholar). In this capacity, Mediator serves to promote the assembly, activation, and regeneration of transcription complexes on core promoters during the initiation and re-initiation phases of transcription (40Wang G. Balamotis M.A. Stevens J.L. Yamaguchi Y. Handa H. Berk A.J. Mol. Cell. 2005; 17: 683-694Abstract Full Text Full Text PDF PubMed Scopus (157) Google Scholar, 41Ito M. Yuan C.X. Okano H.J. Darnell R.B. Roeder R.G. Mol. Cell. 2000; 5: 683-693Abstract Full Text Full Text PDF PubMed Scopus (255) Google Scholar, 42Park J.M. Kim H.S. Han S.J. Hwang M.S. Lee Y.C. Kim Y.J. Mol. Cell. Biol. 2000; 20: 8709-8719Crossref PubMed Scopus (101) Google Scholar, 43Yudkovsky N. Ranish J.A. Hahn S. Nature. 2000; 408: 225-229Crossref PubMed Scopus (295) Google Scholar, 44Park J.M. Werner J. Kim J.M. Lis J.T. Kim Y.J. Mol. Cell. 2001; 8: 9-19Abstract Full Text Full Text PDF PubMed Scopus (115) Google Scholar, 45Liu Y. Kung C. Fishburn J. Ansari A.Z. Shokat K.M. Hahn S. Mol. Cell. Biol. 2004; 24: 1721-1735Crossref PubMed Scopus (144) Google Scholar, 46Mittler G. Kremmer E. Timmers H.T. Meisterernst M. EMBO Rep. 2001; 2: 808-813Crossref PubMed Scopus (103) Google Scholar, 47Baek H.J. Malik S. Qin J. Roeder R.G. Mol. Cell. Biol. 2002; 22: 2842-2852Crossref PubMed Scopus (109) Google Scholar, 48Cantin G.T. Stevens J.L. Berk A.J. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 12003-12008Crossref PubMed Scopus (86) Google Scholar, 49Kuras L. Borggrefe T. Kornberg R.D. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 13887-13891Crossref PubMed Scopus (84) Google Scholar). Because of its direct association with both signal-activated transcription factors and the RNA polymerase II transcription machinery, Mediator has been proposed to function as a general conduit and integrator of regulatory signals that converge on the promoters of protein-coding genes (50Woychik N.A. Hampsey M. Cell. 2002; 108: 453-463Abstract Full Text Full Text PDF PubMed Scopus (206) Google Scholar). Consistent with this idea, several Mediator subunits are functionally required for activated transcription in response to diverse cell signaling pathways. These include MED1 (TRAP220, ARC/DRIP205) for nuclear receptor, MED14 (TRAP170, ARC/DRIP/CRSP150 (cofactor required for Sp1 function)) for interferon-γ, MED23 (TRAP150β, ARC/DRIP/CRSP130, human SUR2) for Ras/mitogen-activated protein kinase (MAPK), and MED15 (ARC105, PCQAP) for TGF-β signaling pathways (51Yuan C.X. Ito M. Fondell J.D. Fu Z.Y. Roeder R.G. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 7939-7944Crossref PubMed Scopus (389) Google Scholar, 52Kato Y. Habas R. Katsuyama Y. Naar A.M. He X. Nature. 2002; 418: 641-646Crossref PubMed Scopus (129) Google Scholar, 53Stevens J.L. Cantin G.T. Wang G. Shevchenko A. Berk A.J. Science. 2002; 296: 755-758Crossref PubMed Scopus (199) Google Scholar, 54Lau J.F. Nusinzon I. Burakov D. Freedman L.P. Horvath C.M. Mol. Cell. Biol. 2003; 23: 620-628Crossref PubMed Scopus (54) Google Scholar). Note that, in this study, we utilize the unified nomenclature suggested by Bourbon et al. (55Bourbon H.M. Aguilera A. Ansari A.Z. Asturias F.J. Berk A.J. Bjorklund S. Blackwell T.K. Borggrefe T. Carey M. Carlson M. Conaway J.W. Conaway R.C. Emmons S.W. Fondell J.D. Freedman L.P. Fukasawa T. Gustafsson C.M. Han M. He X. Herman P.K. Hinnebusch A.G. Holmberg S. Holstege F.C. Jaehning J.A. Kim Y.J. Kuras L. Leutz A. Lis J.T. Meisterernest M. Naar A.M. Nasmyth K. Parvin J.D. Ptashne M. Reinberg D. Ronne H. Sadowski I. Sakurai H. Sipiczki M. Sternberg P.W. Stillman D.J. Strich R. Struhl K. Svejstrup J.Q. Tuck S. Winston F. Roeder R.G. Kornberg R.D. Mol. Cell. 2004; 14: 553-557Abstract Full Text Full Text PDF PubMed Scopus (207) Google Scholar) to identify Mediator subunits. Where first introduced, however, each Mediator subunit will also be identified by its original name to facilitate recognition.The role of Mediator as an established signal transducer coupled with its genetic links to the Wnt pathway prompted us to examine the requirement for Mediator in β-catenin-driven transcription. Herein, we identify a direct physical interaction between β-catenin and the MED12 subunit in Mediator that is functionally required for activated transcription in response to Wnt signaling. Our study thus identifies MED12 as a new component in the Wnt/β-catenin pathway and further implicates Mediator in a broad range of developmental and pathological processes driven by canonical Wnt signal transduction.EXPERIMENTAL PROCEDURESAntibodies—The antibodies used for immunoblotting, affinity purification, and co-immunoprecipitation analyses were as follows. Anti-MED1 (catalog no. sc-8998), anti-MED6 (catalog no. sc-9433), anti-MED12 (catalog no. sc-5372), anti-MED16 (catalog no. sc-5366), anti-MED17 (catalog no. sc-12453), anti-CDK8 (catalog no. sc-13155, sc-1521), anti-HDAC1 (catalog no. sc-8410), and anti-transcription factor IIH p89 (catalog no. sc-293) antibodies were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). Anti-MED23 (catalog no. 551175) and anti-β-catenin (catalog no. 610154) antibodies were purchased from Pharmingen. Anti-FLAG antibody M2 was purchased from Sigma. To generate rabbit anti-MED30 and anti-MED4 polyclonal antibodies, recombinant FLAG-His6-MED30 or FLAG-His6-MED4 was expressed in Escherichia coli strain BL21(DH3), purified under denaturing conditions by nickel-nitrilotriacetic acid fast flow chromatography (Qiagen Inc.), and used to immunize rabbits (Covance, Berkeley, CA). Specific antibodies were purified from rabbit serum by passage over an antigen-cross-linked affinity column and were used directly for immunoblot analysis and chromatin immunoprecipitation (ChIP) assay or were first cross-linked to protein A-Sepharose (GE Healthcare) using dimethyl pimelimidate (Sigma) for immunoprecipitation assays.Expression and Reporter Plasmids—All expression vectors forβ-catenin, Xenopus TCF3, and MED23, luciferase/β-galactosidase reporters have been described (24Hecht A. Litterst C.M. Huber O. Kemler R. J. Biol. Chem. 1999; 274: 18017-18025Abstract Full Text Full Text PDF PubMed Scopus (157) Google Scholar, 26Hecht A. Vleminckx K. Stemmler M.P. van Roy F. Kemler R. EMBO J. 2000; 19: 1839-1850Crossref PubMed Google Scholar, 36Boyer T.G. Martin M.E. Lees E. Ricciardi R.P. Berk A.J. Nature. 1999; 399: 276-279Crossref PubMed Scopus (252) Google Scholar, 56Lee E. Salic A. Kirschner M.W. J. Cell Biol. 2001; 154: 983-993Crossref PubMed Scopus (126) Google Scholar, 57Aulehla A. Wehrle C. Brand-Saberi B. Kemler R. Gossler A. Kanzler B. Herrmann B.G. Dev. Cell. 2003; 4: 395-406Abstract Full Text Full Text PDF PubMed Scopus (464) Google Scholar). pRC/CMV-MED12, a multipurpose mammalian MED12 expression plasmid, was a kind gift from Dr. Leonard P. Freedman and used for in vitro transcription/translation of full-length MED12. pCMV-3xFLAG-MED12, a mammalian MED12 expression vector encoding MED12 N-terminally tagged with three tandem FLAG epitopes, was constructed by transferring the MED12 cDNA from pRC/CMV-MED12 to p3xFLAG-CMV (Sigma) through a multistep subcloning procedure. pRC/CMV-MED12-(1–1058) for in vitro transcription/translation of a MED12 N-terminal fragment was constructed by restriction digestion of pRC/CMV-MED12 with XbaI and subsequent plasmid religation. pET28-MED12-(626–1749) for in vitro transcription/translation of a MED12 internal fragment was constructed by subcloning an EcoRI-XhoI fragment of MED12 into pET28 (Novagen). pGBKT7-MED12-(1749–2231) for in vitro transcription/translation of a MED12 C-terminal fragment was constructed by subcloning a XhoI-NotI fragment of MED12 into pGBKT7 (Clontech). pCS2+MED12-PQL-His6-FLAG and pCS2+MED12-OPA-His6-FLAG for in vitro transcription/translation and mammalian expression of FLAG and His6 epitope-tagged MED12 PQL and opposite paired (OPA) domains, respectively, were constructed by subcloning PCR-amplified fragments encoding the MED12 PQL (amino acids 1651–2086) and OPA (amino acids 2087–2212) domains into pCS2+-His6-FLAG engineered to contain the His6 and FLAG epitope tag sequences in the multicloning site of pCS2+. pCS2+HA-MED15 and pET28-CycC were constructed by PCR-based subcloning of cDNAs encoding MED15 (cDNA clone MGC:20267; American Type Culture Collection) and cyclin C (cDNA clone MGC:19502; Open Biosystems, Huntsville, AL) into pCS2+ and pET28, respectively, and used for in vitro transcription/translation of full-length MED15 and cyclin C.Cell Culture, Transfections, RNA Interference, and Reporter Assays— 293 and HeLa cells were obtained from American Type Culture Collection and cultured in Dulbecco's modified Eagle's medium with 10% bovine growth serum (Hyclone). 293Top cells were a generous gift of Dr. Harold E. Varmus and were cultured in Dulbecco's modified Eagle's medium with 10% bovine growth serum and 400 ng/ml G418. T-REx HeLa cells (Invitrogen) were cultured in minimum Eagle's medium with 10% bovine growth serum and 5 μg/μl blasticidin (Invitrogen). Parental and Wnt3α-expressing L cells (American Type Culture Collection) were cultured and used for preparation of Wnt-conditioned medium as described previously (58Shibamoto S. Higano K. Takada R. Ito F. Takeichi M. Takada S. Genes Cells. 1998; 3: 659-670Crossref PubMed Scopus (230) Google Scholar). For transient reporter assays, cells were seeded into 24- or 12-well cell culture plates 24 h prior to transfection. Cells (30–40% confluent) were transfected with FuGENE 6 (Roche Applied Science) following the manufacturer's instructions. 48 h post-transfection, transfected cells were harvested and assayed for luciferase (Promega Corp.) and β-galactosidase (Applied Biosystems, Foster City, CA) activity as described previously (59Tan W. Kim S. Boyer T.G. J. Biol. Chem. 2004; 279: 55153-55160Abstract Full Text Full Text PDF PubMed Scopus (14) Google Scholar). For MED12 RNA interference (RNAi) experiments, cells were transfected with MED12-specific (catalog no. M-009092-00) or control (catalog no. D-001210-01-05) small interfering RNA (siRNA; Dharmacon, Chicago, IL) using TransIT-siQUEST transfection reagent (Mirus Bio Corp., Madison, WI) 48 h prior to transfection of β-catenin expression and reporter plasmids using FuGENE 6 as described above. Reporter assay was performed 24 h post-transfection. Each transfection was repeated a minimum of three times in duplicate.Glutathione S-Transferase (GST) Pulldown Assays—Fusion proteins of GST with full-length β-catenin (referred to as GST-βcat-FL), an N-terminal β-catenin fragment spanning amino acids 1–284 (referred to as GST-βcat-N), and a C-terminal β-catenin fragment spanning amino acids 630–781 and therefore including the transactivation domain (referred to as GST-βcat-C) were overexpressed in E. coli strain BL21(DE3), and soluble lysates were prepared in 50 mm Tris-HCl (pH 7.5), 250 mm NaCl, 5 mm EDTA, and 0.2% Nonidet P-40 by sonication. HeLa/S3 nuclear extracts were prepared as described (60Dignam J.D. Lebovitz R.M. Roeder R.G. Nucleic Acids Res. 1983; 11: 1475-1489Crossref PubMed Scopus (9143) Google Scholar). Recombinant Mediator subunits and fragments were expressed and radiolabeled with [35S]methionine by translation in vitro (TnT SP6/T7 quick coupled transcription/translation system, Promega Corp.).For GST pulldown assays using HeLa/S3 nuclear extract, 20 μg of each GST-β-catenin derivative was immobilized on glutathione-Sepharose beads (GE Healthcare) and washed extensively. Immobilized beads were subsequently incubated with 1 mg of HeLa/S3 nuclear extract, dialyzed previously against 0.1 m KCl buffer D (20 mm HEPES (pH 7.9), 0.2 mm EDTA, and 20% glycerol). After overnight incubation at 4 °C, beads were washed five times with 0.15 m KCl buffer D containing 0.2% Nonidet P-40. Bound proteins were eluted in Laemmli sample buffer. 10% of each eluate was resolved by SDS-12% PAGE and analyzed by Coomassie Brilliant Blue staining to ensure that equivalent amounts of GST-β-catenin fusion proteins were immobilized. The remaining 90% of each eluate was resolved by SDS-10% PAGE and processed for immunoblot analysis using antibodies specific for Mediator subunits. GST pulldown assays using radiolabeled recombinant Mediator subunits were performed similarly except that bovine serum albumin was added to the binding mixture at a final concentration of 1.5 μg/μl as a blocking reagent, and 0.2 m KCl buffer D containing 0.1% Nonidet P-40 was used for washes. Eluates were resolved by SDS-12% PAGE and visualized by PhosphorImager analysis (GE Healthcare).For Mediator purification, a soluble nuclear extract was prepared from MED6-HA/S3, a HeLa/S3-derived clonal cell line engineered by retrovirus-mediated gene transfer to express a hemagglutinin epitope-tagged Mediator MED6 subunit. Nuclear extract was first fractionated by phosphocellulose chromatography, and a 0.3–0.5 M KCl step fraction was subjected to 12CA5 (anti-hemagglutinin) affinity purification. Peptide eluates were dialyzed against 0.1 m KCl buffer D and used in GST pulldown assays.Dual GST pulldown/protein cross-linking assays were performed as described previously (61Gwack Y. Baek H.J. Nakamura H. Lee S.H. Meisterernst M. Roeder R.G. Jung J.U. Mol. Cell. Biol. 2003; 23: 2055-2067Crossref PubMed Scopus (87) Google Scholar) with minor modifications. Briefly, glutathione-Sepharose-immobilized GST and GST-β-catenin derivatives were incubated with HeLa/S3 nuclear extract and washed as described above. Subsequently, beads were equilibrated and resuspended in cross-linking buffer (20 mm HEPES (pH 7.9) and 100 mm KCl), followed by incubation with variable concentrations of dithiobis(succinimidyl propionate) (DSP; Pierce) to introduce reversible cross-links between directly interacting proteins. After incubation for 10 min at room temperature on a rocking platform, the cross-linking reaction was immediately quenched by the addition of 1 m Tris (pH 7.5) and subsequently terminated by the addition of quenching buffer (30 mm Tris (pH 7.5) and 100 mm KCl) for 15 min at room temperature. Uncross-linked proteins were removed with urea wash buffer (30 mm Tris (pH 7.5) 100 mm KCl, and 6 m urea); cross-links were reversed; and proteins were retained on beads eluted in Laemmli sample buffer at 94 °C. Eluates were resolved by SDS-10% PAGE and analyzed by immunoblot assay for the presence of Mediator subunits.ChIP Assays and Quantitative Reverse Transcription (RT)-PCR— ChIP assays were performed as described previously (62Odom D.T. Zizlsperger N. Gordon D.B. Bell G.W. Rinaldi N.J. Murray H.L. Volkert T.L. Schreiber J. Rolfe P.A. Gifford D.K. Fraenkel E. Bell G.I. Young R.A. Science. 2004; 303: 1378-1381Crossref PubMed Scopus (1065) Google Scholar) with minor modifications. Briefly, 293Top cells were grown in 150 mm culture dishes and treated with 1% formaldehyde for 30 min at room temperature. Cross-linking reactions were quenched with glycine, and soluble chromatin was obtained by sonication of isolated nuclei in radioimmune precipitation assay buffer (50 mm HEPES (pH 7.6), 1 mm EDTA, 0.5 m LiCl, 1% Nonidet P-40, and 0.7 mm sodium deoxycholate). Immunoprecipitation reactions were performed using 3 μg of control or specific antibody as indicated. After overnight incubation at 4 °C, immune complexes were captured on protein A-Sepharose, extensively washed, eluted, and incubated at 65 °C to reverse cross-links. DNA isolated with a QIAquick PCR purification kit was subsequently used in amplification reactions including primers specific for TCF-binding regions within the DKK1 (14Chamorro M.N. Schwartz D.R. Vonica A. Brivanlou A.H. Cho K.R. Varmus H.E. EMBO J. 2005; 24: 73-84Crossref PubMed Scopus (266) Google Scholar) or axin2 (63Kouzmenko A.P. Takeyama K. Ito S. Furutani T. Sawatsubashi S. Maki A. Suzuki E. Kawasaki Y. Akiyama T. Tabata T. Kato S. J. Biol. Chem. 2004; 279: 40255-40258Abstract Full Text Full Text PDF PubMed Scopus (186) Google Scholar) gene.For quantitative RT-PCR, total RNAs were isolated from 293Top cells treated with control or Wnt3α-conditioned medium using TRIzol reagent (Invitrogen). Quantitative RT-PCR was performed using ABsolute™ MAX 1-STEP QRT-PCR SYBR® Green/ROX Mix (ABgene, Rochester, NY) on an ABI PRISM 7900HT Fast real-time PCR system (Applied Biosystems). The gene-specific primers used in this study were as follows: HsAxin2-F, tgtgggcagtaagaaacagc; HsAxin2-R, ggttctcgggaaatgaggta; HsDKK1-F, catcagactgtgcctcagga; HsDKK1-R, ccacagtaacaacgctggaa; HsGAPDH-F, cctgttcgacagtcagccg; and HsGAPDH-R, cgaccaaatccgttgactcc.Co-immunoprecipitation Assays—Nuclear extracts from HeLa and BG-1 cells treated with 30 mm LiCl for 6 h were prepared as described (60Dignam J.D. Lebovitz R.M. Roeder R.G. Nucleic Acids Res. 1983; 11: 1475-1489Crossref PubMed Scopus (9143) Google Scholar) and dialyzed against 0.2 m KCl buffer D. Nuclear extracts (1 mg each) were first adjusted to 150 mm KCl and 0.1% Nonidet P-40 and subsequently subjected to overnight immunoprecipitation at 4 °C using 15 μl of protein A-Sepharose conjugated to either MED30-specific antibody or rabbit IgG as a negative control. Immune complexes were washed four times for 5 min with 0.15 m KCl buffer D containing 0.1% Nonidet P-40 at 4 °C, eluted in Laemmli sample buffer, and processed by SDS-11% PAGE for immunoblot analysis. For immunoprecipitation of Mediator in HeLa cells transfected with siRNA, nuclear extract was prepared as described above except that 0.1% Nonidet P-40 was used to disrupt cell membranes rather than mechanical lysis methods. Nuclear extracts (80 μg) were first adjusted to 168 mm NaCl, 0.1% Nonidet P-40, and 10% glycerol and subjected to immunoprecipitation and subsequent immunoblot analysis as described above.For co-immunoprecipitation analysis of endogenous β-catenin and ectopically expressed MED12, 293 cells were transfected with 6 μg of pCMV-3xFLAG-MED12 or pCMV-3x-FLAG empty vector as a negative control using FuGENE 6. 44 h after transfection, cells were treated with 30 mm LiCl for 4 h, and whole cell extracts were subsequently prepared in 0.15 m KCl buffer D containing 0.3% Nonidet P-40 and supplemented with protease inhibitors. Whole cell extracts (800 μg) were adjusted to 0.1% Nonidet P-40 and then subjected to immunoprecipitation with 1.2 μg of anti-FLAG monoclonal antibody M2 and 15 μl of a protein A-Sepharose/protein G-agarose mixture. Immune complexes were washed four times with 0.15 m KCl buffer D containing 0.1% Nonidet P-40 for 5 min at 4" @default.
• W2108124310 created "2016-06-24" @default.
• W2108124310 creator A5015331994 @default.
• W2108124310 creator A5022859329 @default.
• W2108124310 creator A5022876276 @default.
• W2108124310 creator A5091203148 @default.
• W2108124310 date "2006-05-01" @default.
• W2108124310 modified "2023-10-12" @default.
• W2108124310 title "Mediator Is a Transducer of Wnt/β-Catenin Signaling" @default.
• W2108124310 cites W1511545125 @default.
• W2108124310 cites W1537657975 @default.
• W2108124310 cites W1554815317 @default.
• W2108124310 cites W1593089530 @default.
• W2108124310 cites W1601315441 @default.
• W2108124310 cites W1655574943 @default.
• W2108124310 cites W1658957308 @default.
• W2108124310 cites W1966458894 @default.
• W2108124310 cites W1967137553 @default.
• W2108124310 cites W1967803088 @default.
• W2108124310 cites W1971082598 @default.
• W2108124310 cites W1971911912 @default.
• W2108124310 cites W1975329922 @default.
• W2108124310 cites W1977825894 @default.
• W2108124310 cites W1979993283 @default.
• W2108124310 cites W1982161126 @default.
• W2108124310 cites W1983883857 @default.
• W2108124310 cites W1985338761 @default.
• W2108124310 cites W1988658871 @default.
• W2108124310 cites W1989215255 @default.
• W2108124310 cites W1992595726 @default.
• W2108124310 cites W1993243592 @default.
• W2108124310 cites W1997669934 @default.
• W2108124310 cites W1998063596 @default.
• W2108124310 cites W2002404925 @default.
• W2108124310 cites W2004103813 @default.
• W2108124310 cites W2005088732 @default.
• W2108124310 cites W2006936902 @default.
• W2108124310 cites W2007717461 @default.
• W2108124310 cites W2012248317 @default.
• W2108124310 cites W2014228869 @default.
• W2108124310 cites W2017593144 @default.
• W2108124310 cites W2021589589 @default.
• W2108124310 cites W2023009353 @default.
• W2108124310 cites W2023219535 @default.
• W2108124310 cites W2023407460 @default.
• W2108124310 cites W2029099543 @default.
• W2108124310 cites W2035192365 @default.
• W2108124310 cites W2036130173 @default.
• W2108124310 cites W2036864436 @default.
• W2108124310 cites W2036894680 @default.
• W2108124310 cites W2039248606 @default.
• W2108124310 cites W2050414776 @default.
• W2108124310 cites W2057199920 @default.
• W2108124310 cites W2058325289 @default.
• W2108124310 cites W2058489244 @default.
• W2108124310 cites W2072179781 @default.
• W2108124310 cites W2073969798 @default.
• W2108124310 cites W2081253307 @default.
• W2108124310 cites W2081985759 @default.
• W2108124310 cites W2082135441 @default.
• W2108124310 cites W2088681495 @default.
• W2108124310 cites W2090636859 @default.
• W2108124310 cites W2092361302 @default.
• W2108124310 cites W2094184203 @default.
• W2108124310 cites W2096745402 @default.
• W2108124310 cites W2099898735 @default.
• W2108124310 cites W2102512718 @default.
• W2108124310 cites W2104490911 @default.
• W2108124310 cites W2109069210 @default.
• W2108124310 cites W2109306599 @default.
• W2108124310 cites W2112763851 @default.
• W2108124310 cites W2115001053 @default.
• W2108124310 cites W2115105467 @default.
• W2108124310 cites W2117100349 @default.
• W2108124310 cites W2117330555 @default.
• W2108124310 cites W2118344768 @default.
• W2108124310 cites W2125194610 @default.
• W2108124310 cites W2139025111 @default.
• W2108124310 cites W2139419405 @default.
• W2108124310 cites W2146167376 @default.
• W2108124310 cites W2149920358 @default.
• W2108124310 cites W2150126479 @default.
• W2108124310 cites W2152123530 @default.
• W2108124310 cites W2155507705 @default.
• W2108124310 cites W2156566553 @default.
• W2108124310 cites W2158268923 @default.
• W2108124310 cites W2158569397 @default.
• W2108124310 cites W2161225294 @default.
• W2108124310 cites W2161463427 @default.
• W2108124310 cites W2165061154 @default.
• W2108124310 cites W2169934500 @default.
• W2108124310 cites W2170709726 @default.
• W2108124310 cites W2188108992 @default.
• W2108124310 cites W2239090104 @default.
• W2108124310 cites W4242886517 @default.
• W2108124310 doi "https://doi.org/10.1074/jbc.m602696200" @default.
• W2108124310 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/16565090" @default.
• W2108124310 hasPublicationYear "2006" @default.

• next